Indel Molecular Marker of Maize Drought Response Gene ZmCDPK6 Promoter and Its Application

Abstract

The present invention discloses an Indel molecular marker of the maize drought-responsive gene ZmCDPK6 promoter and its application, belonging to the field of molecular genetics. The nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO.3. The Indel molecular marker provided by the present invention is significantly correlated with the yield traits (single ear weight, grain weight per ear) of maize materials under drought conditions. The 140bp Indel deletion / insertion affects traits such as single ear weight and grain weight per ear of maize, resulting in changes in maize yield. This Indel molecular marker can be used to screen materials with significant differences in yield under drought conditions. The Indel molecular marker of the present invention can be used for maize molecular-assisted breeding and identification of high-quality germplasm resources, accelerating the creation of drought-tolerant maize materials and the breeding process of new varieties.

Description

Technical Field

[0001] The present invention relates to the field of molecular genetics, and particularly to an Indel molecular marker of the promoter of maize drought-responsive gene ZmCDPK6 and its application. Background Art

[0002] Maize is an important crop used for food, economy and feed, and is crucial for China's food security and economic development. Maize is prone to various abiotic stresses such as drought, salt damage and waterlogging during its growth process, resulting in reduced yields or even crop failures. Therefore, exploring drought-tolerant and high-yield maize gene resources and cultivating stress-resistant, high-yield and green new varieties are the primary tasks for improving the scientific and technological innovation of maize seeds, developing green modern agriculture and ensuring national food security. Technical means such as molecular markers and genotype identification are helpful for screening excellent maize germplasm resources. Indels (insertions / deletions) are an important type of molecular genetic marker, which have the advantages of wide distribution and convenient detection, and are of great significance for maize molecular breeding.

[0003] Calcium-dependent protein kinases CDPKs are a class of Ser / Thr protein kinases that can be directly activated by Ca 2+ signals without depending on calmodulin. When plants are subjected to external abiotic stresses, receptors on the cell membrane will sense the signals and open the ion channels on the membrane, causing changes in the Ca 2+ concentration in the plant. Signal proteins sense the changes in the intracellular Ca 2+ concentration and bind to other target proteins to initiate the expression of downstream genes, causing plant stress responses. Under drought stress conditions, the catalytic functional region of CDPKs protein can bind to Ca 2+ and be activated, transmit the signal to the substrate protein through phosphorylation, and then amplify the signal step by step through various interactions, promote the expression of stress-related genes, thereby changing the physical and chemical properties of the plant, and adapting to and resisting drought stress. Therefore, exploring stress-resistant related genes such as CDPKs in maize and investigating the relationship between the variation of their key sites and maize drought tolerance are helpful for screening excellent maize germplasm. Summary of the Invention

[0004] The object of the present invention is to provide an Indel molecular marker of the promoter of maize drought-responsive gene ZmCDPK6 and its application to solve the problems existing in the above-mentioned prior art. This Indel molecular marker can be used to screen maize materials with significantly different yields under drought conditions, and accelerate the creation of drought-tolerant maize materials and the breeding process of new varieties.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an Indel molecular marker for the promoter of maize drought-responsive gene ZmCDPK6, and the nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO.3.

[0007] The present invention also provides a primer pair for detecting the Indel molecular marker, including an upstream primer with a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.5.

[0008] The present invention also provides a product containing the primer pair, and the product includes a detection reagent or a kit.

[0009] The present invention also provides the application of the primer pair in preparing a kit for detecting the Indel molecular marker, and the nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO.3.

[0010] The present invention also provides the application of the Indel molecular marker, the primer pair or the product in any one of the following:

[0011] (1) Application in detecting maize drought tolerance

[0012] (2) Application in screening drought-tolerant maize lines;

[0013] (3) Application in breeding drought-tolerant maize lines;

[0014] (4) Application in identifying maize germplasm resources.

[0015] The present invention also provides a method for detecting maize drought tolerance traits, including the following steps:

[0016] Using the genomic DNA of the maize sample to be tested as a template, performing PCR amplification with the primer pair, performing electrophoresis detection on the obtained PCR product, and identifying the drought tolerance traits of the maize sample to be tested by the size of the electrophoresis band.

[0017] Further, if the size of the electrophoresis band is 81bp, the maize sample to be tested has drought tolerance traits; if the size of the electrophoresis band is 221bp, the maize sample to be tested has drought-sensitive traits.

[0018] Further, the reaction system for the PCR amplification is: 2×Rapid Taq Master Mix 10.0 μL, upstream primer 0.4 μL, downstream primer 0.4 μL, ddH 2 O 8.2 μL and DNA template 1.0 μL.

[0019] Furthermore, the amplification program for the PCR amplification is as follows: 95°C for 2 min; 95°C for 15 s, 56°C for 15 s, 72°C for 15 s, for 30 cycles; 72°C for 5 min.

[0020] The present invention discloses the following technical effects:

[0021] The Indel molecular marker provided by the present invention is significantly correlated with the yield traits (single ear weight, ear grain weight) of maize materials under drought conditions. The 140-bp Indel deletion / insertion affects traits such as the single ear weight and ear grain weight of maize, changing the yield of maize. This Indel molecular marker can be used to screen materials with significant differences in yield under drought conditions. The Indel molecular marker of the present invention can be used for maize molecular-assisted breeding and identification of high-quality germplasm resources, accelerating the creation of drought-tolerant maize materials and the breeding process of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0023] Figure 1 It is for the analysis of the expression pattern of ZmCDPK6 under drought stress; wherein A is the expression level of ZmCDPK6 in the leaves of P1 and P2, and the internal reference gene is GAPDH; B is the expression level of ZmCDPK6 in the roots of P1 and P2, and the internal reference gene is GAPDH; in A - B, CK represents the normal nutrient solution condition, and T represents the drought stress condition simulated by 20% PEG.

[0024] Figure 2 It is a DNA sequence alignment analysis diagram of different maize materials;

[0025] Figure 3 It is an electrophoresis diagram of PCR amplification of the Indel molecular marker in the ZmCDPK6 promoter of different maize materials; M represents Marker (DL2000);

[0026] Figure 4 It is the difference analysis of yield traits such as single ear weight and ear grain weight in different haplotype maize materials; A is the field phenotype photos of some adult plants of different haplotype maize materials; B is the ear pictures of some different haplotype maize materials; C is the statistical chart of yield traits in different haplotype maize materials. DETAILED DESCRIPTION OF THE INVENTION

[0027] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms used in the present invention are only for describing particular embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0030] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0031] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0032] The different maize inbred line materials used in the embodiments of the present invention, such as the drought-tolerant maize inbred line P1 (AC7643), the drought-sensitive inbred line P2 (AC7729 / TZSRW), and the maize inbred line B73, etc., were all collected and preserved by Sichuan Agricultural University. The 336 drought population materials used in the following embodiments are shown in Table 1 and were all preserved in the germplasm resource bank of the Maize Research Institute of Sichuan Agricultural University.

[0033] Table 1 Names of 336 drought population materials

[0034]

[0035]

[0036]

[0037] Analysis of the Expression Pattern of Maize ZmCDPK6 under Drought Conditions in Example 1

[0038] Maize drought-tolerant inbred line P1 (AC7643) and drought-sensitive inbred line P2 (AC7729 / TZSRW) were cultured under normal hydroponic conditions. When the maize seedlings grew to the four-leaf and one-core stage, 20% PEG treatment was applied to a part of P1 and P2 materials to simulate drought stress, and seven time points of 3h, 6h, 12h, 24h, 36h, 48h, and 60h were set. Subsequently, root and leaf materials under normal hydroponic conditions and different treatment times were collected, RNA was extracted, reverse-transcribed into cDNA, and the expression pattern of the ZmCDPK6 gene under drought stress conditions was analyzed.

[0039] The primer pairs for analyzing the expression level of ZmCDPK6 under drought conditions are as follows:

[0040] ZmCDPK6-RT-F: 5’-CATTGGTCGGAGGCTTGG-3’ (SEQ ID NO.1);

[0041] ZmCDPK6-RT-R: 5’-GCCTGCCCATCCTCGTAT-3’ (SEQ ID NO.2).

[0042] The results are as Figure 1 shown. Under the condition of 20% PEG treatment, the expression level of the ZmCDPK6 gene in the root and leaf tissues of P1 and P2 materials was significantly up-regulated, revealing that the ZmCDPK6 gene is involved in the drought stress response of maize.

[0043] Analysis of Indel and Sequence Alignment of the ZmCDPK6 Promoter in Different Maize Materials in Example 2

[0044] In this study, sequence alignment analysis of different maize materials was carried out through the MaizeGDB database ([[]] Figure 2 ) and it was found that there is an Indel marker in the promoter region of the maize ZmCDPK6 gene. The Indel molecular marker is located at position 6221611 on chromosome 1, and the allele is an insertion / deletion of 140bp (genome version is MaizeB73AGP_v3).

[0045] The sequence of this Indel molecular marker is as follows:

[0046] CTAGGCCTTATTCGGTTATCTCTCAATCCATGTGGATTGAGTTGGATTGGGTGGGTTT AAATCCCAAACAAGTCAAAGTTCTTCTAAATTTTTTCCAATCCCGTCCAATCCATATATAA TGGGAATAACCGAACAAGACC(SEQ ID NO.3).

[0047] Verify the haplotypes of different maize materials by PCR as follows:

[0048] The primer pairs for amplifying the fragment containing the Indel molecular marker are shown below:

[0049] CDPK6-indel-up: 5'-AGAGTCGCACAAGACACAAGC-3' (SEQ ID NO.4);

[0050] CDPK6-indel-dn: 5'-AGAAGGTCAAACTTCAGCCGG-3' (SEQ ID NO.5).

[0051] The PCR reaction system is shown in Table 2.

[0052] Table 2 PCR amplification reaction system

[0053]

[0054] The PCR amplification program is shown in Table 3.

[0055] Table 3 PCR amplification program

[0056]

[0057] An amplified fragment using the DNA of material P1 as a template was obtained, with a length of 81 bp, and the sequence is shown in SEQ ID NO.6:

[0058] AGAGTCGCACAAGACACAAGCGTACAGAGATCTACTACAGAGAAGAAAATACAGATACAACCGGCTGAAGTTTGACCTTCT(SEQ ID NO.6);

[0059] An amplified fragment using the DNA of material P2 as a template was obtained, with a length of 221 bp, and the sequence is shown in SEQ ID NO.7:

[0060] AGAGTCGCACAAGACACAAGCGTACAGAGATCTA CTAGGCCTTATTCGGTTATCTCTCAATCCATGTG GATTGAGTTGGATTGGGTGGGTTTAAATCCCAAACAAGTCAAAGTTCTTCTAAATTTTTTCCAATCCCGTCCAATCCATATATAATGGGAATAACCGAACAAGACC CTACAGAGAAGAAAATACAGATACAACCGGCTGAAGTTTGACCTTCT (SEQ ID NO.7);

[0061] Note: The underlined part indicates the Indel molecular marker fragment missing in P1 material.

[0062] The obtained PCR products were detected by agarose gel electrophoresis. The detection results are as Figure 3 shown. It can be seen that in the selected part of the maize drought population materials, this Indel can divide the population into two haplotypes (named type 0 (band size is 81 bp) and indel type (band size is 221 bp)). Among them, P1 is the type 0 haplotype without indel; P2 and B73 are the indel type with Indel insertion.

[0063] Example 3 Analysis of differences in yield traits such as single ear weight and kernel weight among maize materials with different haplotypes

[0064] Furthermore, a correlation analysis was carried out on the detection results of different haplotypes in 336 drought populations and the data of drought tolerance and yield (single ear weight, kernel weight) traits of maize collected by the research group under drought conditions at the adult stage. This study found that the drought tolerance in the field of materials with haplotype 0 was significantly higher than that of maize plants with indel haplotype (MP064: type 0, P2: indel type, FH258: type 0, CML0849: indel type, Figure 4 as shown in A); and the ear setting rate was significantly higher than that of the indel type ( Figure 4 as shown in B); at the same time, the yield (single ear weight, singleEarweight(g) p = 0.0012, kernel weight, Kernelweight(g), p = 0.0141, t - test) of maize materials with haplotype 0 in 336 drought populations was significantly higher than that of indel - type plants ( Figure 4 as shown in C). This indicates that the Indel molecular marker can accurately identify drought - tolerant maize materials.

[0065] The above - mentioned examples are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A drought-responsive gene in maize ZmCDPK6 The Indel molecular marker of the promoter is characterized in that The Indel molecular marker is a nucleotide sequence as shown in SEQ ID NO.3, and the nucleotide sequence shown in SEQ ID NO.3 has an insertion / deletion of 140 bp at position 6221611 of chromosome 1 of the genome version Maize B73 AGP_v3.

2. A primer pair for detecting the Indel molecular marker according to claim 1, characterized in that: It includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO.4 and a downstream primer shown as SEQ ID NO.

5.

3. A product comprising the primer pair as claimed in claim 2, characterized in that: The products include detection reagents or kits.

4. Use of the primer pair according to claim 2 in preparing a kit for detecting the Indel molecular marker according to claim 1.

5. Use of the primer pair according to claim 2 or the product according to claim 3 in any of the following: (1) Application in detecting drought tolerance of corn (2) Application in screening drought-tolerant maize lines; (3) Application in breeding drought-tolerant maize lines; Using the genomic DNA of the corn sample to be tested as a template, performing PCR amplification using the primer pair or the product, performing electrophoresis detection on the obtained PCR product, and identifying the drought resistance trait of the corn sample to be tested by the size of the electrophoresis band; If the size of the electrophoresis band is 81 bp, the corn sample to be tested is drought-tolerant; if the size of the electrophoresis band is 221 bp, the corn sample to be tested is drought-sensitive.

6. A method for detecting drought tolerance of corn, characterized in that: The following steps are involved: Using the genomic DNA of the corn sample to be tested as a template, performing PCR amplification using the primer pair described in claim 2, performing electrophoresis detection on the obtained PCR product, and identifying the drought resistance trait of the corn sample to be tested by the size of the electrophoresis band; If the size of the electrophoresis band is 81 bp, the corn sample to be tested is drought-tolerant; if the size of the electrophoresis band is 221 bp, the corn sample to be tested is drought-sensitive.

7. The method according to claim 6, characterized in that The reaction system of the PCR amplification was: 10.0 μL of 2×Rapid TaqMaster Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 8.2 μL of ddH2O and 1.0 μL of DNA template.

8. The method according to claim 6, characterized in that The amplification program of the PCR amplification is: 95°C for 2 min; 95°C for 15 s, 56°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 5 min.

Images