Kchmr gene or protein and its application in improving arabidopsis thaliana tolerance to high temperature stress and breeding method of high temperature tolerant arabidopsis thaliana
By overexpressing the KcHMR gene in Arabidopsis thaliana, the problem of insufficient plant response to high temperature stress was solved, the antioxidant capacity and thermomorphogenesis of Arabidopsis thaliana were enhanced, and the gene resources for high temperature-tolerant breeding were realized, providing a new approach for plant growth, development and yield improvement under climate warming conditions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-22
- Publication Date
- 2026-07-21
AI Technical Summary
There is a lack of research on the response to high temperature stress in existing technologies, which leads to inhibited plant growth and reduced yield under high temperature conditions. There is also a lack of effective heat-resistant gene resources and breeding methods.
Overexpression of the KcHMR gene in Arabidopsis thaliana, construction of a KcHMR gene overexpression vector and transformation of Arabidopsis thaliana using Agrobacterium-mediated transformation, enhanced the antioxidant capacity and thermomorphogenesis of Arabidopsis thaliana, and improved its tolerance to high temperatures.
It significantly enhances Arabidopsis thaliana's resistance to high-temperature stress, reduces leaf damage and oxidative stress damage, improves the plant's growth adaptability under high-temperature conditions, and provides genetic resources for breeding heat-resistant plants.
Smart Images

Figure CN118406694B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology breeding technology, and in particular to a KcHMR gene or protein, the application of the aforementioned KcHMR gene or protein in improving the heat stress tolerance of Arabidopsis thaliana, and provides a method for cultivating heat-resistant Arabidopsis thaliana. Background Technology
[0002] Abiotic stress is a significant factor leading to crop yield reduction and even plant death. Among abiotic stressors, high temperatures cause plants to activate programmed cell death programs in certain cells or tissues, resulting in leaf drop, rapid chlorosis in seedlings, and eventual death. However, research reports on plant responses to high-temperature stress are relatively scarce compared to abiotic stresses such as salinity, drought, and low temperatures. But with the continuous rise in global temperatures, the stress caused by high temperatures on plants is intensifying, and people are paying increasing attention to the adverse effects of high temperatures on plants.
[0003] High temperatures primarily cause oxidative stress. High temperatures and drought often occur together in nature. High temperature stress affects the stability of various proteins, membrane systems, RNA types, cytoskeleton structure, and enzymatic reaction efficiency in cells to varying degrees, thus impacting metabolic homeostasis. Since many physiological and biochemical reactions within cells are coupled, disruption of metabolic homeostasis can lead to the accumulation of toxins such as reactive oxygen species (ROS), subsequently damaging cells, interfering with normal molecular regulatory mechanisms, and causing irreversible damage to plants. Plants also adapt to changes in environmental temperature and respond positively to high temperature stress by readjusting their transcriptome, proteome, metabolome, and lipids. This includes enhancing the expression of heat-resistant proteins to protect other sensitive proteins from damage and repairing already damaged proteins; and increasing the activity of antioxidant enzyme systems to improve ROS scavenging capacity and prevent damage to cells and their membrane systems.
[0004] High-temperature stress and the plant's response to it is a complex biological process. Studying the response mechanisms and feedback mechanisms of plants to high-temperature stress, actively exploring and utilizing heat-tolerant plant resources and genetic resources such as genes and proteins, and applying modern molecular biology and genomics methods to clone, express, and functionally validate heat-tolerant genetic resources before applying them to economically valuable crops will not only provide a theoretical basis for the study of the molecular mechanisms of plant responses to high temperatures but also provide new germplasm resources and breeding materials for heat-tolerant breeding. This will be an effective way to alleviate the stunted growth and development and yield reduction caused by high temperatures in the future. Therefore, developing and finding new heat-responsive genes is of great significance for improving plant tolerance to high-temperature stress. Summary of the Invention
[0005] To address the aforementioned technical problems in existing technologies, this invention provides a KcHMR gene and its protein. Overexpression of this gene in Arabidopsis thaliana is beneficial for Arabidopsis to efficiently cope with oxidative damage caused by high-temperature stress and to rapidly adapt to high-temperature environments through thermomorphogenesis, thereby enhancing its resistance to high-temperature stress. Therefore, this invention further provides the application of the aforementioned KcHMR gene or KcHMR protein in improving the high-temperature stress tolerance of Arabidopsis thaliana and provides a method for cultivating high-temperature tolerant Arabidopsis thaliana. The implementation of this invention provides excellent genetic resources for the genetic improvement of high-temperature tolerant plants and offers new ideas for obtaining new plant varieties resistant to high-temperature stress. It has important theoretical and practical significance for maintaining plant growth and development and increasing the yield of economic crops under climate warming conditions.
[0006] This invention is specifically achieved through the following technical solutions:
[0007] The first aspect of the present invention provides a KcHMR gene, the cDNA sequence of which is shown in SEQ ID NO.3.
[0008] A second aspect of the present invention provides a KcHMR protein, the amino acid sequence of which is shown in SEQ ID NO.4.
[0009] The third aspect of the present invention provides the application of the KcHMR gene or KcHMR protein as described above in improving the heat stress tolerance of Arabidopsis thaliana.
[0010] Furthermore, the temperature of the high-temperature stress is not higher than 45°C.
[0011] A fourth aspect of this invention provides a method for cultivating heat-resistant Arabidopsis thaliana, comprising the following steps:
[0012] A KcHMR gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcHMR gene expression was obtained.
[0013] Furthermore, the construction of the KcHMR gene overexpression vector includes the following steps: using *Pterocarya stenoptera* genomic DNA as a template, the KcHMR gene is amplified by PCR using the primer pair shown in SEQ ID NO.5-6, and the amplified KcHMR gene is ligated into the plant expression vector pK2GW7 via a Gateway reaction to obtain the KcHMR gene overexpression vector.
[0014] Furthermore, the Gateway reaction includes the following steps: ligating the amplified KcHMR gene to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TMThe KcHMR gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcHMR gene overexpression vector.
[0015] Furthermore, the PCR amplification program includes: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1.5 min, 32 cycles; 72℃ extension for 10 min.
[0016] Furthermore, the method for transforming the KcHMR gene overexpression vector into the wild-type Arabidopsis thaliana is selected from calcium phosphate coprecipitation, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method, or Agrobacterium-mediated transformation.
[0017] The advantages and positive effects of this invention are as follows:
[0018] 1. The KcHMR gene provided by this invention is closely related to the heat tolerance of Arabidopsis thaliana at the protein level. Overexpression of this gene in Arabidopsis thaliana revealed that transgenic Arabidopsis thaliana overexpressing the KcHMR gene showed significantly enhanced resistance to heat stress, manifested by the rapid activation of antioxidant-related enzymes, reduction of peroxidation, leaf damage, and electrolyte leakage, confirming that this gene participates in the thermomorphogenesis of Arabidopsis thaliana and plays a role in improving the plant's heat tolerance. Therefore, this invention provides an excellent gene resource for the genetic improvement of heat-tolerant plants and has broad application prospects in the field of breeding heat-tolerant plants.
[0019] 2. This invention provides a new approach to obtaining new plant varieties resistant to high temperature stress by overexpressing the KcHMR gene, which has important theoretical and practical significance for maintaining plant growth and development and increasing the yield of economic crops under climate warming conditions. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 This is a phylogenetic tree of the KcHMR protein according to an embodiment of the present invention;
[0022] Figure 2 This is a map of the p35s-KcHMR gene overexpression vector of this invention.
[0023] Figure 3The aboveground phenotypic changes of wild-type Arabidopsis and transgenic Arabidopsis under different time periods of 45°C high-temperature stress treatment in Example 45 of the present invention are shown in Figures a and b, which represent 0h, 3h, 6h and 8h of 45°C high-temperature stress treatment, respectively.
[0024] Figure 4 This is a graph showing the changes in SOD, POD, CAT activities and MDA content in leaves of wild-type Arabidopsis and transgenic Arabidopsis under different durations of high-temperature stress treatment at 45°C in Example 4 of this invention.
[0025] Figure 5 This is a graph showing the changes in chlorophyll content in leaves of wild-type Arabidopsis and transgenic Arabidopsis under different durations of high-temperature stress treatment at 45°C in Example 4 of this invention.
[0026] Figure 6 This is a graph showing the changes in the relative electrical conductivity of leaves of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana under different durations of high-temperature stress treatment at 45°C in Example 4 of this invention. Detailed Implementation
[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0028] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.
[0029] To better understand the invention and not to limit its scope, all figures and other numerical values used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "about." The term "about" has its usual meaning as indicating a value that includes inherent variations in the error of the equipment or method used to determine that value, or that includes a value close to said value, for example, within 10% of said value (or a range of values). Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values and may vary depending on the desired properties being sought. The terms "comprising," "including," "containing," "having," and similar words are non-limiting in meaning, allowing for the addition of other steps and other components that do not affect the result.
[0030] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.
[0031] The term "gene" refers to the complete nucleotide sequence required to produce a polypeptide chain or functional RNA. Therefore, gene expression includes transcription and the stable accumulation of gene-coding RNA (mRNA) or functional RNA, and can also refer to the translation of mRNA into polypeptides or proteins.
[0032] The term "cDNA" refers to a DNA molecule that, after reverse transcription, is reverse complementary to an RNA molecule (such as mRNA) (first-strand cDNA) or a DNA molecule with the same sequence as an RNA molecule except that U is T (second-strand cDNA). cDNA has no introns but only exons.
[0033] The term "vector" refers to a self-replicating DNA molecule, often in the form of a circular double-stranded DNA molecule, used to transfer a foreign target gene into a host organism. A vector containing the target gene is called a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, granules, and minichromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, plasmids and vectors are used interchangeably.
[0034] The term "expression vector" allows a foreign target gene inserted into the vector to be expressed in a host organism. When an expression vector is introduced into a suitable host organism, the inserted target gene (e.g., the KcHMR gene of this invention) can be expressed.
[0035] The terms "introduction" or "transfer" refer to the transfer of a target gene nucleic acid molecule (such as an overexpression vector containing the KcHMR gene) into a host organism, resulting in stable genetic inheritance. The introduced nucleic acid molecule can be in plasmid form retained in the host organism or can be integrated into the host organism's genome. A host organism containing the introduced gene is referred to as a "transgenic," "recombinant," "transformed," or "engineered" organism. The introduction of expression vectors into host organisms can be performed using conventional techniques well known to those skilled in the art.
[0036] The terms "overexpression," "excessive expression," or similar terms refer to a gene expression level that exceeds the normal expression level. In a preferred embodiment, the gene expression level is at least 10%, 20%, 50%, 100% (2-fold), 200% (3-fold), 300% (4-fold), or even more times higher than the normal expression level. In this invention, overexpression or excessive expression is relative to wild-type plants.
[0037] Normally, comparing C tThe value method is the most commonly used method for studying the content of gene expression products. The quantitative result is obtained by combining the target gene and the internal reference gene C. t The difference between values (△C) t This is reflected in the formula, which is a relative quantification. The method for calculating the relative expression level is Formula 2. -ΔΔ C t Calculation. Term "C" t "or "C t "C-value" refers to the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. The C-value for each sample template... t The value of C is linearly related to the logarithm of the initial copy number of the template; the higher the initial copy number, the better the C value. t The smaller the value.
[0038] The term "high-temperature stress" refers to a high-temperature environment that is detrimental to plant growth and development, and may even inhibit plant life activities. High temperature is one of the important adverse environmental factors affecting plant growth. When the ambient temperature exceeds the temperature range that plants can adapt to and persists for a period of time, it will cause physiological damage to the plant. The most direct damage is protein denaturation, damage to biomembrane structure, and disorder of physiological and biochemical metabolism within the plant. This will inhibit plant growth and development activities or threaten its survival, and is called high-temperature damage, also known as heat injury.
[0039] Arabidopsis thaliana is currently the most commonly used plant for studying thermomorphogenesis, exhibiting optimal growth and performance at 22°C. However, temperatures above 29°C can stress Arabidopsis growth, causing structural and morphological distortions, reduced seed yield, and significant thermomorphological adjustments, specifically hypocotyl and petiole elongation, as well as stem growth and leaf drooping. Thermomorphological adaptations may alleviate high temperatures by enhancing leaf transpiration cooling.
[0040] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.
[0041] Kareliniacaspica is a perennial herbaceous plant belonging to the genus Kareliniacaspica in the family Asteraceae. It possesses broad-spectrum stress resistance and often grows in large clumps in harsh environments such as the Gobi Desert, deserts, and high-salt meadows (Flora of China, Volume 75, Science Press, September 1979, First Edition, pp. 54-55). It is an ideal material for conducting research on plant stress and screening for stress-resistance genes. However, there are currently few reports on research into high-temperature stress resistance genes in Kareliniacaspica.
[0042] This invention isolates and clones a transcription activator HEMERA (HMR) from wild *Ligustrum lucidum*, whose cDNA nucleotide sequence is shown in SEQ ID NO.3, is 1572 bp in length, and its open reading frame encodes a protein of 523 amino acid residues, the protein sequence of which is shown in SEQ ID NO.4. The *Ligustrum lucidum* HMR (KcHMR) gene participates in plant thermomorphogenesis at the protein level and is associated with the plant's response to high-temperature stress. The transcription activator HEMERA (HMR) encodes a key element in the phytochrome signaling pathway and is a dual nuclear and plastid target protein required for PHYB-mediated photomorphogenesis and thermomorphogenesis. The plastid HMR (pTAC12) is a photosynthetic gene encoded by the plastid, while the nuclear HMR is a transcription activator that can directly interact with PHYB and PIF4. HMR is involved in daytime temperature sensing through the PIF4 signaling pathway and functions at the protein level. PIF4 transcription is not directly regulated by HMR, but rather through its C-terminal transcriptional activation domain (TAD) inducing the expression of PIF4 target genes, thereby activating heat-responsive growth-related genes and promoting PIF4 accumulation. The HMR's TAD is essential for the stability of the PIF4 protein at warm temperatures. Studies have shown that HMR plays a more prominent role in daytime heat sensing as a co-activator of PIF4 transcription under red light (RC) and long-day (LD) conditions.
[0043] This invention overexpresses the gene in the model plant Arabidopsis thaliana, showing that transgenic Arabidopsis thaliana overexpressing the KcHMR gene and wild-type Arabidopsis thaliana exhibit phenotypic changes under high-temperature stress. However, the transgenic Arabidopsis thaliana shows significantly less leaf yellowing, curling, and cracking compared to wild-type Arabidopsis thaliana, and a significantly reduced degree of electrolyte leakage, indicating that its leaf damage is better than that of wild-type plants. Moreover, transgenic Arabidopsis thaliana overexpressing the KcHMR gene can activate oxidative stress defense capabilities more quickly, increase the activity of antioxidant-related superoxide dismutase, peroxidase, and catalase, reduce the content of malondialdehyde (MDA), a lipid peroxidation product, and alleviate chlorophyll decomposition. This allows for faster and better removal of harmful free radicals generated under high-temperature stress, effectively responding to oxidative damage caused by high-temperature stress and rapidly adapting to high-temperature environments through thermomorphogenesis, thereby enhancing the high-temperature resistance of Arabidopsis thaliana and improving the plant's tolerance to prolonged high-temperature environments.
[0044] The KcHMR gene of the plant *Corydalis odorata* of this invention has the ability to improve the heat resistance of plants. By overexpressing this gene, it can also be used to cultivate heat-resistant varieties of plants including cotton, rapeseed, rice, wheat, soybean, and corn.
[0045] Based on the above findings, one embodiment of the present invention provides a KcHMR gene, the cDNA sequence of which is shown in SEQ ID NO.3.
[0046] Another embodiment of the present invention provides a KcHMR protein, the amino acid sequence of which is shown in SEQ ID NO.4.
[0047] Another embodiment of the present invention provides the application of the KcHMR gene or its protein as described above in improving the heat stress tolerance of Arabidopsis thaliana.
[0048] The KcHMR gene provided in this invention is closely related to the heat tolerance of Arabidopsis thaliana at the protein level. This gene was cloned in vitro, and a KcHMR gene overexpression vector was constructed. Transgenic Arabidopsis thaliana plants were obtained using Agrobacterium-mediated transformation. Studies showed that these transgenic Arabidopsis thaliana plants exhibited significantly enhanced resistance to heat stress. Under 8 hours of heat stress, the degree of leaf damage and oxidative stress damage were significantly reduced compared to wild-type plants, confirming that this gene participates in the thermomorphogenesis of Arabidopsis thaliana and greatly improves the heat tolerance of transgenic plants. This invention provides excellent gene resources for the genetic improvement of heat-tolerant plants and has broad application prospects in the field of heat-tolerant plant breeding. Overexpression of the KcHMR gene provides a new approach to obtaining new plant varieties resistant to heat stress, which has important theoretical and practical significance for maintaining plant growth and development and increasing the yield of economic crops under climate warming conditions.
[0049] Optionally, the temperature of the high-temperature stress is not higher than 45℃ (including 45℃). Arabidopsis thaliana prefers a humid environment, and its suitable growth temperature is 21-25℃, with the optimal growth temperature being 22℃. Temperatures exceeding 29℃ will put pressure on the growth and development of Arabidopsis thaliana, causing thermomorphological adjustments. Therefore, for Arabidopsis thaliana, the temperature of high-temperature stress can be 29-45℃.
[0050] Based on the same inventive concept as described above, another embodiment of the present invention provides a method for cultivating heat-resistant Arabidopsis thaliana, comprising the following steps:
[0051] A KcHMR gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcHMR gene expression was obtained.
[0052] The original expression vectors used to construct overexpression vectors are any conventional expression vectors in this field, as long as they can contain the KcHMR gene and initiate the transcription and translation processes of that gene to achieve gene expression. Typical vectors include plasmids, viral vectors, bacteriophages, granules, and mini-chromosomes. Plasmids are the most common vector form.
[0053] When the KcHMR gene of this invention is constructed into an expression vector, a promoter can be added upstream of its transcription initiation nucleotide. This promoter can be a strong promoter, a specific promoter, or an inducible promoter to ensure transcription of the KcHMR gene. Furthermore, enhancers can also be used. These enhancer regions can be located upstream of the ATG start codon or adjacent start codons, but must be within the same reading frame as the coding sequence to ensure translation of the KcHMR gene.
[0054] In a typical implementation, the expression vector is selected as a plant expression vector; for example, the pK2GW7 vector can be selected.
[0055] Specifically, the construction of the KcHMR gene overexpression vector includes the following steps: using *Pterocarya stenoptera* genomic DNA as a template, the KcHMR gene is amplified by PCR using the primer pair shown in SEQ ID NO.5-6, and the amplified KcHMR gene is ligated into the plant expression vector pK2GW7 via a Gateway reaction to obtain the KcHMR gene overexpression vector.
[0056] More specifically, the Gateway reaction includes the following steps: ligating the amplified KcHMR gene to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TM The KcHMR gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcHMR gene overexpression vector.
[0057] Optionally, the PCR amplification program includes: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1.5 min, 32 cycles; 72℃ extension for 10 min.
[0058] Transformation of host cells using expression vectors can be performed using conventional techniques well known to those skilled in the art. Overexpression vectors carrying the KcHMR gene can be introduced into Arabidopsis cells or tissues using the following DNA transfection methods: calcium phosphate co-precipitation, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method, or Agrobacterium-mediated transformation, etc. The transformed cells or tissues can then be cultured into plants. For specific procedures, please refer to: Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).
[0059] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.
[0060] Example
[0061] 1. Discovery and cloning of the KcHMR gene in the Chinese tallow tree (Pterocarya stenoptera).
[0062] In this embodiment, a DNA sequence homologous to the Arabidopsis thaliana AtHMR gene was cloned from *Pterocarya stenoptera* and named KcHMR. This gene is related to the thermomorphogenesis of *Pterocarya stenoptera*, actively participates in the high-temperature stress response, and plays an important role in its heat tolerance. The *Pterocarya stenoptera* germplasm resources used were obtained from the Key Laboratory of Biological Resources Conservation and Utilization of the Xinjiang Production and Construction Corps in the Tarim Basin, and were collected in Alar City, Xinjiang Uygur Autonomous Region, China in October 2019. Specific procedures are as follows:
[0063] Total RNA extraction and genomic cDNA acquisition from *Hylocereus undatus* leaves: The RNAprepPure polysaccharide-polyphenol plant total RNA extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number DP441) was used, employing reverse transcriptase... One-Step gDNA Removal and cDNA Synthesis SuperMix (purchased from Quanshijin Company (Beijing), catalog number AE311-03) was used to reverse transcribe and synthesize cDNA. The reaction conditions were: 45℃ for 30 min, followed by 85℃ for 5 s.
[0064] Obtaining the full-length sequence of the KcHMR gene from *Pterocarya stenoptera*: Specific amplification primers KcHMR-F and KcHMR-R were designed based on the transcriptome sequence. Using *Pterocarya stenoptera* cDNA as a template, the open reading frame (ORF) of the KcHMR gene was amplified using PCR technology. PCR conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1.5 min, 32 cycles; 72℃ extension for 10 min. The amplified PCR product was ligated into the pMD-19T vector (purchased from TAKARA, catalog number 3271). Positive clones were screened and sequenced. The successfully constructed plasmid was named pMD-19T-KcHMR. The primer sequences (5′-3′) are shown below:
[0065] KcHMR-F: ATGATTTCTGGATGTGGCTGTGT (see SEQ ID NO. 1);
[0066] KcHMR-R: TTACTTATCCTGCTCAAAGTCCAACATGAAG (see SEQ ID NO. 2).
[0067] The full-length cDNA of the KcHMR gene is 1572 bp. Analysis of the obtained cDNA using the ORFFinder online tool revealed that the gene contains a complete ORF encoding 523 amino acids. Specifically, the cDNA sequence of the KcHMR gene is shown in SEQ ID NO. 3, and the amino acid sequence of the protein is shown in SEQ ID NO. 4.
[0068] The sequence of the KcHMR gene is shown below:
[0069]
[0070] The sequence of the KcHMR protein is shown below:
[0071] (See SEQ ID NO.4).
[0072] Sequence analysis was performed using MEGA 11.0 software and the NCBI online alignment tool BlastX. Figure 1 A phylogenetic tree of the KcHMR protein is presented. The results show that Tagetes erecta TeHMR (NCBI accession number: KAK1426744.1) and Tagetes erecta KcHMR share 89.67% homology at the protein level, exhibiting the highest similarity and the closest phylogenetic relationship.
[0073] 2. Construction of KcHMR gene overexpression vector
[0074] Primers KcHMRBP-F and KcHMRBP-R were designed based on the obtained KcHMR gene cDNA sequence. BP-LR adapter bases were added to both ends of the primers. PCR amplification was performed using pMD-19T-KcHMR plasmid as a template. PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1.5 min, 32 cycles; 72℃ extension for 10 min. PCR amplification yielded a PCR product containing the complete ORF. Primer sequences (5'-3') are shown below:
[0075] KcHMR-BP-F: ggggacaagtttgtacaaaaaagcaggcttcatgatttctggatgtggctgtgt (see SEQ ID NO. 5);
[0076] KcHMR-BP-R:ggggaccactttgtacaagaaagctgggtcttacttatcctgctcaaagtccaacatgaag (see SEQ ID NO. 6).
[0077] PCR products were ligated to pDONR via a BP reaction. TM 221 vector (BP enzyme and pDONR) TM The pONDR221 vector was purchased from Invitrogen (product number 11791-100), and the process includes: mixing the PCR product with the pONDR221 plasmid vector and adding it to the Gateway. TM BPClonase TM The enzyme mixture was used for the BP reaction. After ligation at 25°C for 1 hour, 1 μL of proteinase K was added to terminate the ligation. After incubation at 37°C for 10 minutes, the mixture was transformed into E. coli DH-5α competent cells using the heat shock method. Activated single colonies were picked, and colony PCR was performed using KcHMR-specific primers under the same PCR conditions. Positive clones were selected to extract plasmids. The successfully constructed BP plasmid was named pONDR221-KcHMR.
[0078] The KcHMR gene on the pONDR221-KcHMR plasmid was ligated into the plant expression vector pK2GW7.0 using the LR reaction (a gift from Huazhong Agricultural University; the LR enzyme was purchased from Invitrogen, USA, catalog number 11791-100). The process included: mixing the BP plasmid obtained in the previous step with the pK2GW7 plasmid vector, and adding Gateway... TM LRClonase TMThe enzyme mixture was ligated at 25°C for 1 hour, followed by the addition of 1 μL of proteinase K to terminate the ligation. After incubation at 37°C for 10 minutes, E. coli DH5α was transformed using the heat shock method. Activated single colonies were picked, and colony PCR was performed using specific primers for KcHMR under the same conditions. Positive clones were selected for plasmid extraction. The positive clones were the obtained overexpression vectors for transformation, named p35s-KcHMR. The vector map of p35s-KcHMR is shown below. Figure 2 .
[0079] The constructed p35s-KcHMR vector was transformed into Agrobacterium strain GV3101. The transformation method is described in the literature "Hellens RP, Mullineaux P, Klee HA guide to Agrobacterium binary Ti vectors[J]. Trends in Plant Science, 2000, 5(10): 446-451." Single colonies were picked and inoculated into LB liquid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin. The medium was cultured in a shaker at 150 rpm and 26 ℃ for 48 h. The bacterial culture was then added to a 1.5 mL centrifuge tube at a volume ratio of 1:1 to glycerol and mixed well. The medium was stored at -80 ℃ and then transformed into Arabidopsis thaliana using Agrobacterium-mediated transformation.
[0080] 3. Genetic transformation of the KcHMR gene and screening and identification of transgenic plants overexpressing the KcHMR gene
[0081] Preparation of Arabidopsis: Wild-type Arabidopsis thaliana L. Columbia ecotype seeds, after vernalization treatment, are sown in nutrient soil (purchased from Pinsch & Lomb peat moss in Denmark) and placed in an artificial culture room. They are cultured under 16 hours of light and 22±2℃ conditions until the Arabidopsis grows to about 4 leaves. Afterwards, seedlings are thinned to control the growth density. Conversion can begin when the Arabidopsis begins to flower after about 6 weeks of growth. The Arabidopsis should be thoroughly watered the day before conversion.
[0082] Activation of Agrobacterium: Glycerol tubes containing the target gene of strain GV3101 (Shanghai Weidi Biotechnology Co., Ltd., catalog number AE1001) stored in an ultra-low temperature freezer were thawed on ice, then streaked onto LB solid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin, and incubated in the dark at 28°C for 36-48 h. Single colonies were picked and incubated overnight at 28°C and 100 rpm in LB liquid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin until OD500 was reached. 600When the concentration is 0.8-1.0, it can be used for transformation. First, transfer the bacterial culture to a centrifuge tube and centrifuge at 5000 rpm for 5 min, then discard the supernatant. Add 100 mL of 5% (w / v) sucrose solution to resuspend Agrobacterium GV3101 and incubate at 28℃ in a shaker for 1-2 h. Add 0.02% (v / v) Silwet L-77 surfactant and shake to mix well.
[0083] Agrobacterium-mediated inflorescence transformation of Arabidopsis thaliana and screening of transgenic Arabidopsis: A method for transforming Arabidopsis thaliana using the floral dip method (Reference: Xiuren Z, Rossana H, Shih-Shun L, et al. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method[J]. Nature) Protocol, 2006, 2(1): 1-6.). The specific steps are as follows: (1) Immerse the Arabidopsis flower heads in Agrobacterium suspension and gently stir for about 30 seconds. Use a paper towel to absorb excess bacterial solution and wrap the Arabidopsis plant in a black plastic bag for 24 hours to keep it moist and dark. (2) After 24 hours, gradually open the plastic bag to allow air circulation and culture normally. (3) Repeat step (1) one week later. (4) Stop watering and harvest the seeds when they are mature, i.e., T1 generation seeds. (5) Disinfect the harvested seeds: first soak them in 70% (V / V) ethanol for 1 minute, and keep the seeds suspended from time to time during the above treatment. Then wash them four times with sterile water. (6) Soak the treated seeds in 0.1% (W / V) agar solution. (7) Spread evenly on the surface of solid MS medium containing 100 mg / L kanamycin; (8) Vernalize at 4℃ for 3 days, and after culturing in the culture room for 10 days, select a total of 35 plants with kanamycin resistance; (9) Transplant the 35 transgenic T1 generation Arabidopsis plants into soil culture, and collect seeds by individual plants after maturity, i.e., T2 generation seeds; (10) Repeat the operation steps (5)-(6) once with the collected T2 generation seeds; (11) Vernalize at 4℃ for 3 days, and after culturing normally for 10 days, calculate the segregation ratio of kanamycin resistant plants to non-resistant plants, and perform statistical analysis; (12) The lines that meet the segregation ratio of resistant to non-resistant plants of 3:1 are considered as single-copy lines, transplanted into soil culture, and after maturity, collect seeds by individual plants, i.e., T3 generation seeds.
[0084] Pure line detection of transgenic Arabidopsis plants: The collected T3 generation seeds were operated once using the above steps (5)-(6); then vernalized at 4℃ for 3 days, and then cultured in the culture room for 10 days. After that, the transgenic plants were checked to see if resistance segregation occurred on solid MS medium containing 100 mg / L kanamycin. The lines that did not show resistance segregation were transgenic pure line T4 generation seeds, which were used for the next step of phenotypic analysis and functional identification.
[0085] 4. Analysis of the high-temperature resistance of transgenic Arabidopsis thaliana
[0086] 4.1 Phenotypic analysis of Arabidopsis thaliana seedlings overexpressing KcHMR and wild-type Arabidopsis thaliana under high-temperature treatment
[0087] Three transgenic Arabidopsis thaliana strains were obtained and tested by PCR amplification. After high-temperature treatment, two strains (OE1 and OE2) with significant phenotypic differences from wild-type Arabidopsis thaliana were selected for physiological testing along with wild-type Arabidopsis thaliana (WT). The two transgenic Arabidopsis thaliana strains (OE1 and OE2) and wild-type Arabidopsis thaliana (WT) were sown in Arabidopsis thaliana-specific nutrient soil (purchased from Top peat moss from Pinsch, Denmark) and placed in an artificial climate culture chamber. They were cultured under conditions of 16 hours of light and 22±2℃. After 4 weeks of growth, the Arabidopsis thaliana were treated with a high temperature of 45℃ for 8 hours.
[0088] Figure 3 The aboveground phenotypic changes of wild-type Arabidopsis and transgenic Arabidopsis (OE1 and OE2) under high-temperature treatment for different durations are shown in Figures a and b, representing 0h, 3h, 6h, and 8h of treatment at 45℃. It can be seen that both wild-type and transgenic plants exhibited significant thermomorphological adjustments under 45℃ high-temperature stress, but the transgenic Arabidopsis remained in a relatively normal physiological state overall, with significantly less change in plant morphology and leaf curling compared to the wild-type. Specifically, the leaves of wild-type and KcHMR-overexpressing lines began to elongate and become upright at 3h of treatment. At 6h of treatment, the yellowing of wild-type leaves was more pronounced than that of transgenic lines, and the leaves of transgenic lines extended upwards. At 8h of treatment, the leaves of wild-type Arabidopsis showed yellowing, curling, and cracking. The leaves of the KcHMR-overexpressing OE2 line also showed yellowing, but to a lesser degree than the wild-type, while the leaf extension of OE1 was significantly better than that of the wild-type. The aforementioned results demonstrate that overexpression of the KcHMR gene in Arabidopsis thaliana enhances the heat tolerance of transgenic Arabidopsis thaliana.
[0089] 4.2 Analysis of physiological and biochemical indicators of Arabidopsis thaliana seedlings with KcHMR overexpression and wild-type Arabidopsis thaliana under high temperature treatment
[0090] Transgenic and wild-type Arabidopsis plants with similar growth were subjected to a 45℃ high-temperature treatment, with three replicates for each treatment. Samples were taken at 0 min, 5 min, 30 min, 120 min, and 240 min of the 45℃ high-temperature treatment to determine the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), malondialdehyde (MDA), chlorophyll content, and relative conductivity.
[0091] 1) Determination of antioxidant indicators: The methods for determining SOD, POD, CAT and MDA are as described in the instructions of the Solarbio SOD (Catalog No.: BC0175), POD (Catalog No.: BC0095), CAT (Catalog No.: BC0205) and MDA (Catalog No.: BC0025) content detection kits.
[0092] 2) Chlorophyll determination: Weigh 0.1g of young, green leaves, cut them into small pieces, and place them in 10mL of 95% ethanol solution. Keep them in the dark until the leaves turn white and harden. Using the 95% ethanol solution as a control, measure the absorbance at 470nm, 649nm, and 665nm using a UV spectrophotometer. Calculate the chlorophyll content using the relevant formula.
[0093] Chlorophyll a (Chla) = (13.95 × A) 665 -6.88×A 649 )×V÷W;
[0094] Chlorophyll b (Chlb) = (24.96 × A) 649 -7.32×A 665 )×V÷W;
[0095] Carotenoids (Car) = [(1000 × A)] 470 -2.05×Chla-114.8×Chlb) / 248]×V÷W;
[0096] Total chlorophyll content = Chla + Chlb;
[0097] In the above formula, V represents the volume of 95% ethanol (unit: L); W represents the fresh weight of the leaf (unit: g); A represents the absorbance value, and the numerical value represents the absorbance value at the corresponding wavelength.
[0098] 3) Relative conductivity measurement: Take 1g of leaf at each time point, put it into 10mL of distilled water and let it stand for 12h to measure the conductivity R1. After boiling for 30min, cooling and shaking, measure the conductivity R2. Calculate the relative conductivity (relative conductivity) = (R1 / R2) × 100.
[0099] Under high-temperature stress, harmful free radicals in plants increase. Superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), as protective enzymes, can scavenge reactive oxygen species in plants, thereby improving stress resistance. Furthermore, as temperature rises, the stability of plant cell membranes is disrupted. Changes in malondialdehyde (MDA) and relative conductivity can indicate the extent of cell membrane damage; the greater the damage, the higher the values. Chlorophyll a, chlorophyll b, and carotenoids decompose at high temperatures. Carotenoids, in particular, can scavenge reactive oxygen species in plants and can be used to assess plant stress resistance.
[0100] Figure 4 The changes in SOD, POD, CAT activities, and MDA content in leaves of wild-type Arabidopsis and transgenic Arabidopsis overexpressing KcHMR under different durations of 45°C high-temperature stress treatment are shown. SOD activity indicates that wild-type SOD activity showed a continuous decreasing trend from 0 to 120 min with increasing high-temperature treatment time, followed by an increase, reaching less than 30% at 240 min compared to the untreated state. In contrast, the SOD activity of the overexpressing lines OE1 and OE2 increased rapidly after 5 min of high-temperature treatment, increasing by approximately 49% at 240 min. CAT activity shows that the CAT activity of wild-type plants initially increased and then decreased, while the CAT activity of the KcHMR overexpressing lines exhibited a high-low-high trend, and was significantly higher than the wild-type at all treatment times except 30 min. The CAT content of the overexpressing lines reached its highest value at 5 min of treatment. POD activity showed that wild-type POD activity decreased with increasing temperature, while the POD activity of the overexpressing lines recovered to the level before high-temperature treatment after 30 min. Throughout the treatment process, the POD activity of the overexpressing lines was significantly higher than that of the wild type. MDA content indicated that the MDA content of the wild-type and overexpressing lines was basically the same before high-temperature treatment. With prolonged high-temperature treatment, the MDA content of the wild-type lines increased, while the overexpressing lines decreased after 30 min of treatment and slightly increased after 240 min, but both were significantly lower than the wild type. Overall, during high-temperature treatment, the relative contents of SOD, CAT, and POD in transgenic lines OE1 and OE2 were higher than those in the wild type, while the MDA content was significantly lower. This confirms that overexpression of the KcHMR gene is beneficial for Arabidopsis thaliana to activate oxidative stress defense capabilities more quickly, better scavenge harmful free radicals in the plant, and thus more efficiently cope with oxidative damage caused by high temperatures. This plays an important role in improving the resistance of Arabidopsis thaliana to high-temperature stress.
[0101] Figure 5The changes in chlorophyll content in leaves of wild-type Arabidopsis and KcHMR-overexpressing transgenic Arabidopsis under 45℃ high-temperature stress at different treatment times are shown. It can be seen that chlorophyll a and chlorophyll b in both wild-type and KcHMR-overexpressing transgenic Arabidopsis decrease with increasing temperature. The carotenoid content in wild-type Arabidopsis decreases with increasing treatment time, while the KcHMR-overexpressing lines show an initial increase followed by a decrease with increasing temperature and treatment time, but all are significantly higher than the wild type. Total chlorophyll content shows that the total chlorophyll content of wild-type plants decreases with increasing treatment time. The decrease in total chlorophyll content in KcHMR-overexpressing lines is small before 240 min of treatment, but increases at 240 min, still higher than the wild type. These results demonstrate that overexpression of the KcHMR gene is beneficial in reducing the degree of chlorophyll decomposition in transgenic Arabidopsis leaves under high-temperature stress, especially carotenoids. This also helps improve Arabidopsis' resistance to oxidative damage under high-temperature stress and enhances its heat resistance.
[0102] Figure 6 The changes in relative electrical conductivity of leaves in wild-type Arabidopsis and transgenic Arabidopsis overexpressing KcHMR at different times under 45°C high-temperature stress are shown. The relative electrical conductivity of the wild-type plant increased with increasing treatment time, while that of the overexpression line began to decrease at 30 min and remained essentially unchanged. Furthermore, the relative electrical conductivity of both transgenic lines was significantly lower than that of the wild-type plants after 30 min of high-temperature treatment. Relative electrical conductivity can indicate the degree of leaf membrane damage and electrolyte leakage; a higher value indicates more severe damage. These results suggest that under prolonged high-temperature stress, the transgenic lines exhibited better electrolyte leakage than wild-type Arabidopsis, demonstrating greater high-temperature resistance.
[0103] In the above data, *p<0.05, **p<0.01, ***p<0.001; ns, not significant.
[0104] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A KcHMR gene, characterized in that, The cDNA sequence of the gene is shown in SEQ ID NO.
3.
2. A KcHMR protein, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
4.
3. The application of the KcHMR gene as described in claim 1 or the KcHMR protein as described in claim 2 in improving the heat stress tolerance of Arabidopsis thaliana.
4. The application of the KcHMR gene or KcHMR protein according to claim 3 in improving the heat stress tolerance of Arabidopsis thaliana, characterized in that, The temperature of the high-temperature stress shall not exceed 45°C.
5. A method for cultivating heat-resistant Arabidopsis thaliana, characterized in that, Includes the following steps: A KcHMR gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcHMR gene expression was obtained; wherein, the cDNA sequence of the KcHMR gene is shown in SEQ ID NO.
3.
6. The method for cultivating heat-resistant Arabidopsis thaliana according to claim 5, characterized in that, The construction of the KcHMR gene overexpression vector includes the following steps: Using *Illicium verum* genomic DNA as a template, the KcHMR gene was amplified by PCR using the primer pairs shown in SEQ ID NO.5-6. The amplified KcHMR gene was then ligated into the plant expression vector pK2GW7 via a Gateway reaction to obtain the KcHMR gene overexpression vector.
7. The method for cultivating heat-resistant Arabidopsis thaliana according to claim 6, characterized in that, The Gateway reaction includes the following steps: The amplified KcHMR gene was ligated to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TM The KcHMR gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcHMR gene overexpression vector.
8. The method for cultivating heat-resistant Arabidopsis thaliana according to claim 6, characterized in that, The PCR amplification program included: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 57 °C annealing for 30 s, 72 °C extension for 1.5 min, 32 cycles; 72 °C extension for 10 min.
9. The method for cultivating heat-resistant Arabidopsis thaliana according to claim 5, characterized in that, The transformation method is selected from viral vector method, gene gun method, microinjection method, electroporation method or Agrobacterium-mediated method.
Citation Information
Patent Citations
Method for cultivating high-temperature-resistant arabidopsis through gene KcNHX1 of karelinia caspia
CN103421812A
Thermal response KcRCB protein, coding gene thereof and application of thermal response KcRCB protein in enhancing high temperature stress resistance of plants
CN117659150A