A KASP molecular marker associated with SSC content in non-heading Chinese cabbage and its application

Abstract

This invention discloses a KASP molecular marker related to the SSC content of non-heading Chinese cabbage and its application. The molecular marker is located at 13757749 bp on chromosome A10 of the non-heading Chinese cabbage genome, where an A-to-G point mutation occurs. The KASP primer set used to amplify the molecular marker includes forward primer F1, forward primer F2, and reverse primer R. The nucleotide sequence of forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of reverse primer R is shown in SEQ ID NO:4. This KASP molecular marker can efficiently and accurately identify whether a non-heading Chinese cabbage variety has a high SSC content, significantly improving breeding efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, and in particular relates to a KASP marker related to the SSC (soluble solids) content of non-heading Chinese cabbage and its application. Background Technology

[0002] Non-heading Chinese cabbage (Brassica rapa ssp. chinensis), also known as bok choy or baby bok choy, is a subspecies of Chinese cabbage belonging to the Brassicaceae family. Native to my country, it is characterized by its short growing season, rich nutrition, and strong adaptability, and is widely cultivated throughout the country, especially in the Yangtze River basin, playing a vital role in ensuring the vegetable supply for residents. With socio-economic development and improved living standards, people are increasingly emphasizing health and nutrition. Therefore, quality traits have gradually become one of the important target traits in the breeding of new non-heading Chinese cabbage varieties. Soluble solids content (SSC), which includes soluble sugars, soluble proteins, organic acids, and volatile aromatic substances, is an important indicator for evaluating the taste and nutritional quality of non-heading Chinese cabbage. SSC is a complex quantitative trait controlled by multiple genes and is easily affected by various factors such as soil nutrients and climate. Inaccurate phenotypic identification can significantly impact the breeding process of high-quality Chinese cabbage varieties.

[0003] Marker-assisted selection (MAS) breeding technology can rapidly and accurately determine the selective nucleotide polymorphisms (SNPs) of large quantities of non-heading Chinese cabbage materials or germplasm resources, eliminating the cumbersome steps of determining SNPs through physiological methods and avoiding the influence of other environmental factors on the SNP determination results. Therefore, it can greatly improve the efficiency and accuracy of breeding selection and accelerate the breeding process. KASP (Kompetitive Allele-Specific PCR) technology is one type of MAS, with advantages such as high accuracy, strong site adaptability, low cost, and suitability for detecting SNP sites in large samples. However, there are currently no reports on molecular markers related to SNPs in non-heading Chinese cabbage. Therefore, developing KASP molecular markers related to SNPs in non-heading Chinese cabbage is of great significance for improving the quality breeding level of non-heading Chinese cabbage in my country. Summary of the Invention

[0004] To overcome the shortcomings and deficiencies of the prior art, the purpose of this invention is to provide a KASP label related to the SSC (soluble solids) content of non-heading Chinese cabbage and its application.

[0005] This invention is achieved by using a KASP marker associated with the SSC content of non-heading Chinese cabbage. The molecular marker is located at 13,757,749 bp on chromosome A10 of the non-heading Chinese cabbage genome, where a point mutation from A to G occurs. The nucleotide sequences 150 bp upstream and downstream of this site are shown in SEQ ID NO:1.

[0006] The present invention further discloses a KASP primer set related to the SSC content of non-heading Chinese cabbage, the primer set including forward primer F1, forward primer F2 and reverse primer R; wherein, the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:4.

[0007] The forward primer F1 is composed of KASP13757749-F1 and its 5' end connected to a fluorescent adapter sequence. The nucleotide sequence of KASP13757749-F1 is shown in SEQ ID NO:2, and the connected fluorescent adapter is a FAM fluorescent adapter. The nucleotide sequence of the FAM fluorescent adapter is shown in SEQ ID NO:5.

[0008] The forward primer F2 is composed of KASP13757749-F2 and its 5' end connected to another fluorescent adapter sequence. The nucleotide sequence of KASP13757749-F2 is shown in SEQ ID NO:3, and the connected fluorescent adapter is a HEX fluorescent adapter. The nucleotide sequence of the HEX fluorescent adapter is shown in SEQ ID NO:6.

[0009] The present invention further discloses a kit for identifying the SSC content of non-heading Chinese cabbage, the kit comprising the above-mentioned KASP primer set.

[0010] This invention further discloses the application of the above-mentioned KASP molecular marker, KASP primer set or kit in the identification of SSC content in non-heading Chinese cabbage, or in the breeding of non-heading Chinese cabbage.

[0011] This invention further discloses a method for genotyping using KASP molecular markers. The method includes the following steps: using genomic DNA from a non-heading Chinese cabbage sample as a template, performing PCR amplification using the primer set of the aforementioned KASP molecular markers, detecting the fluorescence of the amplification products, and completing genotyping based on the fluorescence signal value.

[0012] This invention further discloses a method for identifying the SSC content of non-heading Chinese cabbage using KASP molecular markers. The method uses genomic DNA from the non-heading Chinese cabbage sample as a template, performs PCR amplification using the aforementioned primer set of KASP molecular markers, and detects the fluorescence of the amplification products. Specifically, if the amplification result shows an A base at 13757749 bp, the non-heading Chinese cabbage sample is considered to have a high SSC content; if the amplification result shows a G base at 13757749 bp, the non-heading Chinese cabbage sample is considered to have a low SSC content.

[0013] Compared to the shortcomings and deficiencies of existing technologies, this invention has the following beneficial effects: The KASP marker of this invention can determine the SSC content of non-heading Chinese cabbage, and is characterized by its simple operation and low cost. It can efficiently predict the SSC content of non-heading Chinese cabbage samples. This marker can be applied to the breeding of non-heading Chinese cabbage varieties with high SSC content, assisting in the quality breeding of non-heading Chinese cabbage, improving breeding efficiency, and shortening the breeding cycle, and has important application prospects. Attached Figure Description

[0014] Figure 1 This is a Manhattan plot of genome-wide association analysis of soluble solids content in non-heading Chinese cabbage in Example 1 of the present invention;

[0015] Figure 2 This is a genotyping diagram of different non-heading Chinese cabbage germplasms using the molecular marker KASP13757749 in Example 1 of the present invention; wherein, the small circle in ellipse 1 represents the non-heading Chinese cabbage germplasm with high SSC content and genotype (A / A), the small circle in ellipse 3 represents the non-heading Chinese cabbage germplasm with low SSC content and genotype (G / G), and the small circle in ellipse 2 represents the template-free control NTC. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0017] This invention utilizes genome-wide association analysis (GWAS) to identify a locus associated with the soluble solids (SSC) content of non-heading Chinese cabbage, and develops a KASP molecular marker associated with SSC content based on this locus.

[0018] Example 1: Screening to identify SNP sites associated with the soluble solids content of non-heading Chinese cabbage.

[0019] This invention uses 164 collected and preserved germplasm resources of non-heading Chinese cabbage as experimental materials, which were planted in the experimental base of Jiangsu Academy of Agricultural Sciences in Liuhe District, Nanjing City in the spring of 2022. During the commercial maturity period of the non-heading Chinese cabbage, the soluble solids (SSC) content of the leaves was determined using a refractometer method. The measurement results are shown in Table 1.

[0020] Table 1. Statistical Table of Germplasm Resources and SSC Content of Non-heading Chinese Cabbage

[0021]

[0022]

[0023]

[0024] Method for determining soluble solids content: (1) Take fresh leaf samples, chop and mix them, accurately weigh 100g and put them into a high-speed tissue homogenizer to be crushed. Use two layers of gauze to squeeze out the homogenate juice for determination. (2) Use distilled water to calibrate the refractometer reading and adjust the soluble solids content to 0% at 20℃. (3) After wiping the prism surface dry, add 2-3 drops of the sample liquid to be tested to the center of the prism, immediately close the upper and lower prisms, rotate the achromatic adjustment knob to divide the field of view into two parts, light and dark, and then rotate the prism knob to make the light and dark boundary line located at the cross intersection of the objective lens. Read the percentage shown on the scale.

[0025] Genome resequencing: DNA was extracted from the leaves of the experimental materials in Table 1 using a kit method. After the sample DNA passed the test, it was fragmented by sonication. The fragmented DNA was then purified, end-repaired, 3'-end augmented with A, and sequencing adapters were ligated. Fragment size selection was performed by agarose gel electrophoresis, followed by PCR amplification to form sequencing libraries. The constructed libraries underwent quality control, and those that passed were sequenced using the Illumina HiSeq platform. Filtered clean reads were compared with the reference genome of non-heading Chinese cabbage using bwa-mem2 software, and the results showed an average sequencing depth of 13.6×.

[0026] Genome-wide association analysis (GWAS): SNP calling was performed using GATK software. SNPs were filtered according to minor allele frequency (MAF) > 0.05 and locus integrity (INT) > 0.8, resulting in 2,091,473 highly congruent SNPs. Genome-wide association analysis (GWAS) was then performed using EMMAX software with a mixed linear model to analyze genotype and phenotypic traits. Simultaneously, -Log... 10 P ≥ 7.5 is used as the significance threshold when the SNP's -Log 10A p-value ≥ 7.5 indicates a significantly associated locus. Two loci significantly associated with non-heading Chinese cabbage spiny stem cells (SSCs) were identified: 13755191 bp (G / A) and 13757749 bp (T / C) on chromosome A10. 10 The maximum values ​​of P are 7.83 and 7.53, respectively. Figure 1 ).

[0027] Example 2: Development of KASP-labeled primer sets

[0028] A 301 bp sequence was obtained by selecting 150 bp sequences upstream and downstream of position 13755191 bp on chromosome A10 of the non-heading Chinese cabbage genome, as shown in SEQ ID NO:1. The molecular marker at position 13755191 bp on chromosome A10 of the non-heading Chinese cabbage genome corresponds to position 151 of SEQ ID NO:1, where the nucleotide is either A or G.

[0029] To address the SNP variation at this location, KASP primers were designed using the Poly Marker website according to KASP design principles. Two forward primers, KASP13755191-F1 / KASP13755191-F2, and one universal reverse primer, KASP13755191-R, were designed, with the following nucleotide sequences:

[0030] KASP13755191-F1: 5'-CATTTGCCGTCGGCGAACATCTATG (SEQ ID NO: 2);

[0031] KASP13755191-F2: 5'-CATTTGCCGTCGGCGAACATCTATA (SEQ ID NO: 3);

[0032] KASP13755191-R: 5'-CAACGAGAGAGAGAAGAAAG (SEQ ID NO: 4).

[0033] The KASP primers were designed based on the genotypic variations of single plants with high and low SSC content at position 13755191 bp on chromosome A10, where the high SSC genotype is A / A and the low SSC genotype is G / G.

[0034] The 5' end of primer KASP13755191-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of primer KASP13755191-F2 is ligated to the HEX fluorescent adapter sequence. The primer sequences after ligation with fluorescent adapters are as follows:

[0035] Forward primer F1: GAAGGTGACCAAGTTCATGCT CATTTGCCGTCGGCGAACATCTATG (SEQ ID NO:7, where the underlined part is the FAM fluorescent tag sequence);

[0036] Forward primer F2: GAAGGTCGGAGTCAACGGATT CATTTGCCGTCGGCGAACATCTATA (SEQ ID NO:8, where the underlined part is the HEX fluorescent tag sequence);

[0037] Reverse primer R: CAACGAGAGAGAGAGAAGAAAG (SEQ ID NO:4).

[0038] Genomic DNA extraction from the sample to be tested:

[0039] Genomic DNA was extracted from leaves of non-heading Chinese cabbage using the CTAB (hexadecyl trimethyl ammonium bromide) method.

[0040] Example 3: Genotyping and SSC content identification of non-heading Chinese cabbage germplasms with different SSCs

[0041] The synthesized forward primers F1, F2, and reverse primer R were dissolved in TE (pH 8.0) to a concentration of 10 μM, and then a primer mixture (KASP Primer Mix) was prepared at a ratio of F1:F2:R = 1:1:3. Using the genomic DNA of the non-heading Chinese cabbage germplasm resources obtained in step (1) as templates, PCR reactions were performed according to the following reaction system and procedure. For the negative control, ddH2O was used instead of template DNA.

[0042] The total volume of the PCR reaction system was 10 μL, including 5 μL of 2×KASP mastermix, 2.5 μL of Primer Mix, and 2.5 μL of template DNA (30 ng / μL). The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; annealing and extension at 61℃~56℃ for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ in each cycle; the second cycle consisted of 94℃ denaturation for 20 s; annealing and extension at 55℃ for 60 s, for a total of 26 cycles.

[0043] When performing fluorescence detection on the amplification products, if the sample PCR product only detects the fluorescence signal corresponding to the forward primer F1 which is linked to the fluorescent adapter sequence, the genotype at the detection site is G / G, and it is determined to be a single plant with low SSC content; if the sample PCR product only detects the fluorescence signal corresponding to the forward primer F2 which is linked to the fluorescent adapter sequence, the genotype at the detection site is A / A, and it is determined to be a single plant with high SSC content.

[0044] Genotyping of 38 non-heading Chinese cabbage germplasm resources with different SSC contents was performed using the marker KASP13755191. The results are as follows: Figure 2 As shown in Table 2, among the A / A genotype plants, only one plant had an SSC content of less than 5%, achieving an accuracy rate of 90.91%.

[0045] Table 238 results of SSC content and genotyping of non-heading Chinese cabbage samples.

[0046]

[0047]

[0048] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A KASP primer set related to the SSC content of non-heading Chinese cabbage, characterized in that, The primer set includes forward primer F1, forward primer F2 and reverse primer R; wherein the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:

4.

2. A kit for identifying the SSC content of non-heading Chinese cabbage, characterized in that, This kit contains the KASP primer set as described in claim 1.

3. The application of the KASP primer set according to claim 1 or the kit according to claim 2 in the identification of SSC content in non-heading Chinese cabbage; wherein, The genotype AA was determined to be a single plant with high SSC content.

4. A method for genotyping using KASP molecular markers, characterized in that, The method includes the following steps: using the genomic DNA of the non-heading Chinese cabbage sample to be tested as a template, performing PCR amplification reaction with the KASP primer set described in claim 1, detecting the fluorescence of the amplification product, and completing genotyping based on the fluorescence signal value; wherein, the genotype AA is determined to be a single plant with high SSC content.

5. A method for identifying the SSC content of non-heading Chinese cabbage using a KASP primer set, characterized in that, Using the genomic DNA of the non-heading Chinese cabbage sample to be tested as a template, PCR amplification was performed using the KASP primer set described in claim 1. The amplification products were then subjected to fluorescence detection. If the amplification result showed that the genotype was AA, it was determined that the SSC content of the non-heading Chinese cabbage sample to be tested was high.

Images