A strain of Penicillium bilai for effectively preventing and controlling peanut root rot and its application

Abstract

The invention discloses a Penicillium bilaiae strain for efficiently preventing and controlling peanut root rot and its application, and relates to the field of microbial technology. The main points of the technical scheme are: the deposit number of Penicillium bilaiae BL‑1 is CGMCC NO.41008, the deposit time is December 2023, the deposit unit is the General Microbiological Center of China Microbiological Culture Collection Administration, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the ITS sequence of the Penicillium bilaiae is shown in SEQ ID NO: 1, and the strain BL‑1 has obvious plate antagonistic activity against plant pathogenic bacteria and fungi such as Ralstonia solanacearum causing peanut bacterial wilt, Fusarium oxysporum of peanut root rot, Rhizoctonia solani of peanut sheath blight, Pythium sphaeroides of peanut fruit rot, and Lactochromis cocoi of peanut stem rot, and the greenhouse prevention effect of peanut root rot reaches 90.36%. It is further found that P.bilaiae BL‑1 also has the ability to promote the growth of peanut seedlings. Therefore, P. bilaiae BL‑1 is a highly effective biocontrol bacterium with the potential to promote peanut growth and inhibit a variety of peanut diseases.

Description

Technical Field

[0001] The invention relates to the field of microbial technology, and more specifically to a Penicillium bilae strain for effectively preventing and controlling peanut root rot and application thereof. Background Art

[0002] Peanuts are annual herbaceous crops of the genus Arachis in the Leguminosae family. They prefer high temperature and dry environments and are suitable for growing in sandy soils with warm climates and sufficient sunlight. Peanuts are native to Brazil in South America. Because of their extremely high economic value and market potential, they are now widely planted all over the world. my country is the most important peanut planting and production base in the world, and also has the world's largest peanut planting area and the world's first peanut production. Peanuts can be planted in my country's Huanghuaihai region, the North China Plain, the Yangtze River Basin, the southeast coast and the Northeast Peanut Area, among which Henan, Shandong, Hebei, and northern Jiangsu and Anhui are more planted. Peanuts are also the third largest oil crop in my country, with a planting area second only to soybeans and rapeseed. According to data, the national peanut planting area will reach 4683.80 thousand hectares in 2022, accounting for 20.03% of my country's total oil crop planting area, highlighting the pivotal role played by peanuts in ensuring my country's edible oil safety and the stable development of the agricultural and rural economy. In addition, peanuts have high nutritional value and economic value. Peanuts are rich in fat, protein and other nutrients, and are a nutritious and popular leisure health food. According to the "Supplement to Compendium of Materia Medica", peanuts have the effects of strengthening the spleen and stomach, moistening the lungs and reducing phlegm. The protein content of the peanut meal left after peanut pressing is as high as 50%, which is a good feed and fertilizer component.

[0003] In recent years, affected by unfavorable planting methods such as continuous cropping of peanuts and environmental factors such as climate change, peanut planting is often threatened by a variety of soil-borne diseases and leaf diseases such as bacterial wilt, leaf spot, stem rot, and root rot, which seriously affect the green high yield of peanuts. The occurrence of diseases is one of the main factors restricting the high and stable yield of peanuts, seriously affecting the sustainable production and trade of peanuts. At present, production still mainly relies on broad-spectrum chemical fungicides such as carbendazim, chlortetracycline, thiophanate-methyl, and mancozeb to control peanut diseases. However, with the increase in the number of peanut planting years and the increase in the frequency of disease occurrence, the frequency and amount of fungicide use have continued to increase, which has affected the planting and growth environment of peanuts to a certain extent, and is prone to excessive pesticide residues, seriously threatening the quality and safety of peanuts.

[0004] Biological control is one of the important ways to achieve green production of peanuts. Among them, Penicillium bilaiae, as a beneficial fungus, shows great potential in green control of crop diseases and crop promotion. Penicillium bilaiae can synthesize more than 1,300 antibacterial substances including antibiotics, antimicrobial peptides, lysozymes, etc., and reduce the occurrence of plant diseases by directly destroying the cell structure of pathogenic microorganisms. In particular, it has a good inhibitory effect on pathogens such as Fusarium, Pythium, Rhizoctonia solani, and Ralstonia solanacearum. Studies have found that Penicillium bilaiae can quickly colonize in the soil environment and crop roots to form a dominant bacterial community. By secreting a variety of acidic substances and hydrolases, it accelerates the decomposition of nutrients in the soil, promotes root absorption and extension, and thus accelerates crop growth. In addition, this type of strain can also secrete a variety of plant hormones to affect the growth and development of crops. Penicillium bilaiae has gradually become a key bacterial species resource for biological control of pathogenic microorganisms in agricultural production. Increasing its development and utilization is of great significance for enriching microbial products and promoting agricultural production and income.

[0005] However, there is currently a lack of effective microbial preparations for the prevention and control of peanut diseases, which cannot meet the green and efficient production of peanuts. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems and provide a Penicillium bilaiae strain for effectively preventing and controlling peanut root rot and its application. The strain BL-1 has obvious plate antagonistic activity against plant pathogenic bacteria and fungi such as Rastonia solanacearum that causes peanut bacterial wilt, Fusarium oxysporum that causes peanut root rot, Rhzoctonia solani that causes peanut sheath blight, Pythium myriotylum that causes peanut fruit rot, and Lasiodiplodia theobromae that causes peanut stem rot, and the greenhouse prevention effect of P. bilaiae BL-1 on peanut root rot reaches 90.36%. P. bilaiae BL-1 also has the ability to promote the growth of peanut seedlings.

[0007] The above technical purpose of the present invention is achieved through the following technical scheme: a strain of Penicillium bilaiae that effectively prevents and controls peanut root rot, the deposit number of the Penicillium bilaiae BL-1 is CGMCCNO.41008, the deposit time is December 19, 2023, the deposit unit is the General Microbiological Center of the China Microbiological Culture Collection Administration, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the Penicillium bilaiae is an aerobic fungus that can grow normally on PDA culture medium, with white hyphae at the edge of the colony and dark green in the middle; the ITS sequence of the Penicillium bilaiae is shown in SEQ ID NO: 1;

[0008] SEQ ID NO: 1:

[0009] GTGTCTCTTGTACCATGTTGCTTCGGCGAGCCCGCCTCACGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCTCTGAACGCTGTCTGAAGATTGCAGTCTGAGCGATAAGCA AAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGC CCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCTCCGTCCTCCCCCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGT CCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTGGCCGACCCTCCAACCCCATTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAA.

[0010] The present invention further discloses an application of a strain of Penicillium bilais for effectively preventing and controlling peanut root rot in any of the following:

[0011] Use of U1 and P. bilaiae BL-1 in the prevention and / or treatment of peanut root rot;

[0012] U2, application of P.bilaiae BL-1 in inhibiting Ralstonia solanacearum (bacterial wilt); U3, application of P.bilaiae BL-1 in inhibiting Fusarium oxysporum (root rot);

[0013] Application of U4 and P.bilaiae BL-1 in inhibiting Rhizoctonia solani (sheath blight);

[0014] Application of U5 and P.bilaiae BL-1 in inhibiting Pythium spp. (fruit rot);

[0015] U6, Application of P.bilaiae BL-1 in inhibiting Lactodispora cocoa (stem rot); U7, Application of P.bilaiae BL-1 in increasing the biomass of peanut plants.

[0016] The present invention further discloses the use of a metabolite of Penicillium bilais that is highly effective in preventing and controlling peanut root rot in any of the following:

[0017] V1, Application of metabolites of P. bilaiae BL-1 in the prevention and / or treatment of peanut root rot;

[0018] V2, Application of metabolites of P. bilaiae BL-1 in inhibiting Ralstonia solanacearum (bacterial wilt);

[0019] Application of metabolites of V3, P. bilaiae BL-1 in inhibiting Fusarium oxysporum (root rot);

[0020] Application of metabolites of V4 and P. bilaiae BL-1 in inhibiting Rhizoctonia solani (sheath blight);

[0021] Application of metabolites of V5 and P. bilaiae BL-1 in inhibiting Pythium spp. (fruit rot);

[0022] Application of metabolites of V6 and P. bilaiae BL-1 in inhibiting Lactodispora caesii (stem rot);

[0023] Application of metabolites of V7 and P. bilaiae BL-1 in increasing the biomass of peanut plants.

[0024] The present invention further discloses a culture of Penicillium bilaiae BL-1 for effectively preventing and controlling peanut root rot. The culture is a substance obtained by culturing Penicillium bilaiae in various microbial culture media, including mycelium, conidia and secretions of P.bilaiae BL-1.

[0025] The present invention further discloses the use of a culture of Penicillium bilais that is highly effective in preventing and controlling peanut root rot in any of the following:

[0026] B1. Use of culture of P. bilaiae BL-1 in preventing and / or treating peanut root rot;

[0027] B2, application of culture of P. bilaiae BL-1 in inhibiting Ralstonia solanacearum (bacterial wilt);

[0028] B3, application of culture of P. bilaiae BL-1 in inhibiting Fusarium oxysporum (root rot);

[0029] B4, application of culture of P.bilaiae BL-1 in inhibiting Rhizoctonia solani (sheath blight);

[0030] B5. Use of cultures of P. bilaiae BL-1 in inhibiting Pythium spp. (fruit rot);

[0031] B6. Use of cultures of P. bilaiae BL-1 in inhibiting Lactodispora caesii (stem rot);

[0032] B7. Application of culture of P.bilaiae BL-1 in increasing the biomass of peanut plants.

[0033] The present invention further discloses a fermentation liquid of Penicillium bilaiae BL-1 which is highly effective in preventing and controlling peanut root rot. The preparation method of the fermentation liquid of P.bilaiae BL-1 comprises the following steps:

[0034] S1: Use a 7 mm diameter puncher to punch 3 to 5 bacterial cakes on the PDA plate of the freshly cultured strain P. bilaiae BL-1, and inoculate them into PDB liquid culture medium;

[0035] S2: adding 10 to 15 sterile glass beads with a diameter of 5 mm to the PDB liquid culture medium inoculated in S1;

[0036] S3: Shake the culture medium at 25°C and 180 rpm for 5 days to obtain the fermentation liquid.

[0037] The present invention further discloses the use of a fermentation liquid of Penicillium bilais for effectively preventing and controlling peanut root rot in any of the following:

[0038] Use of fermentation broth of C1, P. Cilaiae CL-1 in preventing and / or treating peanut root rot;

[0039] C2, Application of the fermentation broth of P. Cilaiae CL-1 in inhibiting Ralstonia solanacearum (bacterial wilt);

[0040] C3, Application of fermentation broth of P. Cilaiae CL-1 in inhibiting Fusarium oxysporum (root rot);

[0041] Application of fermentation broth of C4 and P. Cilaiae CL-1 in inhibiting Rhizoctonia solani (sheath blight);

[0042] Application of fermentation broth of C5 and P. Cilaiae CL-1 in inhibiting Pythium spp. (fruit rot);

[0043] Application of fermentation broth of C6 and P. Cilaiae CL-1 in inhibiting cocoa spores (stem rot);

[0044] Application of fermentation broth of C7 and P.Cilaiae CL-1 in increasing the biomass of peanut plants.

[0045] In summary, the present invention has the following beneficial effects:

[0046] 1. The strain P.bilaiae BL-1 involved in the present invention is a stable, efficient and broad-spectrum plant disease biocontrol fungus, which can be effectively used for the biological control of peanut root rot;

[0047] 2. The biocontrol strain of the present invention has obvious plate antagonistic activity against plant pathogenic bacteria and fungi such as Rastoniasolanacearum, which causes peanut bacterial wilt, Fusarium oxysporum, which causes peanut root rot, Rhzoctonia solani, which causes peanut sheath blight, Pythium myriotylum, which causes peanut fruit rot, and Lasiodiplodia theobromae, which causes peanut stem rot, and the greenhouse control effect on peanut root rot reaches 90.36%. It was further found that P.bilaiae BL-1 also has the ability to promote the growth of peanut seedlings;

[0048] 3. The strain P.bilaiae BL-1 of the present invention is a beneficial Penicillium bilaiae strain that has the functions of preventing and controlling peanut diseases and promoting peanut growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The neighbor-joining method was used in the present invention to construct a phylogenetic tree of P. bilaiae BL-1 and related Penicillium strains based on ITS sequences;

[0050] Figure 2 The plate antagonistic effect of Penicillium BL-1 of the present invention on various peanut pathogens;

[0051] Figure 3 The invention discloses the influence of Penicillium bilai BL-1 on the germination of peanut seeds. DETAILED DESCRIPTION

[0052] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0053] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0054] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0055] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0056] The public can collect the pathogens used in the following embodiments from the wild, or contact Baofeng County Wanlong Fertilizer Co., Ltd. to obtain them in order to repeat the relevant experiments in the present invention.

[0057] A strain of Penicillium bilaiae BL-1 that is highly effective in preventing and controlling peanut root rot, Penicillium bilaiae BL-1, hereinafter referred to as P.bilaiae BL-1, with a deposit number of CGMCC NO.41008, a deposit time of December 19, 2023, and a deposit unit of the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the Penicillium bilaiae is an aerobic fungus that can grow normally on PDA culture medium, with white hyphae at the edge of the colony and dark green in the middle; the ITS sequence of the Penicillium bilaiae is shown in SEQ ID NO: 1.

[0058] The culture medium preparation method used in the following examples is as follows:

[0059] PDA medium: 200 g potato, 20 g glucose, 18 g agar, and distilled water to 1000 mL.

[0060] PDB medium: 200 g potato, 20 g glucose, distilled water to 1000 mL.

[0061] Nutrient agar medium (NA medium): 3 g beef extract, 5 g peptone, 2.5 g glucose, 12 g agar, pH 7.0, distilled water to 1000 mL.

[0062] Nutrient broth medium (NB medium): 3 g beef extract, 5 g peptone, 2.5 g glucose, pH 7.0, distilled water to 1000 mL.

[0063] Example 1: Isolation and identification of Penicillium bilaiae BL-1 (CGMCC NO.41008).

[0064] 1. Isolation of strains

[0065] Penicillium bilaiae BL-1 was isolated from the soil surrounding the tubers of peanut fields in Baofeng County, Pingdingshan City, Henan Province. The collected soil samples were cleaned of plant roots, branches and other debris, further ground and sieved, and 10g of the sample was weighed and added to 90mL of sterile saline. The soil sample was shaken at 25°C and 180rpm for 60min to evenly suspend the soil sample in the saline, so as to maximize the dispersion of microorganisms in the soil in the solution. After standing for 2 to 3min, 5mL of the supernatant was taken and diluted to 10 by a 10-fold gradient series. -5 . Take 200 μL of each dilution and spread it evenly on the PDA plate, where streptomycin with a final concentration of 50 μg / ml was added to the PDA medium, and three replicates were set up. After drying under sterile conditions, it was placed in a 25°C fungal incubator for about 48 hours. After a single colony grows, select a colony with a single color and morphology, pick a single hyphae and transfer it to a new PDA plate containing streptomycin for purification and culture to obtain strain BL-1.

[0066] 2. Identification of strain BL-1

[0067] The isolated strain BL-1 was inoculated onto a PDA plate and placed in a constant temperature incubator at 25°C for 5 days, and then its morphological characteristics were observed. The strain grew rapidly on the PDA plate and could cover the entire plate (90 mm) in 5 days. The hyphae were white at first, and the edge of the hyphae became white as the colony grew, and the middle was green. The hyphae grew on the surface of the culture medium, and the aerial hyphae were short and velvety, with no obvious soluble pigments. Under a microscope, the hyphae were colorless, with a smooth surface, endogenous septa, and conidiophores at the top of the hyphae. There were multiple branches, which were broom-shaped, and colorless, transparent, and nearly spherical conidia were grown on them, which were typical morphological characteristics of Penicillium fungi.

[0068] The genomic DNA of strain BL-1 was obtained using the Omega fungal DNA mini-extraction kit, and PCR amplification was performed based on the universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') for fungal ITS sequence amplification. The PCR system included 10 μL of 2×PCR MasterMix, 1 μL of upstream and downstream primers (concentration 10 μM), 50 ng of DNA template, and 20 μL of ddH2O. The PCR amplification program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; 72℃ renaturation for 10 min. The PCR product was sent to Treasure Biotechnology (Dalian) Co., Ltd. for sequencing, and the 16S rDNA-ITS sequence of strain BL-1 was obtained as shown in Sequence 1. Further online BLAST comparison was performed on the NCBI website to find related Penicillium and construct a phylogenetic tree using MEGAX ( Figure 1 ). It was found that strain BL-1 and Penicillium bilaiae are in the same branch and have the closest homology, so the strain can be identified as Penicilliumbilaiae BL-1. The strain has been patented and deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration (CGMCC) on December 19, 2023, and its registration number is CGMCCNO.41008. Hereinafter referred to as P.bilaiae BL-1.

[0069] Example 2: Antagonistic activity of Penicillium bilaiae BL-1 against different pathogens

[0070] Peanut pathogens include: Rastonia solanacearum, the pathogen of peanut bacterial wilt, Fusarium oxysporum, the pathogen of peanut root rot, Rhzoctonia solani, the pathogen of peanut sheath blight, Pythium myriotylum, the pathogen of peanut fruit rot, and Lasiodiplodia theobromae, the pathogen of peanut stem rot.

[0071] 1. Antibacterial effect of Penicillium bilaiae BL-1

[0072] The antibacterial activity of strain BL-1 against the above pathogens was analyzed by plate confrontation. The method of plant pathogenic fungi confrontation experiment is as follows: on the freshly cultured pathogenic fungi PDA plate, use a 7mm diameter puncher to take the edge of the colony, and then use a sterilized inoculation needle to inoculate one side of the mycelium of the fungus band to a blank PDA plate, and then inoculate 7mm strain BL-1 cakes at equal distances on both sides of the pathogen cake, and then invert it in a 25℃ constant temperature fungal incubator for culture, and set 3 repetitions. Observe the growth every day, and take photos and measure the size of the inhibition zone after culturing for 3-5 days according to the growth rate of different pathogens. The plate confrontation operation of R. solanacearum was as follows: 1) First, a fresh single colony of R. solanacearum was inoculated into NB culture medium and cultured overnight at 28°C and 180rpm to obtain pathogen culture medium; 2) When the thawed NA culture medium was cooled to 40-45°C, the pathogen culture medium was added to the cooled NA culture medium to a final concentration of 1×10 7 cfu / mL, shake well and pour into the culture dish to obtain a bacterial plate; 3) After the plate is completely solidified, inoculate a 7mm BL-1 bacterial cake in the center, place it in a 28℃ constant temperature incubator, invert and culture for 48h, observe and measure the diameter of the inhibition zone, and set 3 replicates.

[0073] The results showed that P.bilaiae BL-1 had significant plate antagonistic activity against five plant pathogenic bacteria and fungi, including Ralstonia solani, Fusarium oxysporum, Rhizoctonia solani, Pythium glomerata, and Diplodia cholerae. Figure 2 ), among which Fusarium oxysporum and Rhizoctonia solani had the highest antagonistic activity.

[0074] 2. Antibacterial effect of sterile fermentation broth of Penicillium bilaiae BL-1

[0075] Preparation of sterile fermentation broth: Use a 7mm diameter puncher to punch 3 to 5 bacterial cakes on the PDA plate of the freshly cultured strain P.bilaiae BL-1, inoculate them in PDB liquid culture medium, add 10 to 15 sterile glass beads with a diameter of 5mm, shake and culture at 25℃, 180rpm for 5 days to obtain the fermentation product. The fermentation product is further centrifuged at room temperature for 10 minutes at 7000×g, the supernatant is collected, and the mycelium and conidia are filtered through a 0.45μm filter membrane to obtain a sterile fermentation broth. Add a sterile fermentation broth with a final concentration of 10% to the PDA culture medium cooled to about 45℃ after melting, mix well and pour into a culture dish, inoculate fresh bacterial cakes of different pathogenic fungi in the middle of the culture medium after solidification, and then invert it in a 25℃ constant temperature fungal incubator for culture, and set up 3 repetitions. The growth was observed every day. According to the growth rate of different pathogens, photos were taken and the colony diameter was measured after culturing for 3-5 days, and the inhibition rate was calculated. The plate inhibition test of sterile fermentation liquid on R. solanacearum was performed as follows: the plate with bacteria was prepared as described above, and then 10 μL of sterile fermentation liquid was applied to the middle of the plate with bacteria, and then placed in a 28°C constant temperature incubator after drying. After inverting and culturing for 48 hours, the diameter of the inhibition zone was observed and measured, and 3 replicates were set.

[0076] Bacterial inhibition rate = (control colony diameter - treatment colony diameter) / control colony diameter × 100% From the results in Table 1, it can be seen that the P.bilaiae BL-1 sterile fermentation liquid has a certain inhibitory effect on the five peanut pathogens selected in the present invention. The sterile fermentation liquid of this strain has a better inhibitory effect on pathogenic fungi, among which the inhibitory rates of Fusarium oxysporum, which causes peanut root rot, and Rhizoctonia solani, which causes sheath blight, are the highest, reaching 62.03% and 64.65% respectively; the inhibitory effect on the pathogenic bacterium Ralstonia solanacearum is weak, and the plate inhibition rate is only 26.43%.

[0077] Table 1 Inhibition rate of Penicillium bilaiae BL-1 against various peanut pathogens

[0078]

[0079] Example 3: Penicillium bilaiae BL-1 promotes peanut seed germination

[0080] Preparation of P.bilaiae BL-1 spore suspension: Use a 7mm diameter puncher to punch 3 to 5 cakes on the PDA plate of the freshly cultured strain P.bilaiae BL-1, inoculate them into PDB liquid culture medium, add 10 to 15 sterile glass beads with a diameter of 5mm, shake and culture at 25°C and 180rpm for 5 days to obtain fermentation liquid. Filter the fermentation liquid through 3 layers of sterile gauze to remove the mycelium, centrifuge at 7000×g for 10min, discard the supernatant, collect the conidia, resuspend them in PDB culture medium, obtain the conidia suspension, and calculate the concentration of the conidia suspension using a hemocytometer, and finally adjust it to 1×10 8 Pieces / mL.

[0081] Select peanut seeds with full grains, good skin gloss and high uniformity. First, soak them in 75% ethanol for 30 seconds for surface disinfection, then rinse them with sterile water 2 to 3 times, then soak the peanut seeds in 2% sodium hypochlorite solution for 5 minutes for disinfection again, and rinse them with sterile water 3 to 5 times to ensure that there is no sodium hypochlorite residue on the surface of the seeds. The surface-sterilized peanut seeds were soaked in the conidia suspension of strain BL-1 and sterile fermentation liquid for 10 minutes, respectively, and soaked in PDB medium for 10 minutes as a blank control. Each treatment was repeated 3 times, with 10 peanut seeds in each repetition. After the epidermis was dried, moisturizing and germination were carried out. The peanut seeds of each treatment were placed in a sterile culture dish (150mm) and placed in an artificial climate room for moisturizing culture (light and dark duration 12 / 10h, relative humidity 60%), with a light temperature of 28°C and a dark temperature of 25°C. Add an appropriate amount of sterile water every day to moisturize, observe the germination, record the number of germinations on the 10th day, measure the germination length, stem thickness and other indicators, and calculate the germination rate.

[0082] All the peanut seeds treated in the present invention can germinate normally, and the germination rate is 100%. However, after germination, the length and size of the peanut buds formed by different treatments are significantly different. The buds formed by the peanut seeds treated with the spore suspension of strain BL-1 and the sterile fermentation liquid after germination are significantly larger than those of the blank treatment ( Figure 3 ). Further measurement of the sprout length and the diameter of the thickest part of the sprout revealed that the sprout length of peanuts treated with BL-1 spore suspension and sterile fermentation liquid exceeded that of the blank control by more than 60% in the same period of time, reaching 40.17 mm and 36.33 mm respectively; and the diameter of the thickest part of the sprout also exceeded that of the control by more than 1 mm (Table 2).

[0083] Table 2 Effects of Penicillium bilaiae BL-1 on peanut seed germination

[0084]

[0085] Example 4: Effect of Penicillium bilaiae BL-1 on Peanut Root Rot

[0086] Select peanut seeds with full grains and uniform size, soak them in clean water at room temperature for 12 hours to allow the seeds to fully absorb water, then use gauze to keep them moist and place them at room temperature for germination. The peanut seeds will appear obviously white in about 3 to 5 days. Plant the peanut seeds with uniform germination in the seedling pot and transplant them after they emerge and grow two true leaves.

[0087] Preparation of spore suspensions of Penicillium bilaiae BL-1 and Fusarium oxysporum F. oxysporum Reference Example 3 for the preparation of spore suspensions. The prepared spore suspensions were mixed with nutrient soil in a certain proportion, and a total of 4 treatments were designed. They were inoculated with biocontrol Penicillium bilaiae BL-1 alone, inoculated with pathogenic Fusarium oxysporum alone, inoculated with biocontrol bacteria and pathogens in a 1:1 ratio, and blank control. The concentration of inoculated conidia in the soil inoculated with biocontrol bacteria or pathogens was ensured to be 1×10 6 / g, and the blank control was mixed with an equal amount of PDB medium. Each treatment was divided into 15 pots with a diameter of 9 cm, and 1 peanut seedling was planted in each pot. Each 5 pots formed a group, and there were 3 groups for each treatment. The transplanted peanut seedlings were placed in an artificial climate room for normal watering management (light / dark duration 12 / 10h, relative humidity 60%), light temperature 28°C, dark temperature 25°C, and the disease situation was observed and recorded every day. When it grew to the 7th day, the number of diseased plants and the severity of the disease were counted, and the incidence rate, disease index and control effect were calculated.

[0088] The disease grading standard for peanut root rot is as follows: Level 0, no obvious symptoms; Level 1, the roots are slightly discolored, and the discolored part accounts for less than 10% of the whole root system, and the plant does not wilt; Level 3, the roots are obviously browned, and the discolored roots account for 10-30% of the whole root system, and the plant shows symptoms of water loss; Level 5, most of the roots are browned, and the discolored roots account for 30-50% of the whole root system, and the plant obviously wilts; Level 7, the discolored roots account for more than 50% of the whole root system, and the plant wilts but does not die; Level 9, the whole plant dries up and dies.

[0089] Incidence rate (%) = number of diseased plants in each group / total number of plants in each group × 100%;

[0090] Disease index = [∑(number of diseased plants at each level × disease level)] / (total number of plants investigated × highest disease level) × 100;

[0091] The control effect (%) = (disease index of the control group - disease index of the treatment group) / disease index of the control group × 100%.

[0092] The results showed that root irrigation with the fermented liquid of strain BL-1 could effectively prevent and control the occurrence of peanut root rot and significantly reduce the incidence and severity of the disease. Indoor potted plants verified that the preventive effect of the fermented liquid of strain BL-1 on peanut root rot was over 90% (Table 3).

[0093] Table 3 Control effect of Penicillium bilaiae BL-1 on peanut root rot

[0094]

[0095] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A Penicillium bilaiae strain that is highly effective in preventing and controlling peanut root rot, characterized in that: The deposit number of the Penicillium bilai BL-1 is CGMCC NO.41008, the deposit time is December 2023, the deposit unit is the General Microbiology Center of the China Microorganism Culture Collection Administration, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the Penicillium bilai is an aerobic fungus that can grow normally on PDA culture medium, with white hyphae at the edge of the colony and dark green in the middle; the ITS sequence of the Penicillium bilai is shown in SEQ ID NO:

1.

2. Use of the Penicillium bilais strain for effectively preventing and controlling peanut root rot according to claim 1 in any of the following: Use of U1 and P. bilaiae BL-1 in the prevention and / or treatment of peanut root rot; Application of U2 and P.bilaiae BL-1 in inhibiting the pathogen of peanut bacterial wilt, Ralstonia solanacearum; Application of U3 and P.bilaiae BL-1 in inhibiting the pathogen of peanut root rot Fusarium oxysporum; Application of U4 and P.bilaiae BL-1 in inhibiting the pathogen of peanut sheath blight, Rhizoctonia solani; Application of U5 and P.bilaiae BL-1 in inhibiting the pathogenic bacteria group of peanut fruit rot, Pythium spp.; Application of U6 and P.bilaiae BL-1 in inhibiting the pathogen of peanut stem rot, Lactodiplodia theobroma; Application of U7 and P.bilaiae BL-1 in increasing the biomass of peanut plants.

3. The fermentation liquid of Penicillium bilais for effectively preventing and controlling peanut root rot according to claim 1, characterized in that: The method for preparing the fermentation broth of P.bilaiae BL-1 comprises the following steps: S1: Use a 7 mm diameter borer to punch 3 to 5 bacterial cakes on the PDA plate of the freshly cultured strain P. bilaiae BL-1, and inoculate them into PDB liquid culture medium; S2: adding 10 to 15 sterile glass beads with a diameter of 5 mm to the PDB liquid culture medium inoculated in S1; S3: Shake the culture medium at 25°C and 180 rpm for 5 days to obtain the fermentation liquid.

4. Use of the fermentation liquid of the Penicillium bilais strain for effectively preventing and controlling peanut root rot according to claim 3 in any of the following: C1. Use of fermentation liquid of P.bilaiae BL-1 in preventing and / or treating peanut root rot; C2, application of fermentation broth of P.bilaiae BL-1 in inhibiting the pathogen of peanut bacterial wilt, Ralstonia solanacearum; C3, Application of the fermentation broth of P.bilaiae BL-1 in inhibiting the pathogen of peanut root rot Fusarium oxysporum; Application of fermentation broth of C4, P.bilaiae BL-1 in inhibiting the pathogen of peanut sheath blight, Rhizoctonia solani; Application of fermentation broth of C5, P.bilaiae BL-1 in inhibiting the pathogenic bacteria group of peanut fruit rot, Pythium spp.; Application of fermentation broth of C6 and P.bilaiae BL-1 in inhibiting the pathogen of peanut stem rot, Lactodiplodia theobroma; Application of fermentation broth of C7 and P.bilaiae BL-1 in increasing the biomass of peanut plants.

Images