Akumen's muciniphila and its use in antitumor immunotherapy

By using Akkermansia ibiome016 and ibiome017 strains to inhibit tumor growth in mouse models, the problem of insufficient application of these tumor models in existing technologies has been solved, achieving significant inhibition and immune enhancement effects on a variety of tumors and expanding the scope of clinical application.

CN118440861BActive Publication Date: 2026-06-26IBIOME BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410599273.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-15
Publication Date
2026-06-26
Estimated Expiration
2044-05-15

AI Technical Summary

Technical Problem

There is limited research on the application of Akkermansia myxophilus in tumor models other than melanoma and breast cancer in existing technologies, and current tumor treatment modalities do not pay enough attention to the gut microbiome, which affects treatment efficacy.

Method used

Akkermansia muciniphila strains ibiome016 and ibiome017 were used to inhibit tumor growth in a mouse model via gavage. They were also used in combination with anticancer therapy to enhance the anticancer effect, promote the immune function of CD4 and CD8 T cells, and increase the number of effector memory T cells in the spleen and CD8 T cells in the intestinal lamina propria.

Benefits of technology

It significantly inhibits the growth of various tumors, including melanoma, colon cancer, and breast cancer, enhances the immune response, improves the efficacy of tumor treatment, expands the scope of clinical application, and enhances the efficacy of immune checkpoint blockade therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118440861B_ABST
    Figure CN118440861B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of immunotherapy of cancer. In particular, the present invention relates to the role of specific strains of gut bacteria, Akkermansia muciniphila Akkermansia muciniphila ) ibiome016 and ibiome017 in anti-tumor immunity, and provides methods for enhancing the response rate of patients to tumor immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a myxotrophic Akkermansia bacterium that can significantly inhibit tumor growth and its uses. Background Technology

[0002] With the rise of cancer immunotherapy, the paradigm for tumor treatment has changed significantly. Among the many factors influencing the efficacy of tumor treatment, the gut microbiome has received widespread attention. The gut microbiome is a supergenome, and its composition and diversity are determined by environment, genetics, and immunity, and are influenced by various factors such as age, geography, and survival characteristics. The abundance of specific bacteria is related to the clinical efficacy of tumor treatment, and can influence tumor development and progression by participating in innate and adaptive immunity, affecting the efficacy of chemotherapy, immunotherapy, and gene therapy.

[0003] Akkermansia myxophilus ( Akkermansia mucinphila Akk (Accutaneous mucin-degrading bacteria) is a common mucin-degrading bacterium in the gut. Studies have shown that Akk abundance is negatively correlated with obesity, type 2 diabetes, fatty liver, inflammatory bowel disease, and neuropsychiatric disorders. It is also closely related to the occurrence and treatment of various tumors, including colon cancer, lung cancer, and prostate cancer. In particular, it is positively correlated with the efficacy of PD-1 / PD-L1 checkpoint inhibitors, suggesting it may be a potential biomarker and therapeutic adjuvant.

[0004] CN110638838A discloses the application of Akk in the preparation of drugs for enhancing the anti-tumor immune function of CD4+ T cells and / or CD8+ T cells and / or enhancing the anti-tumor immune function of CD8+ T cells in the tumor microenvironment. The applicant used only a lung cancer LLC cell mouse model. After gavage administration of Akk bacteria purchased from the ATCC website, the lung tumor volume decreased significantly by approximately 2-3 times. Akk enhanced the immune function of systemic CD4+ T cells and / or CD8+ T cells, and Akk inhibited tumor growth at least partially by inhibiting PD-1 expression in T cells, thereby enhancing the body's anti-tumor immune function.

[0005] CN111450124A discloses the application of Akk in the preparation of anti-tumor drugs and drugs that increase the infiltration of γδT cells in the tumor microenvironment. The applicant used only a mouse model of hepatocellular carcinoma HEPA1-6 cells. After gavage administration of Akk bacteria purchased from the ATCC website, the liver tumor volume decreased significantly by approximately 2-4 times. Akk administration increased the relative number of γδT cells in the liver tumor microenvironment by 5-8 times, significantly increasing the number of γδT cells in the tumor microenvironment.

[0006] It is evident that the available strains of Akk bacteria are limited in the current technology, and there is relatively little research on other tumor models, such as melanoma and breast cancer. Summary of the Invention

[0007] To address the aforementioned problems in the existing technology, this application provides a strain of Akkermansia myxophilus and its use in anti-tumor immunotherapy. This strain, even as a single bacterium, exhibits a strong inhibitory effect on tumor growth and also possesses multiple functions and uses, including regulating the gastrointestinal tract and enhancing immunity.

[0008] This invention is achieved through the following technical solution:

[0009] Protected strain of this invention: Akkermansia myxophilus ( Akkermansia mucinphila ibiome016 or Akkermansia myxophilus ( Akkermansia mucinphila Both ibiome017 and ibiome017 are deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, on December 13, 2023. The accession numbers are CCTCC NO: M 20232553 and CCTCC NO: M 20232554, respectively.

[0010] This invention also protects the above-mentioned Akkermansia muciniphila ( Akkermansia mucinphila The use of the strain in the preparation of a drug for preventing or treating tumors; preferably, when the drug is used to treat tumors, it can be used alone or in combination with other anticancer therapies to enhance the anticancer effect.

[0011] Preferably, the prevention of tumor development or treatment of tumor includes, but is not limited to, at least one of the following phenotypes:

[0012] (a) Promotes the secretion of effector factors TNF-α and / or IFN-γ by CD4 and / or CD8 T cells in draining lymph nodes in vivo;

[0013] (b) Increase the proportion of effector memory T cells and / or PD-1+CD8 T cells in the spleen in vivo;

[0014] (c) Promotes the secretion of IFN-γ, an effector cytokine, from CD4 and / or CD8 T cells in the spleen in vivo;

[0015] (d) Increase the number of CD8 T cells in the intestinal lamina propria in vivo;

[0016] (d) Slowing down the tumor growth curve;

[0017] (e) Reduce tumor volume;

[0018] (f) Reduce tumor weight.

[0019] Preferably, the other anticancer treatments include antiPD-1 therapeutic agents (preferably antiPD-1 antibodies, CTLA-4 antibodies, PD-L1 antibodies and / or PD-L1 inhibitors), or other antibody drugs besides antiPD-1 antibodies (preferably at least one of chemotherapy drugs, photosensitizers, photothermal agents, and immunotherapy drugs).

[0020] Furthermore, the tumor is a solid tumor (preferably selected from one or more of the group consisting of gastric cancer, esophageal cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, breast cancer, kidney cancer, fibrosarcoma, lung cancer, bile duct cancer, and melanoma, more preferably melanoma, colon cancer, or breast cancer).

[0021] This invention also protects the above-mentioned Akkermansia muciniphila ( Akkermansia mucinphila The use of the strain in the preparation of a medicament that enhances the immune response of an organism (preferably a mammal, more preferably a human) (preferably by promoting the secretion of effector factors TNF-α and / or IFN-γ of CD4 and / or CD8 T cells in draining lymph nodes or spleen, and / or by increasing the proportion of effector memory T cells and / or PD-1+CD8 T cells in spleen, and / or by increasing the number of CD8 T cells in the lamina propria of the intestine).

[0022] This invention also protects pharmaceutical compositions comprising the aforementioned Akkermansia myxophilus (… Akkermansia mucinphila ) strain, or the aforementioned Akkermansia myxophilus ( Akkermansia mucinphila ( ) Cultures or processed products of strains, and pharmaceutically acceptable carriers.

[0023] Preferably, the pharmaceutical composition further includes an anti-PD-1 therapeutic agent (preferably an anti-PD-1 antibody, CTLA-4 antibody, PD-L1 antibody and / or PD-L1 inhibitor), or other antibody drugs besides anti-PD-1 antibodies (preferably at least one of chemotherapy drugs, photosensitizers, photothermal agents, and immunotherapy drugs).

[0024] Preferably, the dosage form of the pharmaceutical composition is selected from the group consisting of tablets, granules, capsules, suspensions, and lyophilized preparations.

[0025] The present invention also protects methods for enhancing the immune response of an organism, including administering the above-mentioned Akkermansia mycotoxin to the organism. Akkermansia mucinphila ) strain, or the aforementioned Akkermansia myxophilus ( Akkermansia mucinphila ( ) A culture or processed product of the strain, or the above-mentioned pharmaceutical composition.

[0026] The anti-PD-1 therapeutic agent described in this invention refers to a substance that works by blocking or inhibiting the function of PD-1, thereby blocking or inhibiting downstream signals of PD-1. It can be an anti-PD-1 antibody or a PD-L1 inhibitor, etc.

[0027] The pharmaceutical compositions of the present invention may contain pharmaceutically acceptable solvents, emulsifiers, suspending agents, preservatives, lubricants, etc., commonly used in the art, but are not limited thereto.

[0028] The pharmaceutical compositions of the present invention can be prepared into commonly used dosage forms, such as tablets, granules, capsules, suspensions, lyophilized preparations, etc.

[0029] "Including the aforementioned Akkermansia muciniphila ( Akkermansia mucinphila "Strain" refers not only to strains containing the aforementioned Akkermansia (a myxotrophic strain) Akkermansia mucinphila The live bacterial form of the strain also includes bacterial decomposition products, culture supernatant, and isolated metabolic products of the strain.

[0030] The subjects are mammals, which can be rodents such as rats and mice, or primates, preferably primates such as humans.

[0031] The amount of the strain of the present invention or the pharmaceutical composition containing it is not particularly limited, as long as it is *Ackermania pseudomallei* (…). Akkermansia mucinphila The strain only needs to be able to colonize the subject's intestine. When the subject is human, the dose is 0.2 mL per administration, for example, 5 × 10⁻⁶. 5 ~5×10 12 CFU / mL, preferably 5×10⁻⁶ 6 ~5×10 8 The strain is administered at a concentration of CFU / mL. The inoculation or administration frequency can be once every 1 to 3 days, preferably once every 2 to 3 days. For successful colonization of the subject's intestine, continuous administration may be for example, two weeks, one month, or extended if necessary. Administration can be via the gastrointestinal tract, such as orally. Colonization can be confirmed by examining the subject's stool after administration.

[0032] The beneficial effects of this invention are as follows:

[0033] 1. The present invention relates to Akkermansia myxophilus (… Akkermansia mucinphila ibiome016 and Akkermansia myxophilus ( Akkermansia mucinphila ibiome017 was isolated from healthy volunteers, is easy to culture in vitro, and can colonize in the mouse intestine.

[0034] 2. For SPF mice carrying subcutaneous B16F10 melanoma, and administered Akkermansia myxophilus via gavage (… Akkermansia mucinphilaibiome016 and Akkermansia myxophilus ( Akkermansia mucinphila ibiome017 can both exert tumor-suppressing functions, expanding the scope of clinical drug use.

[0035] 3. In in vivo experiments on mice, Akkermansia myxophilus was found to be present. Akkermansia mucinphila ibiome016 can promote the secretion of IFN-γ and TNF-α by CD4 and CD8 T cells in the draining lymph nodes of mice, increase the proportion of effector memory T cells and PD-1+CD8 T cells in the spleen, increase the IFN-γ secretion capacity of CD4 and CD8 T cells in the spleen, and increase the number of CD8 T cells in the lamina propria of the intestine.

[0036] 4. For SPF mice carrying subcutaneous E0771 breast cancer tumors, and administered via gavage with Akkermansia myxophilus (… Akkermansia mucinphila ibiome016, this strain can exert tumor-suppressive function, expanding the scope of clinical drug use.

[0037] 5. Subcutaneous MC38 colon cancer tumors in SPF mice were treated with oral administration of Akkermansia myxophilus (…). Akkermansia mucinphila ibiome017, this strain can exert tumor-suppressive function, expanding the scope of clinical drug use.

[0038] 6. Akkermansia myxophilus ( Akkermansia mucinphila ibiome016 and Akkermansia myxophilus ( Akkermansia mucinphila ibiome017 has the potential to synergize with tumor immunotherapy, improve the efficacy of immune checkpoint blockade therapy, increase the response rate of anti-PD-1 therapy in cancer patients, and improve patient survival.

[0039] Biological Preservation

[0040] Akkermansia myxophilus ( Akkermansia mucinphila ibiome016, deposited on December 13, 2023, deposited at the China Center for Type Culture Collection, located at Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, accession number CCTCC NO: M 20232553.

[0041] Akkermansia myxophilus ( Akkermansia mucinphila ibiome017, deposited on December 13, 2023, deposited at the China Center for Type Culture Collection, located at Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, accession number CCTCC NO: M 20232554. Attached Figure Description

[0042] Figure 1 This is the effect of Akk1 on the growth of B16F10 tumors in SPF mice in Example 2; where 1A is the tumor growth curve of each group after tumor injection, 1B is the tumor weighing result on day 17 after tumor injection, and 1C is the tumor dissection photograph of each group on day 17 after tumor injection.

[0043] Figure 2 The effects of Akk2 and Akk3 on the growth of B16F10 tumors in SPF mice in Example 3 are shown in Figure 2A. 2A shows the tumor growth curves of each group after tumor injection, 2B shows the tumor weighing results on day 25 after tumor injection, and 2C shows the tumor dissection photographs of each group on day 25 after tumor injection.

[0044] Figure 3 The image shows the gating results of flow cytometry of CD4 and CD8 T cells in the drained lymph nodes in Example 4; where 3A represents the percentage of CD4 T cells secreting IFN-γ, 3B represents the percentage of CD8 T cells secreting IFN-γ, 3C represents the percentage of CD4 T cells secreting TNF-α, and 3D represents the percentage of CD8 T cells secreting TNF-α.

[0045] Figure 4 for Figure 3 Statistical results of flow cytometry; where 4A represents the percentage of CD4 T cells secreting IFN-γ, 4B represents the percentage of CD8 T cells secreting IFN-γ, 4C represents the percentage of CD4 T cells secreting TNF-α, and 4D represents the percentage of CD8 T cells secreting TNF-α.

[0046] Figure 5 The image shows the gating results of flow cytometry of effector memory (CD44+CD62L-) T cells and PD-1+ cells in spleen CD8 T cells in Example 5; where 5A shows the percentage of CD44+CD62L- T cells in CD8 T cells and 5B shows the percentage of PD-1+ cells in CD8 T cells.

[0047] Figure 6 for Figure 5 Statistical results of flow cytometry; where 6A shows the percentage of CD44+CD62L-T cells in CD8 T cells, and 6B shows the percentage of PD-1+ cells in CD8 T cells.

[0048] Figure 7 The image shows the gating results of flow cytometry analysis of IFN-γ secreted by CD4 and CD8 T cells in the spleen in Example 6; where 7A shows the percentage of CD4 T cells secreting IFN-γ, and 7B shows the percentage of CD8 T cells secreting IFN-γ.

[0049] Figure 8 for Figure 7 Statistical results of flow cytometry; where 8A represents the percentage of CD4 T cells secreting IFN-γ, and 8B represents the percentage of CD8 T cells secreting IFN-γ.

[0050] Figure 9 This is a gating result of flow cytometry on CD8 T cells in the intestinal lamina propria in Example 7.

[0051] Figure 10 for Figure 9 Statistical results of flow cytometry.

[0052] Figure 11 This is the effect of Akk1 on the growth of E0771 breast cancer tumors in SPF mice in Example 8; where 11A is the tumor growth curve of each group after tumor injection, 11B is the tumor weighing result on day 35 after tumor injection, and 11C is the tumor dissection photograph of each group on day 35 after tumor injection.

[0053] Figure 12 This is the effect of Akk3 on the growth of MC38 colon cancer tumors in SPF mice in Example 9; where 12A is the tumor growth curve of each group after tumor injection, 12B is the tumor weighing result on day 28 after tumor injection, and 12C is the tumor dissection photograph of each group on day 28 after tumor injection. Detailed Implementation

[0054] To better understand the present invention, the present invention will be further described below with reference to the embodiments and accompanying drawings. The following embodiments are only illustrative of the present invention and are not intended to limit it.

[0055] Example 1: Isolation and Preliminary Identification of the Strain

[0056] Recruit healthy volunteers who have not used antibiotics within the past year. After signing an informed consent form, volunteers will collect 2-5 g of fresh feces, place it in a sample collection tube containing glycerol, shake to homogenize, and then place the processed fecal sample in an ice box. The sample will be delivered to the applicant's laboratory within 24 hours for bacterial isolation.

[0057] ① Fecal sample pretreatment: Take 1 mL of the mixture from the sample collection tube containing glycerol and feces, add it to 9 mL of 1× sterile PBS solution, vortex to mix, and then take 100 µL of the mixture and serially dilute it to 10. -9For plate coating. Simultaneously, take 2 mL of a sample containing a thorough mixture of glycerol and feces, and heat the fecal sample at 68°C for 10 min. During the heat treatment, mix the sample at regular intervals to ensure uniform heating. After the heat treatment, take 1 mL of the mixture and serially dilute it to 10⁻⁶. -4 Used for flatbed coating.

[0058] ② Take 100 μL of the diluted sample and spread it on BHI medium (Qingdao Haibo Biotechnology, HB8297-1). After the dilution solution on the plate surface is free of obvious water marks, invert the plate and place it in an anaerobic workbench for incubation (temperature: 37℃, humidity: 65%, O2: 0%). Incubate statically for 24~36 h. After single colonies grow, perform multiple streak purifications on the single colonies. Perform 16S rRNA sequencing on the purified strains to determine the taxonomic position of the strains.

[0059] ③ 16S rRNA sequencing: 16S rRNA PCR amplification was performed on the strain to be identified. The amplification system consisted of: 12.5 μL of 2 Taq MasterMix (Novizan; P112-01), 1 μL of primer 1 (27F: AGAGTTTGATCCTGGCTCAG), 1 μL of primer 2 (1492R: TACGGCTACCTTGTTACGACTT), 1 μL of liquid bacterial culture, and 9.5 μL of ddH2O. Amplification conditions were: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 30 s, for 30 cycles; 72℃ for 5 min. The amplified products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The 16S rRNA gene sequence of the strain was submitted to the NCBI Basic Local Alignment Search Tool for 16S rRNA gene analysis. The species corresponding to the strain with the highest similarity in the alignment results was taken as the species of the corresponding strain.

[0060] Among the isolated strains, the gene sequences of three strains showed that the strain with the highest similarity was... Akkermansia mucinphila strain ATCC BAA-835 (similarities of 99.06%, 98.92%, and 100%, respectively), therefore this strain belongs to Akkermansia myxophila. Akkermansia mucinphila These types are temporarily numbered Akk1, Akk2, and Akk3 for further functional filtering.

[0061] Example 2: Akkermansia myxophilus ( Akkermansia mucinphila Akk1's anti-B16F10 tumor effect in SPF mice

[0062] Male C57 / B6J mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were randomly divided into two groups after one week of acclimatization: a control group administered PBS by gavage and an experimental group administered Akkermansia myxophilus Akk1 by gavage, with 8 mice in each group. After culturing Akkermansia myxophilus Akk1 for 24 hours, the centrifuged bacterial cells were resuspended in PBS. Mice in the experimental group were then administered 200 μL of the bacterial cells (5 × 10⁻⁶ ml) by gavage. 6 CFU was administered via gavage six times a week; control mice were simultaneously administered 200 μL of PBS via gavage. After 10 gavage administrations, all mice were shaved, and subcutaneous B16F10 tumors (2.5 × 10⁻⁶) were detected. 5 / mouse. Tumor volume was measured starting on day 9 after tumor implantation, and then every 1-2 days thereafter. The tumor volume was approximated using 0.5 × length × width × width. Mice were sacrificed on day 17 after tumor implantation, and the tumors were photographed and weighed. Results are as follows: Figure 1 As shown, Akk1, a myxotrophic axolotl, significantly inhibits the growth of melanoma B16F10 tumors. Specifically, oral administration of Akk1 alone significantly slows the tumor growth curve. Figure 1 A) The tumor weight has significantly decreased ( Figure 1 B) The tumor volume has significantly decreased ( Figure 1 C).

[0063] Example 3: Akkermansia myxophila ( Akkermansia mucinphila Anti-B16F10 tumor effects of Akk2 and Akk3 in SPF mice

[0064] Male C57 / B6J mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were randomly divided into three groups after one week of acclimatization: a control group administered PBS by gavage, and experimental groups administered Akk2 or Akk3 bacteria by gavage, respectively, with 8 mice in each group. The experimental groups administered Akk2 or Akk3 bacteria by gavage six times a week. After 24 hours of culture, the Akk2 or Akk3 bacteria were centrifuged and resuspended in PBS. Each mouse was gavaged with 200 μL of PBS (5 × 10⁻⁶ ml) each time. 5 CFU. In the control group, each mouse was simultaneously administered 200 μL of PBS via gavage. After 7 gavages, all mice were shaved, and subcutaneous tumors of B16F10 (3 × 10⁻⁶) were detected. 5 / mouse. Tumor volume was measured starting on day 10 after tumor implantation, and then every 1-2 days thereafter. The tumor volume was approximated using 0.5 × length × width × width. Mice were sacrificed on day 25 after tumor implantation, and the tumors were photographed and weighed. Results are as follows: Figure 2As shown, Akk3 of Akimiglinophilus significantly inhibited the growth of B16F10 melanoma (growth curve, weight, volume), while Akk2 of Akimiglinophilus did not have this inhibitory effect, indicating that not all Akimiglinophilus strains have an inhibitory effect on melanoma.

[0065] Therefore, the two Akkmanella strains, Akk1 and Akk3, which showed inhibitory effects on melanoma, were named Akkmanella myxophila. Akkermansia mucinphila ibiome016 and Akkermansia myxophilus ( Akkermansia mucinphila ibiome017, deposited at the China Center for Type Culture Collection (CCTCC), located at: China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, China; deposit date: December 13, 2023; accession numbers: CCTCC NO: M 20232553 and CCTCC NO: M 20232554.

[0066] Example 4: Akkermansia myxophilus ( Akkermansia mucinphila Akk1 increases the secretion of IFN-γ and TNF-α by CD4 and CD8 T cells in draining lymph nodes.

[0067] After a week of acclimatization feeding with the Jicui Yaokang C57BL / 6J mice for 5 weeks, the mice were randomly divided into two groups of 6 mice each: the experimental group was administered Akk1 bacterial solution (5×10⁻⁶) by gavage daily. 6 (CFU / mL), the control group received 200 μL of PBS via gavage daily, 6 times a week. After one week of gavage, subcutaneous tumor-bearing B16F10, 3×10 5 / mouse. Mice were sacrificed on day 20 of tumor bearing. Drainage lymph nodes from the right hamstring of the mice were harvested, ground, and used to obtain a single-cell suspension. The suspension was labeled with a specific fluorescent antibody, and flow cytometry was used to detect the secretion of IFN-γ and TNF-α by CD4 and CD8 T cells in the drainage lymph nodes. Figure 3 The diagram shown illustrates the gating process for flow cytometry results: Based on cell size and the complexity of their contents, the total number of cells is first enclosed, followed by single cells, then viable cells, then TCRβ+ T cells, further distinguishing between CD4 and CD8, and finally detecting the secretion of IFN-γ and TNF-α by CD4 and CD8 cells. The flow cytometry results are then statistically analyzed. Figure 4 The figure shows that, compared with the control group, mice in the Akk1 gavage group had increased secretion of IFN-γ and TNF-α from CD4 and CD8 T cells in the draining lymph nodes.

[0068] Example 5: Akkermansia myxophilus ( Akkermansia mucinphilaAkk1 increases the proportion of effector memory T cells and PD-1+CD8 T cells in the spleen.

[0069] After a week of acclimatization feeding with the Jicui Yaokang C57BL / 6J mice for 5 weeks, the mice were randomly divided into two groups of 6 mice each: the experimental group was administered Akk1 bacterial solution (5×10⁻⁶) by gavage daily. 6 (CFU / mL), the control group received 200 μL of PBS via gavage daily, 6 times a week. After one week of gavage, subcutaneous tumor-bearing B16F10, 3×10 5 / mouse. Mice were sacrificed on day 20 of tumor infection. Spleens were harvested, ground to obtain a single-cell suspension, and then treated with erythrocyte lysis buffer. The spleen cells were labeled with specific fluorescent antibodies, and flow cytometry was used to detect the proportions of CD44+CD62L-T cells and PD-1+ cells within the spleen's CD8 T cells. Figure The diagram shows the gating process for flow cytometry results: based on cell size and the complexity of their contents, the total number of cells is first enclosed, then single cells, then viable cells, and finally CD3+CD8+ T cells (CD8T). The proportions of CD44+CD62L-T cells and PD-1+ cells within the CD8T cells are then determined. The flow cytometry results are then presented in statistical format. ​ The figure shows that, compared with the control group, the proportion of CD44+CD62L-T cells (effect memory T cells) and PD-1+CD8 T cells in the spleen of mice in the Akk1 gavage experimental group was significantly increased.

[0070] Example 6: Akkermansia myxophilus ( ​ Akk1 increases the IFN-γ secretion capacity of CD4 and CD8 T cells in the spleen.

[0071] After a week of acclimatization feeding with Jicui Yaokang C57BL / 6J mice for 5 weeks, the mice were randomly divided into two groups of 10 mice each: the experimental group was administered Akk1 bacterial solution (5×10⁻⁶) by gavage daily. 6 (CFU / mL), control group administered PBS by gavage, 200 μL each, gavage frequency 6 times per week. After one week of gavage, subcutaneous tumor-bearing B16F10, 2×10 5 / mouse. On day 25 of tumor bearing, mice were sacrificed, and their spleens were harvested. Single-cell suspensions were obtained by grinding the spleen cells using a steel mesh, followed by treatment with erythrocyte lysis buffer. The spleen cells were then labeled with specific fluorescent antibodies, and flow cytometry was used to detect IFN-γ secretion by CD4 T cells and CD8 T cells within the spleen. ​The diagram shown illustrates the gating process for flow cytometry results: Based on cell size and the complexity of their contents, the total number of cells is first enclosed, followed by single cells, then viable cells, then TCRβ+ T cells, further distinguishing between CD4 and CD8, and finally detecting the secretion of IFN-γ by CD4 and CD8. The flow cytometry results are then statistically analyzed. ​ The figure shows that, compared with the control group, the experimental group of mice that were administered Akk1 by gavage had significantly increased IFN-γ secretion from CD4 and CD8 T cells in the spleen.

[0072] Example 7: Akkermansia myxophilus ( ​ Akk1 increases the number of CD8+ T cells in the intestinal lamina propria.

[0073] After a week of acclimatization feeding with Jicui Yaokang C57BL / 6J mice for 5 weeks, the mice were randomly divided into two groups of 3 mice each: the experimental group was administered Akk1 bacterial solution (5×10⁻⁶) by gavage daily. 6 The control group was administered PBS by gavage, 200 μL each, 6 times a week. One month after gavage, the mice were sacrificed, and a 4 cm segment of the ileum near the cecum and a 5 cm segment of the colon near the cecum were taken from each mouse. The intestinal contents were rinsed with PBS, and the intestinal tract was dissected. The intestines were cut into 1-2 cm segments and placed in 25 mL of pre-digestion solution (RPMI 65 mL, FBS 1.2 mL, EDTA 120 μL). The mixture was shaken at 37°C and 220 rpm for 20 min. The resulting culture medium was filtered through a 200-mesh steel mesh. The intestinal segments were added to the pre-digestion solution for subsequent processing. The filtered culture medium was centrifuged to obtain intestinal epithelial cells and intraepithelial lymphocytes. The above steps were repeated twice. The remaining tissue was added to a digestion solution containing collagenase and DNase (RPMI 10 mL, DNASE I STOCK 20 μL, Type II Collagenase 5 mg (Sigma), FBS 0.2 mL). The filtered result was intestinal lamina propria lymphocytes. Specific fluorescent antibodies were used to label lamina propria lymphocytes, and the number of CD8+ T cells was detected by flow cytometry. ​ The diagram shown illustrates the gating of flow cytometry results: based on cell size and the complexity of their contents, the total number of cells is first circled, then single cells, then viable cells, followed by CD45.2+CD3+ T cells, and finally CD8+ cells. The flow cytometry results are then statistically analyzed. ​ The figure shows that, compared with the control group, the experimental group of mice that were given Akk1 by gavage had an increased number of CD8+ T cells in the lamina propria of the intestine.

[0074] Example 8: Akkermansia myxophilus ( ​ Antitumor effect of Akk1 on subcutaneous E0771 breast cancer tumors in SPF mice

[0075] Male C57 / B6J mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were acclimatized for one week, then their intestinal flora was cleared with a quadruple antibiotic regimen (ABX). 0.15g ampicillin, neomycin, metronidazole, and 0.075g vancomycin hydrochloride were added to every 50mL of sterile water, administered by gavage at a dose of 500μL per mouse daily for one week. Ten days after discontinuation of the quadruple antibiotic regimen (ABX), the mice were randomly divided into two groups: a control group administered PBS by gavage and an experimental group administered Akkmanophilus by gavage, with 10 mice in each group. The Akkmanophilus group was administered Akkmanophilus Akk1 cells by gavage six times a week. After 24 hours of culture, the Akkmanophilus cells were centrifuged and resuspended in PBS, with each mouse receiving 200μL of PBS (5×10⁻⁶ cells per gavage). 5 CFU. In the PBS control group, each mouse was simultaneously administered 200 μL of PBS by gavage. After 7 gavage cycles, all mice were shaved, and subcutaneous E0771 breast cancer cells (5 × 10⁻⁶) were collected. 5 / mouse. Tumor volume was measured and recorded starting on day 11 after tumor implantation, and thereafter every 2-3 days. The tumor volume was approximated using 0.5 × length × width × width. Mice were sacrificed on day 35 after tumor implantation, and the tumors were photographed and weighed. Results are as follows: ​ As shown, Akk1 from Akkermansia myxophilus has an inhibitory effect on the growth of E0771 breast cancer in mice. Specifically, oral administration of Akk1 alone significantly slowed the growth curve of E0771 breast cancer tumors. ​ A) The tumor weight has significantly decreased ( ​ B) The tumor volume has significantly decreased ( ​ C).

[0076] Example 9: Akkermansia myxophilus ( ​ Antitumor effect of Akk3 on subcutaneous MC 38 colon cancer tumors in SPF mice

[0077] Male C57 / B6J mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were acclimatized for one week and then randomly divided into two groups: a control group receiving PBS by gavage and an experimental group receiving Akkermansia myxophilia by gavage, with 9 mice in each group. The Akkermansia myxophilia experimental group received 200 μL (5 × 10⁻⁶) Akkermansia myxophilia Akk3 bacterial suspension six times a week. 6 CFU / mL). In the PBS control group, each mouse was simultaneously administered 200 μL of PBS by gavage. After 6 gavages, all mice were shaved, and subcutaneous MC38 colon cancer cells (5 × 10⁻⁶) were collected. 5 / mouse. Tumor volume was measured and recorded starting on day 9 after tumor implantation, and thereafter every 2-3 days. The tumor volume was approximated using 0.5 × length × width × width. Mice were sacrificed on day 28 after tumor implantation, and the tumors were photographed and weighed. Results are as follows: ​ As shown, Akk3, an Acetobacter myxophilus strain, has an inhibitory effect on the growth of MC38 colon cancer in mice. Specifically, oral administration of Akk3 alone can slow down the growth curve of MC38 colon cancer tumors. ​ A) Tumor weight reduction ( ​ B) Tumor volume decreases ( ​ C).

[0078] The above-described embodiments are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Akkermansia myxophilus ( Akkermansia muciniphila The strain is characterized by: The aforementioned Akkermansia myxophilus ( Akkermansia muciniphila The strain is *Ackermania pseudomallei* (…). Akkermansia muciniphila ibiome016 or Akkermansia myxophilus ( Akkermansia muciniphila ibiome017, both are deposited at the China Center for Type Culture Collection, dated December 13, 2023, with accession numbers CCTCC NO: M20232553 and CCTCC NO: M 20232554, respectively.

2. The Akkermansia myxophilus strain as described in claim 1 ( Akkermansia muciniphila The use of the strain in the preparation of a drug for treating tumors, characterized in that: When the aforementioned Akkermansia mycotoxin ( Akkermansia muciniphila The strain is *Ackermania pseudomallei* (…). Akkermansia muciniphila When ibiome016 is present, the tumor is melanoma or breast cancer; when the Akkermansia myxophilus ( Akkermansia muciniphila The strain is *Ackermania pseudomallei* (…). Akkermansia muciniphila When ibiome017 is used, the tumor is melanoma or colon cancer.

3. The use according to claim 2, characterized in that: The drug is used alone to treat tumors or in combination with other anticancer drugs.

4. The use according to claim 2 or 3, characterized in that, The tumor treatment includes at least one of the following phenotypes: (a) Reduce tumor volume; (b) Reduce tumor weight.

5. The use according to claim 3, characterized in that: The other anticancer treatment drugs include at least one of the following: anti-PD-1 therapeutic agents, PD-L1 inhibitors, CTLA-4 antibodies, chemotherapy drugs, photosensitizers, and photothermal agents.

6. A pharmaceutical composition, characterized in that: Includes the Akkermansia myxophilus strain as described in claim 1 ( Akkermansia muciniphila ) strain, or the aforementioned Akkermansia myxophilus ( Akkermansia muciniphila ( ) Cultures of strains and pharmaceutically acceptable vectors.

7. The pharmaceutical composition according to claim 6, characterized in that: It also includes at least one of the following: anti-PD-1 therapeutic agents, PD-L1 inhibitors, CTLA-4 antibodies, chemotherapy drugs, photosensitizers, and photothermal agents.

Citation Information

Patent Citations

  • Application of akkermansia muciniphila or prevotella copri to preparation of drugs for enhancing anti-tumor immune function

    CN110638838A

  • Pharmaceutical composition for preventing or treating cancer or inflammatory disease

    US20250057893A1