A method for distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes and its application

Abstract

The present invention discloses a method and application for identifying Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum, specifically including screening hypervariable regions based on chloroplast genome, designing primers atpF-atpH-1F / at pF-atpH-1R with the screened hypervariable regions as templates, and performing PCR amplification on 53 samples. After Sanger sequencing, MEGA11.0 is used to evaluate the species identification ability of the screened sequences, and determine the specific DNA barcode that can be used to identify Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum. The specific DNA barcode of Gynostemma pentaphyllum is shown in SEQ ID NO.5; the specific DNA barcode of Long-stalked Gynostemma pentaphyllum is shown in SEQ ID NO.6; the specific DNA barcode disclosed in the present invention can be used for the identification of Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum original plants, seeds, rhizomes, medicinal materials and Gynostemma pentaphyllum products, providing a basis for the classification and identification of Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum species and the standardization of the Gynostemma pentaphyllum medicinal material market.

Description

Technical Field

[0001] The invention relates to the technical field of identification of Gynostemma pentaphyllum and Gynostemma pentaphyllum longiflorum, and in particular to a specific DNA barcode for identifying Gynostemma pentaphyllum and Gynostemma pentaphyllum longiflorum based on chloroplast genome. Background Art

[0002] The Chinese herbal medicine Gynostemmatis Pentaphylli is a traditional Chinese herbal medicine, and has been included in the local herbal medicine standards in 14 provinces. Gynostemma pentaphyllum ) dried whole plant. As a traditional edible and medicinal plant, Gynostemma pentaphyllum has been included in the list of health food raw materials. Because it is rich in dammarane-type saponins similar to ginsenosides, Gynostemma pentaphyllum saponins, it is known as the "Southern Ginseng". Li Shizhen's "Compendium of Materia Medica" records that Gynostemma pentaphyllum has the effects of "treating sores, scabies and insect bites, cooling blood and detoxifying, and promoting urination". Gynostemma pentaphyllum is rich in dammarane-type triterpenoid saponins and Gynostemma pentaphyllum saponins. Among them, Gynostemma pentaphyllum saponins III, IV, VIII, and XII are exactly the same as ginsenosides Rbl, Rb3, Rd and F2 respectively. In addition, Gynostemma pentaphyllum is also rich in polysaccharides, flavonoids, amino acids and trace elements. Modern research shows that it has important pharmacological effects such as regulating blood lipids, lowering blood sugar and anti-tumor, and has extremely high medicinal value. The longipes of Gynostemma pentaphyllum is similar in shape to Gynostemma pentaphyllum, but the two have different chemical compositions. The longipes mainly contains longipes gynostemma saponins, whose aglycone structure has one more furan ring than the aglycone of gynostemma saponins, and cannot be hydrolyzed into compounds such as ginsenodiol and ginsenotriol, which are completely different from the saponin components of Gynostemma pentaphyllum. Therefore, it is of great significance to accurately identify Gynostemma pentaphyllum and longipes gynostemma pentaphyllum.

[0003] The only distinguishing feature between Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum is the length of the fruit pedicel, which is less than 5 mm, while the length of the fruit pedicel of Long-stalked Gynostemma pentaphyllum is 15-20 mm. Samples that are not in the fruit maturity period cannot be distinguished between the two by morphological characteristics. Gynostemma pentaphyllum is propagated by seeds, seedlings, and rhizomes, but seeds, seedlings, and rhizomes are not the distinguishing features between Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum. During the planting process, Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum cannot be distinguished by plant morphological characteristics; the best harvesting period of Gynostemma pentaphyllum is from April to September, when the content of Gynostemma pentaphyllum saponins is high and the medicinal value is high, but this period is a non-fruiting period, and when harvesting Gynostemma pentaphyllum, Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum cannot be distinguished. If the two species cannot be correctly identified, Long-stalked Gynostemma pentaphyllum may be mistakenly planted or harvested, thus affecting the medicinal effect. Compared with morphological identification methods, DNA molecules can provide rich information for species identification, but the sequence alignment results of the plant universal DNA barcode ITS2 show that Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum cannot be distinguished. Compared with traditional DNA barcodes, the chloroplast genome has richer variable sites and stronger species resolution. Therefore, specific DNA barcodes that can effectively identify Gynostemma pentaphyllum and Gynostemma pentaphyllum longifolia can be developed based on the highly variable regions of the chloroplast genome. Combined with the plant universal DNA barcode ITS2, it can be used to identify the origin of Gynostemma pentaphyllum original plants, medicinal materials, decoction pieces and Gynostemma pentaphyllum products.

[0004] Therefore, how to develop DNA barcodes based on the chloroplast genomes of Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes and identify the two is an urgent problem that technicians in this field need to solve. Summary of the invention

[0005] In view of this, the present invention provides a method and application for distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A method for distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes, the application being:

[0008] 1) Application in distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes;

[0009] 2) Application in Gynostemma pentaphyllum breeding;

[0010] The DNA barcode of Gynostemma pentaphyllum is shown in SEQ ID NO.5;

[0011] The DNA barcode of Gynostemma pentaphyllum is shown in SEQ ID NO.6.

[0012] In the above technical solution, the DNA barcode of Gynostemma pentaphyllum and the DNA barcode of Gynostemma pentaphyllum are different at bases 330-331;

[0013] In the application, when the base is AA, it is Gynostemma pentaphyllum; when the base is TT, it is Gynostemma pentaphyllum.

[0014] In the above technical solution, the substance for detecting DNA barcode includes primer sequences, as shown in SEQ ID NO.1 to SEQ ID NO.2;

[0015] atpF-atpH-1F: 5'-CGGGATCATGTACCTTTTCG-3', such as SEQ ID NO.1;

[0016] atpF-atpH-1R: 5'-TCGTTGGGACAATAACCCAT-3', such as SEQ ID NO. 2.

[0017] The application of the kit comprising the primer sequence is:

[0018] 1) Application in distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes;

[0019] 2) Application in Gynostemma pentaphyllum breeding.

[0020] A kit comprises a primer pair shown in SEQ ID NO.1 to SEQ ID NO.2.

[0021] A DNA barcode, comprising sequences shown by SEQ ID NO.5 and SEQ ID NO.6.

[0022] The breeding method of Gynostemma pentaphyllum comprises comparing the specific DNA barcode sequences of the samples with the primer pairs shown in SEQ ID NO.3 to SEQ ID NO.4, constructing an NJ phylogenetic tree, and determining the species information of the samples.

[0023] It can be seen from the above technical solution that, compared with the prior art, the present invention provides a specific DNA barcode that can be used to identify Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum, namely, the sequences of SEQ ID NO.5 and SEQ ID NO.6. By comparison, there is an AA / TT difference at the 330-331 bases of these two sequences. Therefore, based on the specific DNA barcode, the present invention discloses primers that can effectively amplify the barcode, which can be used for the identification of Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum original plants, seeds, rhizomes, medicinal materials and Gynostemma pentaphyllum products, providing a basis for the classification and identification of Gynostemma pentaphyllum and Long-stalked Gynostemma pentaphyllum species and the standardization of the Gynostemma pentaphyllum medicinal material market. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Attached Figure 1 Global mVISTA alignment of the chloroplast genomes of Gynostemma pentaphyllum and Gynostemma longipedate.

[0026] Attached Figure 2 This is the DnaSP variation analysis diagram of the chloroplast genome of Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes (Pi>0).

[0027] Attached Figure 3 The electrophoresis diagram of primer 1F / 1R amplification for identifying Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes; M: DL2000 DNA marker; 0: Negative control; 1: PS2048MT004; 2: PS2048MT005; 3: PS2048MT006; 4: PS2048MT007; 5: PS2048MT008; 6: PS0462MT004; 7: PS0462MT005; 8:PS0462MT006; 9: PS0462MT007; 10: PS0462MT008;

[0028] Attached Figure 4 To construct the NJ phylogenetic tree of Gynostemma pentaphyllum and Gynostemma longipedate based on specific DNA barcode sequences.

[0029] Attached Figure 5 This is the NCBI BLAST comparison result of the ITS2 sequence of the sample numbered CHA01-06.

[0030] Attached Figure 6 The following are the results of NCBI BLAST comparison of ITS2 sequences of 119 samples.

[0031] Attached Figure 7 For 119 samples atpF-atpH Sequence NJ phylogenetic tree. DETAILED DESCRIPTION

[0032] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] The primer sequences used in the examples are (5′ to 3′):

[0034] atpF-atpH-1F: CGGGATCATGTACCTTTTCG, SEQ ID NO.1;

[0035] atpF-atpH-1R:TCGTTGGGACAATAACCCAT, SEQ ID NO.2;

[0036] ITS2-2F: ATGCGATACTTGGTGTGAAT, SEQ ID NO.3;

[0037] ITS2-2R:GACGCTTCTCCAGACTACAAT, SEQ ID NO.4.

[0038] Example 1 Screening of specific DNA barcodes for Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes

[0039] Using the annotated chloroplast genome of Gynostemma pentaphyllum (GenBank accession number: PP413694 (unpublished)) as a reference, mVISTA was used to map the three Gynostemma pentaphyllum species. Gynostemma pentaphyllum and 3 long-stemmed Gynostemma pentaphyllum G. longipes A global alignment of the chloroplast genomes of Figure 1 ). The variation of intergenic regions in the chloroplast genome sequences of the two species is greater than that of genic regions, such as atpF-atpH , rps16 - QUR - UUG , ccsA - nD , oeLh - UUC - T - GGU , nG - i etc. These hypervariable regions may be potential molecular markers for species identification of Gynostemma pentaphyllum and Gynostemma longipes.

[0040] DnaSP was used to calculate the nucleotide variation values ​​(Pi) of all genes and intergenic regions in the chloroplast genomes of the two species, and to detect highly variable regions and analyze the sequence difference level ( Figure 2 The average Pi value of the intergenic region of the chloroplast genome of the two species (0.001393) is greater than the average Pi value of the gene (0.000616). Combining the Pi value with the mVISTA result analysis, the present invention screened the most variable atpF-atpH The sequence is a specific DNA barcode for identifying Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes.

[0041] Gynostemma pentaphyllum atpF-atpH Sequence:

[0042] TAGTTATAACGAGAAAAGTACAGTTGGTTGTATCCAACTTATTCTTGAAATAAACAACTCGCACACACTCCCTTTCCAAAAAAAATCAATACACCAAGCACTACGCTTAGATTTATTGGATTTGTTGCTAAAATATCGGTATTAAATCCGAAACTCCCGGCGGATGGCCAGTAACCCAAAGAAATCAAAGAATCGATTACATTTTTCATACCATCTCCTTTTCTAGATAAAACTAATTATCTATTTCTTTCTATTAATTTTATATGTTTATTTTCAATTTTATTAATTTCCTATTTCGTTTCTAAATAGAGTAAAAAATATATTGATTTAAAAATCAATATATTTTTTTTTCACTTGGAAATTTCCAACAAGAAGGAAAGGATACATACTTATGAGATTCAAATTAGATACCAAGTTTTATAGTAATTGAGAAATCCCTCCCTTGTTGTAACAATCCTAAAAAAAAGTTCCATTCGACATTGGGGACTAAGAAGGGGAACGAAGAAGGCGAGTCGGTATGCTAATGCCTCATCCTCAAATCAGTCCTTCCC, as shown in SEQ ID NO.5;

[0043] Gynostemma longipes atpF-atpH Sequence:

[0044] , as shown in SEQ ID NO.6.

[0045] The comparison results showed that the two sequences only differed in bases at 330-331bp.

[0046] Example 2 Obtaining DNA barcodes specific to Gynostemma pentaphyllum and Gynostemma longipes

[0047] Experimental Materials

[0048] In this example, a total of 53 samples were collected, including 34 samples of Gynostemma pentaphyllum and 19 samples of Gynostemma pentaphyllum longipes. The specific information is shown in Table 1.

[0049] Species Collection time Sample No. Collection location Gynostemma pentaphyllum 2022.10.21 PS0462MT004-015 Ankang, Shaanxi 2022.10.21 PS0462MT016-018 Zhejiang 2022.11.01 PS0462MT019-022 Ankang, Shaanxi 2022.11.13 PS0462MT023-030 Guiyang, Guizhou 2023.09.01 PS0462MT031-037 Guiyang, Guizhou Gynostemma longipes 2023.12.10 PS2048MT004-018 Ankang, Shaanxi 2022.10.21 PS2048MT019-022 Ankang, Shaanxi 2022.10.21 PS0462MT001-003 Ankang, Shaanxi 2022.11.08 PS0462MT004-015 Ankang, Shaanxi 2023.04.15 PS0462MT016-018 Zhejiang 2023.04.17 PS0462MT019-022 Ankang, Shaanxi Genome extraction

[0050] Take about 50-100 mg of the samples in Table 1 respectively, grind them in liquid nitrogen, and perform the remaining steps according to the standard operating procedures of the plant genomic DNA extraction kit.

[0051] PCR amplification

[0052] Hypervariable regions atpF-atpHPrimers 1F / 1R were designed using the sequence as a template, such as SEQ ID NO.1~SEQ ID NO.2, which were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The primers were dissolved in sterile double distilled water and diluted to 2.5 μM.

[0053] 25 μL reaction PCR amplification system: 12.5 μL of 2×Accurate Taq premix, 1 μL of upstream and downstream primers (2.5 μM), about 50 ng of DNA template, add sterile double distilled water to make up the volume to 25 μL.

[0054] PCR reaction condition parameters: 94°C, 5 min; (94°C, 30 s, 60°C, 30 s, 72°C, 45 s), 35 cycles; 72°C, 10 min.

[0055] PCR product sequencing

[0056] The PCR products were subjected to Sanger bidirectional sequencing on an ABI3730XL sequencer, and the sequencing primers were the same as the PCR amplification primers. Figure 3 ;

[0057] Sequence splicing

[0058] In this embodiment, the software CodonCode Aligner is used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence are removed using the software, and then the low-quality parts at both ends of the sequencing results are removed, and the quality of the remaining parts is evaluated. After sequence splicing, the specific DNA barcode sequences of Gynostemma pentaphyllum, Gynostemma pentaphyllum longifolium and related counterfeit products are obtained. The specific DNA barcode sequence of Gynostemma pentaphyllum has two haplotypes (PS0462MT004-015 and PS0462MT019-034 are the same haplotype, and PS0462MT016-018 is the same haplotype), and the specific DNA barcode sequence of Gynostemma pentaphyllum longifolium is the same haplotype.

[0059] PS0462MT004: TAGTTATAACGAGAAAAGTACAGTTGGTTGTATCCAACTTATTCTTGAAATAAACAACTCGCACACACTCCCTTTCCAAAAAAAATCAATACACCAAGCACTACGCTTAGATTTATTGGATTTGTTGCTAAAATATCGGTATTAAATCCGAAACTCCCGGCGGATGGCCAGTAACCCAAAGAAATCAAAGAATCGATTACATTTTTCATACCATCTCCTTTTCTAGATAAAACTAATTATCTATTTCTTTCTATTAATTTTATATGTTTATTTTCAATTTTATTAATTTCCTATTTCGTTTCTAAATAGAGTAAAAAATATATTGATTTAAAAATCAATATATTTTTTTTTCACTTGGAAATTTCCAACAAGAAGGAAAGGATACATACTTATGAGATTCAAATTAGATACCAAGTTTTATAGTAATTGAGAAATCCCTCCCTTGTTGTAACAATCCTAAAAAAAAGTTCCATTCGACATTGGGGACTAAGAAGGGGAACGAAGAAGGCGAGTCGGTATGCTAATGCCTCATCCTCAAATCAGTCCTTCCC, as shown in SEQ ID NO.7;

[0060] PS0462MT016: TAGTTATAACGAGAAAAGTACAGTTGGTTGTATCCAACTTATTCTTGAAATAAACAACTCGCACACACTCCCTTTCCAAAAAAAATCAATACACCAAGCACTACGCTTAGATTTATTGGATTTGTTGCTAAAATATCGGTATTAAATCCGAAACTCCCGGCGGATGGCCAGTAACCCAAAGAAATCAAAGAATCGATTACATTTTTCATACGATCTCCTTTTCTAGATAAAACTAATTATCTATTTCTTTCTATTAATTTTATATGTTTATTTTCAATTTTATTAATTTCCTATTTCGTTTCTAAATAGAGTAAAAAATATATTGATTTAAAAATCAATATATTTTTTTTTTCGCTTGGAAATTTCCAACAAGAAGGAAAGGATACATACTTATGAGATTCAAATTAGATACCAAGTTTTATAGTAATTGAGAAATCCCTCCCTTGTTGTAACAATCCTAAAAAAAAGTTCCATTCGACATTGGGGACTAAGAAGGGGAACGAAGAAGGCGAGTCGGTATGCTAATGCCTCATCCTCAAATCAGTCCTTCCC, as shown in SEQ ID NO.8;

[0061] PS2048MT004:, as shown in SEQ ID NO.6.

[0062] Example 3 Identification and analysis of specific DNA barcodes of Gynostemma pentaphyllum and Gynostemma longipes

[0063] K2P distance

[0064] The intra-species and inter-species K2P distances of the high-quality sequences obtained by sequencing were calculated according to MEGA11.0. In the present invention, the minimum inter-species genetic distance was greater than the maximum intra-species genetic distance, and there was no overlap, indicating that the obtained sequences met the requirements of DNA barcodes (Table 2).

[0065] Species Genetic distance (average genetic distance) Gynostemma pentaphyllum 0-0.0036389（0.0006032） Gynostemma longipes 0 Gynostemma pentaphyllum and Gynostemma longipes 0.0036397-0.007295（0.003962） NJ phylogenetic tree

[0066] The NJ phylogenetic tree was constructed using MEGA 11.0, and the bootstrap replication value was set to 1000. In the present invention, Gynostemma pentaphyllum was clustered into one branch, and Long-stalked Gynostemma pentaphyllum was clustered into one branch, indicating that atpF-atpH Can be used as a specific DNA barcode for the identification of Gynostemma pentaphyllum and Gynostemma longipes ( Figure 4 ).

[0067] Example 4 Identification and analysis of the original species of samples from the entire industrial chain of Gynostemma pentaphyllum

[0068] Experimental Materials

[0069] In this embodiment, a total of 125 samples of the entire Gynostemma pentaphyllum industry chain were collected, including 66 samples from the upstream, including 6 seeds, 48 ​​seedlings, and 12 roots, and 59 samples from the mid- and downstream, including 18 pieces of medicinal materials and 41 Gynostemma pentaphyllum teas. Specific information is shown in Table 3.

[0070] Sample source Location Sample quantity Sample No. Collection location Upstream seed 6 ZZ01-06 Ankang, Shaanxi blade 6 ZM01-06 Zhangzhou, Fujian blade 6 ZM07-12 Guiyang, Guizhou blade 6 ZM13-18 Zhangzhou, Fujian blade 6 ZM19-24 Zhangzhou, Fujian blade 6 ZM25-30 Ji'an, Jiangxi blade 6 ZM31-36 Ji'an, Jiangxi blade 6 ZM37-42 Hubei Enshi blade 6 ZM43-48 Zhangzhou, Fujian root 6 GEN01-06 Henan Pingdingshan root 6 GEN07-12 Ankang, Shaanxi Midstream and downstream Whole herb 6 YP01-06 Chengdu, Sichuan* Whole herb 6 YP07-12 Jieyang, Guangdong* Whole herb 6 YP13-18 Kunming, Yunnan* Whole herb 5 CHA07-11 Anhui Bozhou* Whole herb 6 CHA12-17 Shaoyang, Hunan* Whole herb 6 CHA18-23 Laibin, Guangxi* Whole herb 6 CHA24-29 Guilin, Guangxi* Whole herb 6 CHA30-35 Yulin, Guangxi* Whole herb 6 CHA36-41 Ankang, Shaanxi* Note: * indicates the place where the sample was purchased.

[0071] Genome extraction

[0072] Take about 100 mg of the samples in Table 3 respectively, grind them in a grinder, and perform the remaining steps according to the standard operating procedures of the plant genomic DNA extraction kit.

[0073] PCR amplification

[0074] Using the universal primer 2F / 3R of ITS2 sequence, as shown in SEQ ID NO.3 to SEQ ID NO.4; and the screened hypervariable region atpF-atpH Sequence primers 1F / 1R, such as SEQ ID NO.1~SEQ ID NO.2, were used for PCR amplification of samples, as shown in Table 1, and were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The primers were dissolved in sterile double distilled water and diluted to 2.5 μM.

[0075] 25 μL reaction PCR amplification system: 12.5 μL of 2× Accurate Taq premix, 1 μL each of upstream and downstream primers (2.5 μM), about 50 ng DNA template, add sterile double distilled water to make up the volume to 25 μL.

[0076] atpF-atpH Sequence PCR reaction condition parameters: 94°C, 5 min; (94°C, 30 s, 60°C, 30 s, 72°C, 45 s), 35 cycles; 72°C, 10 min.

[0077] ITS2 sequence PCR reaction condition parameters: 94°C, 5 min; (94°C, 30 s; 56°C, 30 s; 72°C, 45 s), 40 cycles; 72°C, 10 min.

[0078] PCR product sequencing

[0079] The PCR products were subjected to Sanger bidirectional sequencing on an ABI3730XL sequencer, and the sequencing primers were the same as the PCR amplification primers.

[0080] Sequence splicing

[0081] In this example, the software CodonCode Aligner was used for sequence splicing and proofreading. For the ITS2 sequence: the 5.8S and 28S regions at both ends of the sequence were first removed using the software, and then the quality of the remaining part was evaluated. After sequence splicing, the ITS2 sequence of the sample was obtained. atpF-atpH Sequence: First, use the software to remove the primer regions at both ends of the sequence, then remove the low-quality parts at both ends of the sequencing results, and perform quality assessment on the remaining parts. Perform sequence splicing.

[0082] Result determination

[0083] In this embodiment, NCBI BLAST was used to perform ITS2 sequence alignment. The obtained ITS2 sequences were aligned, and the BLAST alignment results showed that the species information of the sample numbered CHA01-06 was Ageratum ( Ageratum conyzoides )( Figure 5 ). The species information of the other 119 samples was Gynostemma pentaphyllum or Gynostemma longipes ( Figure 6 ). The 119 samples were atpF-atpH The sequences were aligned with specific DNA barcode sequences to construct the NJ phylogenetic tree ( Figure 7 ), determine the sample species information, the results show that 107 samples (sample number: ZZ01-06, ZM01-48, GEN01-12, YP01-06, CHA07-41) are Gynostemma pentaphyllum, 12 samples (sample number: YP07-18) are Gynostemma pentaphyllum longifolia. In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same and similar parts between the embodiments can be referred to each other. For the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and the relevant parts can be referred to the method part.

[0084] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes, characterized in that: The following steps are involved: 1) Screening of specific DNA barcodes for Gynostemma pentaphyllum and Gynostemma longipes: Based on the global alignment of chloroplast genomes, atpF-atpH sequences were screened as specific DNA barcodes for distinguishing Gynostemma pentaphyllum and Gynostemma longipes. Obtaining specific DNA barcodes for Gynostemma pentaphyllum and Gynostemma longipes: The primers atpF-atpH-1F / atpF-atpH-1R were designed with the screened hypervariable region atpF-atpH sequence as a template, and PCR amplification and sequencing were performed with the genomic DNA of Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes as a template; 3) Identification and analysis of specific DNA barcodes of Gynostemma pentaphyllum and Gynostemma longipes: The intra-species and inter-species K2P distances of high-quality sequences obtained by sequencing were calculated using MEGA11.0, and the NJ phylogenetic tree was constructed to determine the species identification efficiency of specific DNA barcodes. The primer sequences of atpF-atpH-1F / atpF-atpH-1R are as follows: atpF-atpH-1F: 5'-CGGGATCATGTACCTTTTCG-3', SEQ ID NO.1; atpF-atpH-1R: 5'-TCGTTGGGACAATAACCCAT-3', SEQ ID NO.2; The specific DNA barcode of Gynostemma pentaphyllum obtained by screening in step (2) is shown as SEQ ID NO.5; the specific DNA barcode of Gynostemma pentaphyllum longipes is shown as SEQ ID NO.

6.

2. The use of primers for detecting DNA barcodes, characterized in that: The application is: 1) Application in distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes; 2) Application in Gynostemma pentaphyllum breeding; The specific DNA barcode of Gynostemma pentaphyllum is shown in SEQ ID NO.5; the specific DNA barcode of Gynostemma pentaphyllum is shown in SEQ ID NO.6; The specific DNA barcodes of Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes were obtained by amplification using atpF-atpH-1F / atpF-atpH-1R primers, and the primer sequences are as follows: atpF-atpH-1F: 5'-CGGGATCATGTACCTTTTCG-3', SEQ ID NO.1; atpF-atpH-1R: 5'-TCGTTGGGACAATAACCCAT-3', SEQ ID NO.

2.

3. The use according to claim 2, characterized in that: The specific DNA barcode of Gynostemma pentaphyllum and that of Gynostemma pentaphyllum are different at bases 330-331; In the application, when the base is AA, it is Gynostemma pentaphyllum; when the base is TT, it is Gynostemma pentaphyllum.

4. An application of a kit, the kit comprising the primer pairs shown in SEQ ID NO.1 to SEQ ID NO.2; the application is: 1) Application in distinguishing Gynostemma pentaphyllum and Gynostemma pentaphyllum longipes; 2) Application in Gynostemma pentaphyllum breeding.

5. A specific DNA barcode, characterized in that: The specific DNA barcode includes the sequences shown in SEQ ID NO.5 and SEQ ID NO.6.

Images