NlMATH3 gene of brown planthopper and its application in controlling brown planthopper

Abstract

The present invention discloses a brown planthopper NlMATH3 gene and its application in controlling brown planthopper. The nucleotide sequence of the brown planthopper NlMATH3 gene is shown in SEQ ID NO. 1. The present invention discloses for the first time the application of the brown planthopper NlMATH3 gene as a target in controlling brown planthopper. By silencing the NlMATH3 gene, the ovarian development and egg laying number of the brown planthopper can be affected, so that the number of brown planthopper offspring produced and the egg survival rate are reduced, thereby achieving the purpose of controlling brown planthopper.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a brown planthopper NlMATH3 gene and an application thereof in preventing and controlling the brown planthopper. Background Art

[0002] Brown planthopper (BPH; Nilaparvata lugens Stal., belonging to the family Homoptera: Delphacidae, is one of the important pests of rice in many Asian countries and my country. Brown planthoppers can migrate long distances and have strong adaptability to the environment, but they can only feed and reproduce on rice and wild rice (Sogawa, 1982; Velusamy et al ., 1986; Dyck et al ., 1979; Hong Xiaoyue et al., 2007; Wang et al., 2008). The piercing-sucking mouthparts of brown planthoppers can penetrate into the host plant and use their mouth needles to suck phloem sap to maintain their own life activities. Brown planthoppers not only feed on phloem sap, which directly affects the growth and development of host plants, but also form salivary sheaths when feeding, which block the vascular bundles of host plants. After feeding, brown planthoppers secrete a large amount of "honeydew", which contains a large amount of amino acids and sugars, which can infect host rice with bacteria (Li Chunfeng et al., 2019). In addition, brown planthoppers are also the vector insects for the spread of grassy bushy dwarf disease and toothed leaf dwarf disease (Hibino, 1996; Cheng Xianian et al., 2003). When rice in the field is severely damaged by brown planthoppers, it will cause large-scale lodging and death of rice, resulting in the phenomenon of "louse burn", and thus no grains will be harvested. Long ago, although brown planthoppers broke out sporadically, once they did, they were catastrophic (Suenaga & Nakatsuka, 1958; Miyashita, 1963). Since 1970, brown planthoppers have frequently broken out in some tropical countries. After 2000, the frequency and scale of brown planthopper outbreaks in rice-producing areas throughout Asia have gradually expanded (Catindig et al., 2009). According to statistics, from 2005 to 2007, more than 25 million hectares of rice fields in my country were affected by brown planthoppers every year (Qiu et al., 2012). In the past three decades, there are three main characteristics of brown planthoppers harming rice in my country: increased frequency of outbreaks, expanded scope of damage, and increased degree of damage (Wang Peng et al., 2013). Brown planthoppers cause a reduction in rice production of approximately 1 to 1.5 billion kilograms each year, equivalent to tens of billions of yuan in economic losses. At present, insecticides are generally used to control brown planthoppers. However, with the extensive use of insecticides, brown planthoppers have developed resistance to insecticides such as pyrethroids, carbofuran, cypermethrin, and even synthetic pyrethroids (Nagata, 1982; Lakshmi et al., 2010). Large-scale spraying of pesticides is not only harmful to humans and animals, but also causes serious environmental pollution and soil erosion. Therefore, it is of great significance to actively carry out research and application of biological control technology for brown planthoppers, implement scientific and effective control of the harm of brown planthoppers in my country and the world, and ensure my country's food security and environmental safety.

[0003] RNAi technology is RNA interference technology. RNAi mainly refers to the technology of silencing the target gene mRNA induced by double-stranded RNA (dsRNA), thereby affecting the normal life activities of the target organism. Since its discovery, it has developed rapidly and become an effective tool for gene function research. In insect-related research, the fields of RNAi technology are mainly concentrated in gene function, RNAi-induced transgenic insect-resistant plants, and beneficial insect disease control (Baum et al. , 2007; Tian et al. , 2009; Chen et al. , 2010; Hunter et al. , 2010;Yao et al. , 2010). There are three main methods for introducing the drug into insects, namely feeding, injection and tissue culture. The best method should be selected according to different experimental requirements. For example, silencing pea aphids ( Acyrthosiphonpisum The experiment on salivary protein C002 was the first experiment to study the function of salivary protein in piercing-sucking insects. Through the experiment, it was found that the feeding of pea aphids was closely related to C002 salivary protein (Mutti et al. , 2006). Ji Rui (2013) found that the amount of honeydew was significantly reduced and the mortality rate was significantly increased after silencing the salivary protein Nl1860 through RNA interference technology. On the other hand, the use of RNA interference to study salivary proteins also has certain limitations. For example, some genes of some insects only appear in certain insect ages, specific periods or specific tissues; for example, in the tobacco moth ( Manduca sextai ) and silkworm ( Bombyx mori ) Gene silencing is difficult in other biological tissues except hemolymph (Eleftherianos et al. , 2007; Miller et al. , 2008; Huang Xiaohui, 2016); on the other hand, some salivary protein genes are indispensable for the normal development of insects. If RNA interference is performed on these genes, the insects will die quickly, making it difficult to conduct subsequent experiments on the role of the gene in insect feeding. At present, the technology of using RNAi to interfere with insects has become relatively mature. Due to the simplicity of RNAi technology and relatively low cost, and more importantly, the specificity and high efficiency of RNAi technology, it has been widely used in various fields of insect research (Bellés, 2010), such as verification of insect gene function, pest control and prevention, and new targets for pesticide development (Tian Honggang et al., 2012; Wang Huidong et al., 2012). Therefore, it is of great significance to explore and identify new functional specific genes and dsRNA of brown planthoppers and cultivate new varieties resistant to brown planthoppers using transgenic technology to ensure my country's food security and environmental safety. Summary of the invention

[0004] The purpose of the first aspect of the present invention is to provide the brown planthopper NlMATH3 gene, the nucleotide sequence of the NlMATH3 gene is shown in SEQ ID NO.1.

[0005] The second aspect of the present invention is to provide a dsRNA that silences the NlMATH3 gene and can affect the ovarian development and egg laying number of brown planthoppers, reduce the number of brown planthopper offspring and reduce the egg survival rate, thereby achieving the purpose of controlling brown planthoppers. One chain of the dsRNA is shown in SEQ ID NO.2.

[0006] The third aspect of the present invention aims to provide a gene encoding the above-mentioned dsRNA, whose nucleotide sequence is shown as SEQ ID NO.3.

[0007] The fourth aspect of the present invention aims to provide a recombinant expression vector, a recombinant microorganism or a transgenic cell line containing the gene encoding the above-mentioned dsRNA.

[0008] The fifth aspect of the present invention aims to provide a drug for controlling brown planthoppers, which contains the above-mentioned dsRNA or the coding gene of dsRNA or the recombinant expression vector, recombinant microorganism or transgenic cell line containing the coding gene of the above-mentioned dsRNA as an active ingredient.

[0009] The sixth aspect of the present invention aims to provide the use of the above-mentioned dsRNA or the gene encoding the dsRNA or the recombinant expression vector, recombinant microorganism or transgenic cell line containing the gene encoding the dsRNA in controlling brown planthoppers.

[0010] The seventh aspect of the present invention aims to provide a method for controlling brown planthoppers, comprising introducing the above-mentioned dsRNA into brown planthoppers.

[0011] Preferably, the introduction is by injection and / or feeding.

[0012] The beneficial effects of the present invention are:

[0013] The present invention discloses for the first time the application of the NlMATH3 gene of brown planthopper as a target in the prevention and control of brown planthopper. By silencing the NlMATH3 gene, the ovarian development and egg laying number of brown planthopper can be affected, the number of brown planthopper offspring produced is reduced and the egg survival rate is reduced, thereby achieving the purpose of preventing and controlling brown planthopper. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the expression level diagram of salivary protein gene NlMATH3 in different instars and tissues of brown planthopper: A is the expression level diagram of NlMATH3 in brown planthopper at different instars (1, 2, 3, 4, 5 represent 1st instar nymph, 2nd instar nymph, 3rd instar nymph, 4th instar nymph and 5th instar nymph, respectively; A1, A3, A5, A7, A9, A11, A13, A15 represent brown planthopper at 1, 3, 5, 7, 9, 11, 13 and 15 days after eclosion, respectively); B is the expression level diagram of NlMATH3 in different tissues of brown planthopper (Lg, Fb, Hd, Ov, By and Mg represent head, salivary gland, ovary, midgut, foot and fat body, respectively).

[0015] Figure 2 This is the expression level of salivary protein gene NlMATH3 in brown planthopper after microinjection of dsRNA. * indicatesp <0.01.

[0016] Figure 3 These are the morphological images of the ovary development of brown planthoppers under different treatments: the left one is the anatomical morphology of the ovary of brown planthoppers injected with dsGFP; the right one is the anatomical morphology of the ovary of brown planthoppers injected with ds NlMATH3.

[0017] Figure 4 The figure is the number of eggs laid and the hatching rate of eggs of brown planthoppers with different treatments after rice oviposition: the left figure is the number of eggs laid by brown planthoppers with different treatments after rice oviposition; the right figure is the hatching rate of eggs of brown planthoppers with different treatments after rice oviposition; * indicates significant difference ( p <0.05).

[0018] Figure 5 The diagram shows the changes in the gene related to the fertility of brown planthoppers under different treatments: the left one shows the changes in the expression of the gene VgR related to the fertility of brown planthoppers under different treatments; the right one shows the changes in the expression of the gene Vg related to the fertility of brown planthoppers under different treatments, * indicates p <0.01. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below with reference to specific embodiments and drawings.

[0020] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0021] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0022] The brown planthopper used in the following examples was raised at the Institute of Plant Protection, Guangdong Academy of Agricultural Sciences, and grown on the non-insect-resistant rice variety Taichung Native 1 (TN1) at a temperature of 27±0.5°C.

[0023] Example 1 Cloning of the NlMATH3 gene of the brown planthopper

[0024] Thirty brown planthoppers that were reared on TN1 rice for multiple generations were used to extract total RNA. The total RNA of female adults of brown planthoppers was extracted using the Trizol method. The specific operation was as follows:

[0025] 1) Place brown planthopper samples in grinding tubes, freeze them quickly in liquid nitrogen, add 200 μL Trizol reagent and grind them thoroughly on ice immediately.

[0026] 2) Add 800 μL of Trizol reagent, blow and clean the brown planthopper tissue residues remaining on the grinding rod, mix thoroughly, and let it stand at room temperature for 5 min.

[0027] 3) Add 200 μL of trichloromethane, shake rapidly for 15 s, and let stand at room temperature for 20 min.

[0028] 4) Centrifuge at 12,333 g for 15 min at 4 °C.

[0029] 5) Aspirate the supernatant, add 500 μL of Dimethylcarbinol (isopropanol), shake rapidly for 15 s, and let stand at room temperature for 20 min.

[0030] 6) Centrifuge at 12,333 g for 15 min at 4 °C.

[0031] 7) Discard the supernatant and add 400 μL 75% Ethanol to wash the precipitate.

[0032] 8) Centrifuge at 7,333 g for 5 min at 4 °C.

[0033] 9) Remove the supernatant by aspiration, dry the precipitate in a clean bench, and add 30 μL of DEPC (diethylpyrocarbonate) water to dissolve the precipitate.

[0034] 10) Quickly freeze the RNA in liquid nitrogen for 10 s and store it in a -80 ℃ freezer.

[0035] The concentration and purity of the extracted total RNA were measured using a NanoDrop spectrophotometer at a wavelength of 280 nm.

[0036] Take 2 μL of total RNA sample for 1% agarose gel electrophoresis detection, and set the electrophoresis setting at 160 V 500 mA for 30 min. Analysis of electrophoresis results: Two bands (28 s and 18 s) can be clearly observed on the electrophoresis gel, without diffusion, and no bands greater than 28 s, which can be used for subsequent experiments.

[0037] Reverse RNA to full cDNA sequence, and follow the instructions of Takara's PrimeScriptTM RT reagent Kitwith gDNA Eraser (cDNA RT reagent Kit http: / / www.takara.com.cn) first-strand cDNA synthesis kit to reverse transcribe the total RNA extracted in the previous step into cDNA. The specific steps are as follows:

[0038] 1) Removal of genomic DNA from RNA: Add the corresponding volumes of components (as shown in Table 1) to a 0.2 ml RNase-free EP tube (on ice), mix well, and place in a dry thermostat at 42 °C for 2 min.

[0039]

[0040] 2) Reverse transcription reaction (synthesis of first-strand cDNA): Add the components and volumes shown in Table 2 to the above reaction solution in sequence (operate on ice);

[0041]

[0042] 3) After the above system is mixed evenly, place it in a PCR instrument for the next step of reaction. The program setting of the PCR instrument is: 37 ℃, 20 min; 85 ℃, 5 s. After the PCR reaction is completed, the reaction solution (cDNA template) is stored in a refrigerator at -20 ℃.

[0043] Example 2 NlMATH3 gene in different tissues and different ages of brown planthopper

[0044] Six different tissues (including legs, fat body, head, ovary, epidermis and midgut) of short-winged female adults of brown planthoppers subcultured on rice variety TN1 were dissected under a stereoscope using forceps and insect pins in a clean environment, and each treatment was repeated 5 times. Total RNA from each tissue was extracted, reverse transcribed into first-chain cDNA (the specific method is the same as in Example 1), and detected by fluorescent quantitative PCR technology using Roche's quantitative reagent. The components of the fluorescent quantitative PCR reaction solution are shown in Table 3.

[0045]

[0046] The above reaction solution was dispensed into 3 wells of a 96-well plate, with about 10 μL in each well.

[0047] PCR reaction program: ① The pre-denaturation stage was set at 95 ℃ for 5 min; ② The reaction stage was set at 95 ℃ for 5 s, 60 ℃ for 20 s, and 40 cycles were run; ③ The end stage was set to be stored at 4 ℃. The fluorescence quantitative PCR instrument used was the ROCH LightCycler 480TM Real-time System (Roch, USA). The quantitative data was analyzed and exported by the software that came with the LightCycler 480 instrument, and the exported data was the Ct value. The brown planthopper actin gene (GenBank: EU179848) was selected as the internal reference, and the final melting curve was generated (65 ℃ to 95 ℃).

[0048] After the reaction was completed, the Ct value was imported into the Excel table and the -△△ Ct method, compared with the actin gene, to calculate the relative expression of each gene. Figure 1 As shown in B: NlMATH3 is most highly expressed in the ovary of the brown planthopper, with a small amount of expression in the fat body, and extremely low (almost absent) expression in the midgut, leg, head, and epidermis.

[0049] Total RNA of brown planthoppers of different ages (1-5 instar nymphs and short-winged female brown planthoppers at 1, 3, 5, 7, 9, 11, 13, and 15 days after eclosion) subcultured on rice variety TN1 was extracted, reverse transcribed into first-chain cDNA (the specific method is the same as in Example 1), and detected by fluorescent quantitative PCR technology using quantitative reagents of Kangrun Company (the specific method is the same as the determination of NlMATH3 gene expression in different tissues). The results are as follows Figure 1 As shown in A: NlMATH3 is expressed at a low level in 1-5 instar nymphs, and its expression increases with the age of the adult. Among them, the expression level of NlMATH3 gene in short-winged female brown planthoppers at 7 and 9 days after eclosion is higher than that in other periods, with the highest expression level at 7 days after eclosion, and then gradually decreases.

[0050] Primers for internal reference gene actin:

[0051] Actin-F:ATGAAACCGTCTACAACTCG;

[0052] Actin-R: GCATCCTGTCGGCAATAC;

[0053] The quantitative primers for NlMATH3 are NlMATH3-F3 and NlMATH3-R3:

[0054] NlMATH3-F3: TAAGCTTACCATCTTTTGCGAG;

[0055] NlMATH3-R3:ACTTTGAACTGCACGGCATTC.

[0056] Example 3 Preparation of dsRNA

[0057] 1) Using the full cDNA sequence obtained by inversion in Example 1 as a template, NlMATH3-F2 and NlMATH3-R2 as primers for PCR amplification, the PCR amplification system is shown in Table 4, and the PCR reaction program is as follows: ① pre-denaturation at 95°C for 5 min; ② 35 cycles under the conditions of 95°C for 30 s, 57°C for 30 s, and 72°C for 40 s; ③ 72°C extension for 10 min; Finally, the PCR amplification product 1 was obtained and stored in a 4°C refrigerator.

[0058]

[0059] NlMATH3-F2: GGTGCTTACGTGTTAATCCA;

[0060] NlMATH3-R2: TGAACAAACCTGTAGGCTCT;

[0061] 2) Using the plasmid containing green fluorescent protein GFP (GenBank: ACY56286) as a template and GFP-F and GFP-R as primers, PCR amplification was performed to obtain PCR amplification product 2. The PCR reaction system is shown in Table 5. The PCR reaction procedure was as follows: ① pre-denaturation at 95 °C for 5 min; ② 35 cycles at 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 40 s; ③ extension at 72 °C for 10 min; finally, the PCR amplification product 2 was obtained and stored in a 4 °C refrigerator.

[0062]

[0063] GFP-F: AAGGGCGAGGAGCTGTTCACCG;

[0064] GFP-R: CAGCAGGACCATGTGATCGCGC.

[0065] 3) Recover amplified products 1 and 2, add A, connect to pMD18-T (TAKARA) vector, and send positive clones for sequencing. Get the correct clone, use the clone plasmid as a template, and amplify with the above primers. Purify the amplified product and concentrate it to a concentration of lug / uL. This product is the template for the synthesis of dsRNA (ds NlMATH3, dsGFP).

[0066] 4) Synthesis of dsRNA

[0067] a) Crossover PCR

[0068] Cross-PCR includes A reaction and B reaction, where the system of A reaction is shown in Table 6, and the system of B reaction is shown in Table 7. The PCR reaction program is as follows: ① The pre-denaturation stage is set at 94℃ for 5 min; ② The reaction stage is set at 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 1 min, and runs for 35 cycles; ③ The end stage is set at 72℃ for 10 min and stored at 4℃. The amplified product was detected by 1% agarose gel electrophoresis, and the program was 150V 500mA 30min.

[0069]

[0070] T7_ NlMATH3-F2: GGATCCTAATACGACTCACTATAGG GGTGCTTACGTGTTAATCCA;

[0071] NlMATH3-R2:TGAACAAACCTGTAGGCTCT;

[0072] T7_GFP-F: GGATCCTAATACGACTCACTATAGG AAGGGCGAGGAGCTGTTCACCG;

[0073] GFP-R: CAGCAGGACCATGTGATCGCGC;

[0074] The underlined region is the T7 RNA polymerase promoter sequence.

[0075]

[0076] NlMATH3-F2:GGTGCTTACGTGTTAATCCA;

[0077] T7_ NlMATH3-R2: GGATCCTAATACGACTCACTATAGG TGAACAAACCTGTAGGCTCT;

[0078] GFP-F: AAGGGCGAGGAGCTGTTCACCG (SEQ ID NO. 6);

[0079] T7_GFP-R: GGATCCTAATACGACTCACTATAGG CAGCAGGACCATGTGATCGCGC;

[0080] The underlined region is the T7 RNA polymerase promoter sequence.

[0081] b) Transcription of ssRNA.

[0082] Preheat RiboMAX at 37°C TM ExpressT7 2× buffer, and mix by inverting; add the system as shown in Table 8 to 0.2 mL RNase-free centrifuge tubes, mix gently, and keep in a constant temperature water bath at 37℃ for 4 h.

[0083]

[0084] c) Mix the reverse transcription products of reaction A and reaction B respectively, place in a 70℃ constant temperature water bath for 10 min, then let stand at room temperature for 20 min, add 2 µL RQ1 RNase-Free DNase and 2 µL 200-fold diluted RNaseA solution, and place in a 37℃ constant temperature water bath for 30 min.

[0085] 5) dsRNA purification.

[0086] Add 4.4 µL 3 M sodium acetate (pH 5.2) and 110 µL 95% ethanol, mix well by pipetting, and place on ice for 5 min. Centrifuge at 14,000 rpm for 10 min and discard the supernatant. Wash the precipitate with 0.5 mL 70% ice ethanol, centrifuge at 14,000 rpm for 10 min and discard the supernatant. Dry in a clean bench for 15 min and add 50 µL of diethyl pyrocarbonate (DEPC) water to dissolve the precipitate.

[0087] 1% agarose gel electrophoresis was performed, and the program was 150V 500mA 30min. The concentration of dsRNA was measured by spectrophotometer at 280nm. According to the concentration, dsRNA (ds NlMATH3 (the nucleotide sequence of one chain is as follows: GGTGCTTACGTGTTAATCCAAAAGGCTTAGACGAAGAAAGCAAAGATTACCTTTCACTCTACCTACTCCTTGTATCTTGTAACAAATCTGAAGTCAGAGCAAAGTTTAAATTCTCCATTCTGAATGCAAAAAGAGAAGAAACCAAAGCTATGGAAAGCCAAAGAGCCTACAGGTTTGTTCA) and dsGFP (the nucleotide sequence of one chain is as follows:) were adjusted to 500 ng / uL, and 1 mL was dispensed into each tube and stored at -80℃.

[0088] Example 4 Microinjection of dsRNA and Effect Detection

[0089] 1. Preparation of brown planthoppers: 50 short-winged female adults, one day after eclosion, subcultured on TN1 rice were taken for injection.

[0090] 2. Plate preparation: Weigh 3 g of agar powder and add it to 200 mL of water, boil it, pour it into a glass plate, and wait for it to solidify for later use.

[0091] 3. Injection: Take 50 worms of similar growth and put them in a test tube. Pass CO2 for anesthesia for 15 seconds. Do not blow towards the worms when passing CO2 to avoid flying around and causing collision damage or loss. Then pour the worms on a 1.5% agar plate with the abdomen facing up. Use Nanoliter 2010 microinjector to inject dsRNA (ds NlMATH3) according to the instructions. The injection position is between the front and middle thorax, and the injection volume is 1uL (500ng / uL).

[0092] 4. After the brown planthoppers were injected with dsRNA, sampling was started from the first day after injection, with three heads sampled every day for three days. The brown planthoppers injected with an equal amount (1uL) of 500ng / uL dsGFP (the operation method was the same as that of ds NlMATH3 treatment) were taken as controls, and the changes in gene expression were verified by RT-PCR.

[0093] The specific operation is as follows: After sampling, extract RNA (refer to 2.1.2), and use TAKARA's PrimeScript RT reagentKit with gDNA Eraser (Cat. No. RR047A) to reverse according to the instructions to obtain the reversed product. Take 5 uL of the cDNA obtained by the reverse, dilute it 10 times, and perform real-time quantitative PCR according to the following operation. The PCR reaction was carried out on the CFX96TouchTM Real-TimePCR Detection System (Bio-Rad) instrument, following the following reaction system: DNase / RNase-FreeddH2O 2.9uL, 2× Supermix 4uL, Primers (5mM) 0.6uL, cDNA template 0.5uL, reaction conditions: 95℃ pre-denaturation for 2min, 95℃ denaturation for 10s, 55-65℃ annealing and extension for 20s, repeat the latter two steps for 40 cycles, and finally 65℃-95℃, increase 0.5℃ each step, and make a melting curve for 5s to determine the specificity of the amplified product. Each sample was repeated three times, and the quantitative data were analyzed and exported by the software of the LightCycler480 instrument. The exported data were Ct values. The brown planthopper actin gene (GenBank: EU179848) was selected as the internal reference, and the melting curve (65 ℃ to 95 ℃) was finally generated. After the reaction was completed, the Ct value was imported into the Excel table and the 2 -△△Ct The relative expression of each gene was calculated by comparing it with the actin gene.

[0094] Primers for internal reference gene actin:

[0095] Actin-F:ATGAAACCGTCTACAACTCG;

[0096] Actin-R: GCATCCTGTCGGCAATAC;

[0097] The quantitative primers for NlMATH3 are NlMATH3-F3 and NlMATH3-R3:

[0098] NlMATH3-F3: TAAGCTTACCATCTTTTGCGAG;

[0099] NlMATH3-R3:ACTTTGAACTGCACGGCATTC.

[0100] The results are as follows Figure 2As shown: Compared with the control group injected with dsGFP, the relative expression level of the NlMATH3 gene in the brown planthopper in the experimental group injected with dsNlMATH3 was significantly reduced from the first day of injection, less than 10%, which was significantly different from the control ( P < 0.05); the results showed that microinjection of ds NlMATH3 could induce the RNAi effect of NlMATH3 gene secretion during egg laying in brown planthoppers, resulting in a significant decrease in gene expression.

[0101] Example 5 Detection of Oviposition Behavior of Brown Planthopper after Microinjection of dsRNA

[0102] First, short-winged female and male adults of brown planthoppers that had emerged one day after being subcultured on TN1 rice were selected and treated with the following two methods: ds NlMATH3: injection of NlMATH3 dsRNA; dsGFP: injection of GFP dsRNA, with 50 insects in each treatment. After treatment, they were placed on TN1 rice to recover for 3 days, and the surviving brown planthoppers were used for subsequent experiments.

[0103] Brown planthopper egg-laying behavior experiment 1: Under a stereomicroscope, ovaries of brown planthoppers with different treatments were dissected using forceps and insect pins. The results are shown in the figure. Figure 3 The left picture in the figure shows the ovary morphology of brown planthoppers injected with dsGFP. We found that the ovaries of brown planthoppers injected with dsGFP were well developed and the eggs were full. Figure 3 The right picture in the figure shows the ovarian morphology of brown planthoppers injected with ds NlMATH3. After injection of ds NlMATH3, the ovarian development of brown planthoppers was abnormal, the lipids near the ovaries decreased, the number of eggs decreased, and the ovarian development was retarded. Due to the reduced expression of the NlMATH3 gene, the development of the ovaries of brown planthoppers was hindered, which in turn affected the egg-laying behavior of brown planthopper adults.

[0104] Brown planthopper egg-laying behavior experiment 2: Place a single female adult and two male adults of brown planthoppers after different treatments on the same rice seedling, and cover the rice seedling with a net bag to prevent the brown planthoppers from escaping; 24 hours later, use a rubber straw to suck out the single female adult and two male adults of brown planthoppers and place them on another new rice seedling, and under a stereoscopic microscope, use forceps and insect pins to dissect the brown planthopper eggs in a single rice stem, and so on, replace and count the number of brown planthopper eggs every 24 hours, and the experiment ends when the brown planthoppers are 15 days old, and the experiment is repeated 10 times. Data are as follows Figure 4 As shown in the left figure, due to the reduced expression of this gene, the egg-laying of brown planthoppers is affected, which in turn affects the egg-laying rate of brown planthopper adults.

[0105] Brown planthopper egg-laying behavior experiment 3: Similarly, single female adult brown planthopper and two male adult brown planthoppers after different treatments were placed on the same single rice seedling, and the rice seedlings were covered with a net bag to prevent the brown planthoppers from escaping; after 24 hours, the single female adult brown planthopper and two male adult brown planthoppers were sucked out with a rubber straw and placed on another new rice seedling, and the rice seedlings with brown planthopper eggs in the previous column were placed in an artificial climate incubator, and the incubator conditions were set to light conditions of 12h:12h, humidity of 75%, and temperature of 27±0.5℃. Similarly, the number of hatched nymphs was counted every 24 hours, and the experiment was carried out until the brown planthoppers were 15 days old, and the experiment was repeated 10 times. Data are as follows Figure 4 As shown in the right figure, due to the reduced expression of this gene, the egg-laying of brown planthoppers is affected, which in turn affects the hatching rate of brown planthopper nymphs.

[0106] Example 6 Effect of the NlMATH3 gene of brown planthopper on genes related to brown planthopper fertility

[0107] First, short-winged adults of brown planthoppers that had emerged one day after being subcultured on TN1 rice were selected and treated with the following two methods: ds NlMATH3: injection of NlMATH3 dsRNA; dsGFP: injection of GFP dsRNA, with 50 insects in each treatment. After treatment, they were placed on TN1 rice to recover for 3 days, and the surviving brown planthoppers were used for subsequent experiments.

[0108] The specific operation is as follows: After sampling, extract RNA (refer to 2.1.2), and use TAKARA's PrimeScript RT reagentKit with gDNA Eraser (Cat. No. RR047A) to reverse according to the instructions to obtain the reversed product. Take 5 uL of the cDNA obtained by the reverse, dilute it 10 times, and perform real-time quantitative PCR according to the following operation. The PCR reaction was carried out on the CFX96TouchTM Real-TimePCR Detection System (Bio-Rad) instrument, following the following reaction system: DNase / RNase-FreeddH2O 2.9uL, 2× Supermix 4uL, Primers (5mM) 0.6uL, cDNA template 0.5uL, reaction conditions: 95℃ pre-denaturation for 2min, 95℃ denaturation for 10s, 55-65℃ annealing and extension for 20s, repeat the latter two steps for 40 cycles, and finally 65℃-95℃, increase 0.5℃ each step, and make a melting curve for 5s to determine the specificity of the amplified product. Each sample was repeated three times, and the quantitative data were analyzed and exported by the software of the LightCycler480 instrument. The exported data were Ct values. The brown planthopper actin gene (GenBank: EU179848) was selected as the internal reference, and the melting curve (65 ℃ to 95 ℃) was finally generated. After the reaction was completed, the Ct value was imported into the Excel table and the 2 -△△Ct The relative expression of each gene was calculated by comparing it with the actin gene.

[0109] Primers for internal reference gene actin:

[0110] Actin-F:ATGAAACCGTCTACAACTCG;.

[0111] Actin-R: GCATCCTGTCGGCAATAC;.

[0112] The Vg quantitative primers are Vg-F, Vg-R:.

[0113] Vg-F: GCATCAATGAACCCAGCTAACTC;.

[0114] Vg-R:TGGACGGCTCTTTGCATACTCC.

[0115] The VgR quantitative primers are VgR-F and VgR-R:.

[0116] VgR-F: AGGCAGCCACACAGATAACCGC;.

[0117] VgR-R: AGCCGCTCGCTCCAGAACATT.

[0118] The results are as follows Figure 5 As shown: In the experimental group injected with dsNlMATH3, the relative expression levels of the reproductive capacity-related genes Vg and VgR in the brown planthopper on the third day after injection were significantly reduced to less than 10%, which was significantly different from the control group ( P < 0.01); The results showed that microinjection of ds NlMATH3 could significantly reduce the expression of reproductive capacity-related genes Vg and VgR in brown planthoppers, indicating that NlMATH3 of brown planthoppers is involved in the reproductive process of brown planthoppers.

[0119] SEQ ID NO.1 (nucleotide sequence of gene NlMATH3)

[0120]

[0121] SEQ ID NO.2 (one strand of dsRNA)

[0122] GGTGCTTACGTGTTAATCCAAAAGGCTTAGACGAAGAAAGCAAAGATTACCTTTCACTCTACCTACTCCTTGTATCTTGTAACAAATCTGAAGTCAGAGCAAAGTTTAAATTCTCCATTCTGAATGCAAAAAGAGAAGAAACCAAAGCTATGGAAAGCCAAAGAGCCTACAGGTTTGTTCA.

[0123] SEQ ID NO.3 (nucleotide sequence of the gene encoding dsRNA)

[0124] GGTGCTTACGTGTTAATCCAAAAGGCTTAGACGAAGAAAGCAAAGATTACCTCTCACTCTACCTACTTCTTGTATCTTGTAACAAATCTGAAGTCAGAGCAAAGTTTAAATTCTCCATTCTAAATGCAAAAAGAGAAGAAACCAAAGCAATGGAAAGCC

Claims

1. The brown planthopper N1MATH3 gene, characterized in that The nucleotide sequence of the NlMATH3 gene is shown in SEQ ID NO.

1.

2. A dsRNA for silencing the NlMATH3 gene according to claim 1, characterized in that: One chain thereof is shown as SEQ ID NO.

2.

3. The dsRNA encoding gene according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO.

3.

4. A recombinant expression vector, recombinant microorganism or transgenic cell line containing the gene encoding the dsRNA according to claim 3.

5. A drug for controlling brown planthopper, characterized in that: A recombinant expression vector, a recombinant microorganism or a transgenic cell line containing the dsRNA according to claim 2 or the coding gene of the dsRNA according to claim 3 or the coding gene of the dsRNA according to claim 4 as an active ingredient.

6. Use of the dsRNA according to claim 2 or the gene encoding the dsRNA according to claim 3 or a recombinant expression vector, a recombinant microorganism or a transgenic cell line containing the gene encoding the dsRNA according to claim 4 in controlling brown planthopper.

7. A method for controlling brown planthopper, characterized in that: The method comprises introducing the dsRNA according to claim 2 into brown planthopper.

8. The method according to claim 7, characterized in that The introduction method is injection and / or feeding.

Images