A dnd gene and identification primer set and its application in identifying germ cells of grass carp and red-eyed trout

Abstract

The present invention discloses a dnd The invention discloses a gene and an identification primer set and an application thereof in identifying the germ cells of grass carp and red-eyed trout, belonging to the technical field of fish germ cell identification. dnd The complete cDNA sequence of the gene is obtained by comparing the cDNA sequence to obtain a primer set consisting of a specific primer and a universal primer, and the PCR technology can be used to quickly and accurately distinguish the germ cells of grass carp and red-eyed trout. The primer set of the present invention includes the grass carp and red-eyed trout shown in SEQ ID NO.3-SEQ ID NO.8 dnd Gene-specific primers and universal primers were used to identify the germ cells of grass carp and red-eyed trout by PCR amplification and agarose gel electrophoresis. dnd Specific primers can only identify grass carp germ cells and amplify the target band, red eye trout dnd Specific primers can only identify the germ cells of red-eyed trout and amplify the target band, which can efficiently and accurately distinguish the germ cells of grass carp and red-eyed trout.

Description

Technical Field

[0001] The present invention belongs to the technical field of fish germ cell identification and specifically relates to a dnd Gene and identification primer sets and their application in identifying germ cells of grass carp and red-eyed trout. Background Art

[0002] grass carp( Ctenopharyngodon idella ) is the main species of freshwater aquaculture in my country. In recent years, the degradation of grass carp germplasm has seriously restricted the healthy and sustainable development of grass carp aquaculture in my country. At present, there are still new grass carp varieties that have not been approved, so it is urgent to develop new technologies to accelerate the process of breeding new grass carp varieties. Reproductive stem cell transplantation technology is to transplant the spermatogonial stem cells of the donor into the recipient, and after being embedded in the recipient's gonads, they proliferate, differentiate and develop, and finally produce the donor's functional gametes. This technology has great application prospects in the preservation of germplasm resources and the rapid breeding of new varieties.

[0003] Grass carp and red-eyed trout belong to the same class of bony fishes, order of Cypriniformes, family of Cyprinidae, subfamily of Leucopinae, and belong to the genera of Grass Carp and Red-eyed Trout respectively. Red-eyed trout can reach sexual maturity for the first time at the age of 2, while grass carp reaches sexual maturity relatively late, generally at the age of 4. Therefore, the establishment of grass carp spermatogonial stem cell transplantation technology can shorten the breeding cycle of grass carp and provide a new and effective way to accelerate the selection and breeding of new excellent grass carp varieties. Summary of the invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a dnd The gene and identification primer set and their application in identifying the germ cells of grass carp and red-eyed trout. The primer set and differentiation method provided by the invention can efficiently and accurately differentiate the germ cells of grass carp and red-eyed trout, and have broad market application prospects.

[0005] In order to achieve the above-mentioned invention object, the present invention adopts the following technical scheme to achieve it:

[0006] The present invention provides a dnd The gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] The present invention provides a method for treating red-eyed trout. dnd The gene has a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The invention provides a primer set for identifying germ cells of grass carp and red-eyed trout, the primer set comprising germ cells of grass carp and red-eyed trout dnd Complete cDNA sequence of the gene, specific primers and universal primers; the grass carp dnd The cDNA sequence of the gene is shown in SEQ ID NO.1; the red-eyed trout dndThe cDNA sequence of the gene is shown in SEQ ID NO.2.

[0009] Further, the specific primers include grass carp dnd Trout erythrocephalus dnd Gene-specific primers:

[0010] The grass carp dnd The gene-specific primers were 5′- AACCGAGGCTTTGCCTACGT - 3′ and 5′ -GCCATCATTTCATCTCTCGA - 3′;

[0011] Red-eyed trout dnd The gene-specific primers were 5′- AACCGAGGCTTTGCCTATGC - 3′ and 5′ -CAACCCTTAAAATAGCACCT - 3′;

[0012] Grass carp and redeye trout dnd The universal primers for the gene were 5'-TCCTTGTTTGATGGGTTGT-3' and 5'-ACTCATTGCCTGCTCTTTT-3'.

[0013] The invention provides application of the primer set in identifying germ cells of grass carp and red-eyed trout.

[0014] Furthermore, the application comprises the following steps:

[0015] (1) Extracting total RNA from the gonads of grass carp and redeye trout;

[0016] (2) Reverse transcription of total RNA into cDNA;

[0017] (3) Using PCR to identify grass carp and red-eyed trout dnd The gene was amplified, and the primers were as shown in SEQ ID No.3-SEQ ID No.8;

[0018] (4) Identification of germ cells of grass carp and red-eyed trout by agarose gel electrophoresis: In grass carp and red-eyed trout, grass carp dnd Gene-specific primers can only identify grass carp germ cells and amplify the target band, red-eyed trout dnd Specific primers can only recognize the germ cells of red-eyed trout and amplify the target band.

[0019] Furthermore, the PCR amplification system was: 5µL 2×Taq master mix, 3.5µL ddH2O, 1µL cDNA, 0.4µL upstream primer, and 0.4µL downstream primer.

[0020] Furthermore, grass carp dnd Trout erythrocephalus dnd The PCR amplification procedure of the universal primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle included 94°C for 30 s, 58°C for 30 s, 72°C for 15 s, and finally 72°C for 10 min. dnd The PCR amplification program of gene-specific primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle including 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, and finally extension at 72°C for 10 min.

[0021] Furthermore, grass carp dnd The specific primers amplified a target band of 569 bp, which corresponds to the germ cells of grass carp, and no target band of 569 bp, which corresponds to the germ cells of red-eyed trout; dnd The specific primers amplified a target band of 1501 bp, which corresponds to the reproductive cells of red-eyed trout, and amplified a target band without 1501 bp, which corresponds to the reproductive cells of grass carp.

[0022] The invention provides a kit for distinguishing germ cells of grass carp and red-eyed trout, comprising a PCR reaction solution and the primer set.

[0023] The invention provides the application of the kit in detecting whether the transplantation of grass carp and red-eyed trout germ cells is successful, identifying the germ cell chimerism and efficiency, and monitoring the development of donor germ cells in recipient gonads.

[0024] Compared with the prior art, the advantages and technical effects of the present invention are: using PCR technology and the primer set of the present invention to detect grass carp and red eye trout dnd Gene amplification, grass carp dnd Gene-specific primers can only recognize grass carp germ cells and amplify grass carp dnd Gene, redeye trout dnd Gene-specific primers can only recognize red-eyed trout germ cells and amplify red-eyed trout dnd Genes, grass carp and redeye trout dnd Gene universal primers can identify and amplify germ cells of grass carp and red-eyed trout dnd Gene, using agarose gel electrophoresis, based on the PCR product comparison analysis to distinguish the germ cells of grass carp and red-eyed trout, combining the advantages of simple and rapid PCR technology and the strong specificity of specific primers, this invention can efficiently and accurately distinguish the germ cells of grass carp and red-eyed trout.

[0025] The target gene was PCR amplified using the primer set. dndThe gene is amplified by PCR, and the germ cells of grass carp and red-eyed trout can be quickly and accurately distinguished based on the PCR product; the universal primer is used as a control in the process of identifying the germ cells. The primer set and kit provided by the present invention can be used to detect whether the transplantation of grass carp and red-eyed trout germ cells is successful, identify the chimerism of germ cells and their efficiency, and monitor the development of donor germ cells in the recipient gonads. The primers and method for distinguishing grass carp and red-eyed trout provided by the present invention are effective methods for solving the detection of exogenous germ cells after transplantation, and have good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It's grass carp dnd The full-length cDNA sequence of the gene and its amino acid sequence;

[0027] Figure 2 Red-eyed trout dnd The full-length cDNA sequence of the gene and its amino acid sequence;

[0028] Figure 3 It's grass carp and red-eye trout. dnd cDNA sequence of the gene and primer locations;

[0029] Figure 4 The gonads of grass carp and red-eyed trout dnd Agarose gel electrophoresis of gene PCR amplification products. DETAILED DESCRIPTION

[0030] The purpose, technical solutions and features of the present invention are further clearly and completely explained below through specific embodiments.

[0031] Example 1

[0032] The present invention uses primers and PCR technology to distinguish the germ cells of grass carp and red-eyed trout. The specific technical scheme is as follows:

[0033] 1. Tissue sampling: Fresh gonads were minced and stored in RNA preservation solution (Vivacell, China, LOT: 2306021) at 4°C overnight, and transferred to -20°C the next day until use.

[0034] 2. Total RNA extraction and reverse transcription: Gonadal total RNA was extracted using an RNA extraction kit (Vazyme, China, LOT: 7E0552A4), the concentration was measured, and the RNA quality was detected by agarose gel electrophoresis. 1 µg of total RNA was reverse transcribed into cDNA using a reverse transcription kit (TaKaRa, Japan, LOT: AM62083A), and stored at −20°C after 4-fold dilution until use.

[0035] 3. Obtain the full-length cDNA sequence of the gene by RACE technology: SMARTer® RACE 5' / 3' Kit (TaKaRa, Japan, LOT: 2104231A, 1909925E) and SeqAmp TM Grass carp and red-eyed trout were obtained by DNA Polymerase (TaKaRa, Japan, LOT: 2110832A) kit dnd The full-length cDNA sequence of the gene, Grass carp dnd The full-length cDNA of the gene is 2570 bp, and its nucleotide sequence is shown in SEQ ID NO.1 ( Figure 1 ), red-eyed trout dnd The full-length cDNA of the gene is 2566 bp, and its nucleotide sequence is shown in SEQ ID NO.2 ( Figure 2 );

[0036] 4. Primer design: By comparing grass carp and red-eyed trout dnd The corresponding specific primers and universal primers were designed based on the gene nucleotide sequence (Table 1):

[0037] Table 1 PCR amplification primers

[0038]

[0039] 5. Polymerase chain reaction (PCR): using grass carp and red-eyed trout dnd Gene primers (Table 1 and Figure 3 ), and PCR amplification of the target gene was performed.

[0040] The PCR system was: 5 µL 2× Taq Plus Master Mix Ⅱ (Vazyme, China, LOT: 7E781J3), 3.5 µL ddH2O, 1 µL cDNA, 0.4 µL upstream primer, and 0.4 µL downstream primer.

[0041] grass carp dnd Trout erythrocephalus dnd The PCR amplification program of universal primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle included 94°C for 30 s, 58°C for 30 s, 72°C for 15 s, and finally 72°C for 10 min. dnd The PCR amplification program of specific primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle including 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, and finally extension at 72°C for 10 min.

[0042] 6. Agarose gel electrophoresis results: Take 2000bp marker and PCR product and perform electrophoresis on 1.5% agarose gel. Figure 4 As shown, in grass carp and red-eyed trout, grass carp dnd The specific primers amplified the target band (569 bp), which corresponds to the germ cells of grass carp. dnd The specific primers amplified the target band (569 bp), which corresponds to the reproductive cells of red-eyed trout; dnd The specific primers amplified the target band (1501bp), which corresponds to the reproductive cells of red-eyed trout. dnd Specific primers amplified the target band (1501bp), corresponding to the germ cells of grass carp; grass carp and red-eyed trout dnd After amplification with universal primers, the target bands were found (grass carp: 566bp, red-eyed trout: 551bp).

[0043] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. Application of a primer set in identifying germ cells of grass carp and red-eyed trout, characterized in that: The primer set includes grass carp dnd Trout erythrocephalus dnd Gene-specific primers and universal primers; The grass carp dnd The specific primers of the gene are shown in SEQ ID NO.3 and SEQ ID NO.4; Red-eyed trout dnd The specific primers of the gene are shown in SEQ ID NO.5 and SEQ ID NO.6; The universal primers are shown in SEQ ID NO.7 and SEQ ID NO.8; Wherein, the grass carp dnd The cDNA sequence of the gene is shown in SEQ ID NO.1; the red-eyed trout dnd The cDNA sequence of the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The application comprises the following steps: (1) Extracting total RNA from the gonads of grass carp and redeye trout; (2) Reverse transcription of total RNA into cDNA; (3) Using PCR to identify grass carp and red-eyed trout dnd The gene was amplified by PCR, and the primers were shown in SEQ ID No.3-SEQ ID No.8; (4) Identification of germ cells of grass carp and red-eyed trout by agarose gel electrophoresis: Grass carp dnd Gene-specific primers can only identify grass carp germ cells and amplify the target band, red-eyed trout dnd Specific primers can only recognize the germ cells of red-eyed trout and amplify the target band.

3. The use according to claim 2, characterized in that: The PCR amplification system is: 5µL 2×Taq Plus Master Mix Ⅱ, 3.5µL ddH2O, 1µL cDNA, 0.4µL upstream primer, and 0.4µL downstream primer.

4. The use according to claim 2, characterized in that: grass carp dnd The PCR amplification procedure of gene-specific primers and universal primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle including 94°C for 30 s, 58°C for 30 s, 72°C for 15 s, and finally extension at 72°C for 10 min. dnd The PCR amplification program for gene-specific primers and universal primers was as follows: after pre-denaturation at 94°C for 5 min, 35 amplification cycles were performed, each cycle including 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, and finally extension at 72°C for 10 min.

5. The use according to claim 2, characterized in that: grass carp dnd The target band of 569 bp amplified by gene-specific primers corresponds to the germ cells of grass carp, and the target band of 569 bp amplified by gene-specific primers corresponds to the germ cells of red-eyed trout; dnd The gene-specific primers amplified a target band of 1501 bp, which corresponded to the germ cells of red-eyed trout, and amplified a target band without 1501 bp, which corresponded to the germ cells of grass carp.

Images