Oncolytic viral vectors inducing immunogenic cell death for antitumor immunotherapy

Abstract

Provided herein are nucleic acids, vectors, viral particles, and nanoparticles for delivering immunogenic cell death executioners, e.g., a N-terminal domain of gasdermin D (GSDMD) and / or a N-terminal domain of Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) to cancer cells. The immunogenic cell death executioners induce necroptosis and pyroptosis, respectively, and are under the control of cancer- (e.g., epithelial cell and / or mesenchymal cell) specific promoters for treating carcinomas (e.g., breast carcinomas).

Description

Attorney Docket No. U1197.70256US00 ONCOLYTIC VIRAL VECTORS INDUCING IMMUNOGENIC CELL DEATH FOR ANTITUMOR IMMUNOTHERAPYRELATED APPLCATION

[0001] This application claims the benefit under 35 U. S. C. § 119(e) of the filing date of U. S. Provisional Application Serial No. 63 / 720,700, filed November 142024, entitled “ONCOLYTIC VIRAL VECTORS INDUCING IMMUNOGENIC CELL DEATH FOR ANTITUMOR IMMUNOTHERAPY” the entire contents of which are incorporated herein by reference in their entirety.STATEMENT OF SUPPORT

[0002] This invention was created in whole or in part with funding received from the Florida Breast Cancer Foundation under Award No. 1454667.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] The contents of the electronic sequence listing (U119770256WO00-SEQ-JXV.xml; Size: 31,528 bytes; and Date of Creation: November 14, 2025) are herein incorporated by reference in their entirety.FIELD OF THE INVENTION

[0004] The application relates to AAV based gene therapy for oncolytic tumor therapy.BACKGROUND

[0005] Cancer cells can undergo immunogenic cell death (ICD), thereby releasing tumor antigens and immuno stimulatory damage-associated molecular patterns (DAMPs, which function as adjuvants), and robustly inducing innate and adaptive immune responses. The resulting activated tumor- antigen- specific effector T cells recognize and attack the remaining cancer cells. Therefore, even when only a small subset of cancer cells are induced to undergo ICD, consequent activation of antitumor immunity is often sufficient to eliminate the entire tumor. For example, in a recent study in mouse tumor models, ICD of less than 15% of tumor cells was sufficient to clear the entire tumor graft (Nature 579: 421, 2020), providing a proof of principle for the success of ICD-based immunotherapy.1#14580236vlAttorney Docket No. U1197.70256US00

[0006] Gene therapy has the potential to treat subjects suffering from or at risk of suffering from various diseases and adeno-associated virus (AAV) vectors carrying genetic payloads have been used in different gene therapies.SUMMARY

[0007] Provided are nucleic acids, vectors, viral particles, and nanoparticles for induction of immunogenic cell death in a cancer cell (e.g., breast cancer cell). The nucleic acids, vectors, viral particles, and nanoparticles comprise immunogenic cell death executioner polypeptide sequences that, when present in a cancer cell, induce cell death in the cancer cell. For example, an N-terminal domain of a Mixed Lineage Kinase domain Like pseudokinase (MLKL) polypeptide, when present in a cancer cell induces immunogenic cell death by necroptosis of the cancer cell. Similarly, an N-terminal domain of a gasdermin D (GSDMD) polypeptide when present in a cancer cell induces immunogenic cell death by pyroptosis of the cancer cell. In the nucleic acids, vectors, viral particles, and nanoparticles provided herein, an MLKL polypeptide or a GSDMD polypeptide are expressed from a cancer- specific promoter (e.g., an epithelial cell- specific promoter and / or a mesenchymal cell- specific promoter that is inactive in virus-packaging cells, e.g., HEK293 cells), e.g., a keratin 80 promoter or a stratifin promoter. Other promoters specifically active in cancer cells, e.g., breast cancer cells melanoma cells, glioblastoma cells, or prostate cancer cells can also be used to drive expression of an immunogenic cell death executioner polypeptide in the cancer cell. Advantageously, the nucleic acids, vectors, viral particles, and nanoparticles carrying a MLKL or GSDMD polypeptide under the control of a keratin 80 or stratifin promoter induce cell death in carcinoma cells (e.g., breast cancer cells). Furthermore, the nucleic acids, vectors, viral particles, and nanoparticles described herein trigger a robust anti-tumor, e.g., anti-carcinoma cell immune response by inducing necroptosis and / or pyroptosis in the tumor, e.g., carcinoma cell.

[0008] Provided herein is a nucleic acid comprising a nucleotide sequence encoding a N-terminal domain of a gasdermin D (GSDMD) protein operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells).

[0009] Further provided is a nucleic acid comprising a nucleotide sequence encoding a N-terminal domain of a Mixed lineage kinase domain like pseudokinase (MLKL) protein operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells).2#14580236vlAttorney Docket No. U1197.70256US00

[0010] In some aspects, the cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in viruspackaging cells) is a Keratin 80 (Krt80) promoter or a Stratifin (SFN) promoter.

[0011] In some aspects, the N-terminal domain of GSDMD comprises about 100 amino acids to about 250 amino acids, e.g., about 241 amino acids.

[0012] In some aspects, the N-terminal domain of MLKL comprises between about 100 amino acids and about 250 amino acids, e.g., about 125 amino acids.

[0013] In some aspects, the Krt80 promoter comprises about 300 to about 920 nucleotides, e.g., 902 nucleotides.

[0014] In some aspects, the SFN promoter comprises about 300 about 1300 nucleotides.

[0015] In some aspects, a nucleic acid further comprises an inverted terminal repeat (ITR).

[0016] In some aspects, the inverted terminal repeat is an adeno-associated virus (AAV) inverted terminal repeat.

[0017] In some aspects, the inverted terminal repeat is an adenovirus (Ad) inverted terminal repeat.

[0018] In some aspects, the nucleotide sequence encoding a N-terminal domain of GSDMD operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells)and / or the nucleotide sequence encoding a N-terminal domain of MLKL operably linked to a cancer-specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells) are flanked by two ITRs.

[0019] In some aspects, the two ITRs are AAV ITRs.

[0020] In some aspects, the two ITRs are Ad ITRs.

[0021] In some aspects, a nucleic acid further comprises a long terminal repeat (LTR).

[0022] In some aspects, the LTR is a lentivirus LTR. In some aspects, the LTR is a retrovirus LTR.

[0023] In some aspects, the nucleotide sequence encoding a N-terminal domain of GSDMD operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells)and / or the nucleotide sequence encoding a N-terminal domain of MLKL operably linked to a cancer-specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells) are flanked by two LTRs.3#14580236vlAttorney Docket No. U1197.70256US00

[0024] In some aspects, the two LTRs are lentivirus LTRs. In some aspects, the two LTRs are retrovirus LTRs.

[0025] Further provided is a vector comprising a nucleic acid described herein.

[0026] Also provided is a viral particle comprising a nucleic acid described herein or a vector described herein.

[0027] In some aspects, a viral particle further comprises a viral capsid protein.

[0028] In some aspects, the viral capsid protein is an AAV capsid protein.

[0029] In some aspects, the viral capsid protein is an Ad capsid protein.

[0030] In some aspects, the viral capsid protein is a lentivirus envelope protein.

[0031] In some aspects, the viral capsid protein is a retrovirus envelope protein.

[0032] Also provided is a composition comprising a nucleic acid described herein, a vector described herein, or a viral particle described herein.

[0033] In some aspects, a composition comprising a nucleic acid described herein or a vector described herein, further comprises a lipid.

[0034] In some aspects, the lipid is an ionizable lipid, a phospholipid, a sterol, a PEG-lipid, or combinations thereof.

[0035] In some aspects, a nanoparticle comprising a nucleic acid described herein.

[0036] Also provided is a method for producing a viral particle, the method comprising: coexpressing a nucleic acid described herein or a vector described herein in a cell with a nucleic acid encoding a packaging cassette, the packaging cassette comprising at least one nucleotide sequence encoding a replication polypeptide and at least one nucleotide sequence encoding a capsid protein or an envelope protein.

[0037] In some aspects, the at least one replication polypeptide is an AAV replication polypeptide and the at least one capsid protein is an AAV capsid protein.

[0038] In some aspects, the at least one replication polypeptide is an Ad replication polypeptide and the at least one capsid protein is an Ad capsid protein.

[0039] In some aspects, the at least one replication polypeptide is a lentivirus Gag polypeptide, lentivirus Pol polypeptide, lentivirus Rev polypeptide, lentivirus Tat polypeptide, or combinations thereof; and the at least one capsid protein is a lentivirus envelope (Env) polypeptide.

[0040] In some aspects, the at least one replication polypeptide is a retrovirus Gag polypeptide, retrovirus Pol polypeptide or a combination thereof; and the at least one capsid protein is a retrovirus envelope (Env) polypeptide.4#14580236vlAttorney Docket No. U1197.70256US00

[0041] Further provided is a method for producing a lipid nanoparticle, the method comprising: mixing a nucleic acid described herein or a vector described herein with a lipid solution, the lipid solution comprising an ionizable lipid, a phospholipid, a sterol, a PEG-lipid, or combinations thereof.

[0042] Also provided is a method of contacting a cell, the method comprising contacting a cell with a nucleic acid described herein, a vector described herein, a viral particle described herein, or a composition described herein.

[0043] In some aspects, the cell is a carcinoma cell. In some aspects, the cell is a breast carcinoma cell.

[0044] Further provided is a method of inducing immunogenic cell death in a cell, the method comprising contacting the cell with a nucleic acid described herein, a vector described herein, a viral particle described herein, or a composition described herein.

[0045] In some aspects, the cell is a carcinoma cell. In some aspects, the cell is a breast carcinoma cell.

[0046] Also provided is a method of inducing release of tumor antigens from a tumor cell, the method comprising contacting a tumor cell with a nucleic acid described herein, a vector described herein, a viral particle described herein, or a composition described herein.

[0047] In some aspects, the tumor cell is a carcinoma cell. In some aspects, the carcinoma cell is a breast carcinoma cell.

[0048] Also provided is a method of treating cancer in a subject, the method comprising administering to a subject in need thereof a nucleic acid described herein, a vector described herein, a viral particle described herein, or a composition described herein. In some aspects, the method further comprises administering to the subject an immune checkpoint therapy.

[0049] In some aspects, the subject has a carcinoma. In some aspects, the subject has a breast carcinoma.5#14580236vlAttorney Docket No. U1197.70256US00BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.

[0051] FIG. 1 shows a schematic of AAV plasmids containing a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells) (Keratin 80 (Krt80) and Stratifin (SFN) promoters)), green fluorescent polypeptide (GFP) reporter, or cytotoxic forms of immunogenic cell death executioners a Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) and gasdermin D (GSDMD).

[0052] FIGs. 2A-2B show identification of cancer- specific promoters (e.g., an epithelial cellspecific promoter and / or a mesenchymal cell-specific promoter; e.g., a promoter that is inactive in virus-packaging cells). FIG. 2A shows fluorescence microscopy images of HEK293 cells transiently transfected with the five indicated gene promoters linked to the GFP reporter. FIG. 2B shows fluorescence microscopy images of MCF7 human breast cancer cells transiently transfected with the five indicated gene promoters linked to the GFP reporter. Red fluorescent polypeptide (RFP) was co-transfected to monitor transfection efficiency. The results show that the promoters of SFN and KRT80 are active in MCF7 cancer cells but inactive in virus-packaging HEK293 cells.

[0053] FIGs. 3A-3B show validation of the cytotoxicity of the N-terminal domains of MLKL and GSDMD. FIG. 3A shows fluorescence microscopy images of HEK293 cells transfected with MLKL, GSDMD, or GFP driven by the constitutive / ubiquitous CMV promoter. FIG. 3B shows fluorescence microscopy images of MCF7 cells transfected with MLKL, GSDMD, or GFP driven by the constitutive / ubiquitous CMV promoter. Cells were subsequently stained with propidium iodide (PI) that labels dying / dead cells. GFP was co-transfected to monitor transfection efficiency.

[0054] FIGs. 4A-4B show that keratin 80 promoter (KRT80)-driven MLKL or GSDMD selectively killed MCF7 cells. FIG. 4A shows fluorescence microscopy images of HEK293 cells transfected with KRT80-driven MLKL or GSDMD. FIG. 4B shows fluorescence microscopy images of MCF7 cells transfected with KRT80-driven MLKL or GSDMD. CMV-6#14580236vlAttorney Docket No. U1197.70256US00driven GFP was added to all samples to monitor transfection. Propidium iodide (PI) staining was used to identify dead cells.

[0055] FIGs. 5A-5B show SFN-driven MLKL or GSDMD selectively killed MCF7 cells. FIG. 5A shows fluorescence microscopy images of HEK293 cells transfected with SFN-driven MLKL or GSDMD. FIG. 5B shows fluorescence microscopy images of MCF7 cells transfected with SFN-driven MLKL or GSDMD. CMV-driven GFP was added to all samples to monitor transfection. Propidium iodide (PI) staining was used to identify dead cells.

[0056] FIG. 6 shows a schematic of adeno-associated virus (AAV) packaging by triple transfection (BioRender). pAAV-Transgene are plasmids depicted in FIG. 1. KRT80 / SFN-driven MLKL / GSDMD, and the indicated plasmids were co-transfected into the HEK293 packaging cells. Ultracentrifugation of iodixanol gradient was used for purification. AAV titration by qPCR using SYBR green was used to determine the number of transgenecontaining particles.

[0057] FIGs. 7A-7C show AAV2 carrying KRT80 / SFN-driven GFP could infect epithelial MCF7 cells and mesenchymal MDA-MB-231 cells and selectively express GFP in MCF7 cells and MDA-MB-231 cells. FIG. 7A shows fluorescence microscopy images of HEK293 cells infected with AAV2 viruses carrying the GFP reporter driven by a ubiquitous CAG promoter or breast cancer- specific KRT80 / SFN promoters. FIG. 7B shows fluorescence microscopy images of MCF7 cells infected with AAV2 viruses carrying the GFP reporter driven by a ubiquitous CAG promoter or breast cancer-specific KRT80 / SFN promoters. FIG. 7C shows fluorescence microscopy images of MDA-MB-231 cells infected with AAV2 viruses carrying the GFP reporter driven by a ubiquitous CAG promoter or cancer-specific KRT80 / SFN promoters. Images were taken 3 days post- infection. MOI: 1,000.

[0058] FIGs. 8A-8B show transduction of AAV2 carrying KRT80 / SFN-driven MLKL / GSDMD selectively induced cell death in MCF7 cells but not in HEK293 cells. FIG.8A shows HE293 cells infected with AAV2 viruses carrying the indicated constructs. FIG. 8B shows MCF7 cells infected with AAV2 viruses carrying the indicated constructs. Images were taken 48-hours post transduction. PI stains dead cells.

[0059] FIGs. 9A-9B show ATP release into cell culture supernatants following AAV2 transduction. FIG. 9A shows a graph of extracellular ATP released from HEK293 cells transduced with AAV2 carrying KRT80 / SFN-driven MLKL or GSDMD. FIG. 9B shows a graph of extracellular ATP released from MCF7 cells transduced with AAV2 carrying KRT80 / SFN-driven MLKL or GSDMD. Media supernatants were collected 48-hr post transduction for ATP measurement (n=6).7#14580236vlAttorney Docket No. U1197.70256US00

[0060] FIG 10 shows extracellular levels of lactate dehydrogenase (LDH) (indicating lytic cell death) three days post-infection of HEK293 (left), MCF7 (center), and MDA-MB-231 (right) cells with AAV2 viruses carrying KRT80- or SFN-driven GSDMD or MLKL.

[0061] FIG. 11 shows extracellular levels of ATP (a DAMP) three days post-infection of HEK293 (left), MCF7 (center), and MDA-MB-231 (right) cells with AAV2 viruses carrying KRT80- or SFN-driven GSDMD or MLKL.DETAILED DESCRIPTION

[0062] Certain cancers, such as breast cancer, generally lack infiltration of immune effector cells, and are often considered immunologically cold and are poorly responsive to immune checkpoint blockade therapy. Accumulating evidence supports that induction of immunogenic cell death in cancer triggers immune responses and improves immunotherapy efficacy.

[0063] The present disclosure is based at least in part on the development of nucleic acids, vectors, viral particles, and nanoparticles for delivering immunogenic cell death executioners, e.g., a N-terminal domain of gasdermin D (GSDM) and / or a N-terminal domain of Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) to cancer cells. The term “cell death executioner” (or “cell death inducer”) as used herein refers to a cytotoxic form of a polypeptide, e.g., a N-terminal domain of a gasdermin and / or MLKL protein that induces immunogenic cell death, e.g., by necroptosis and pyroptosis, respectively. The term “immunogenic cell death” refers to a cell death that elicits an immune response. For example, the N terminal domain of a gasdermin D immunogenic cell death executioner induces necroptosis and the N terminal domain of a MLKL immunogenic cell death executioner induces pyroptosis. In some aspects, the immunogenic cell death executioners are expressed from promoters that are tumor cell specific. For example, in some aspects, the immunogenic cell death executioners are expressed from gene promoters that are selectively active in cancer cells (e.g., breast cancer cells), but inactive in virus-packaging cells. The promoters may be active, for example, in epithelial cells and / or mesenchymal cells. The promoters, in some embodiments, are specific promoters that drive expression in epithelial cell tumors, e.g., carcinomas. Non-limiting examples of cancer- specific promoters (e.g., epithelial cell specific promoters and / or mesenchymal cell specific promoters) provided herein include a keratin 80 promoter and a stratifin promoter.

[0064] Without wishing to be bound by theory, it is thought that expression of these cell death executioners during the virus packaging process will destruct the packaging cells and leading8#14580236vlAttorney Docket No. U1197.70256US00to failed AAV production; however, the use of cell-type- selective promoters prevents expression of the cell death inducers during AAV packaging and allow efficient AAV yield.

[0065] The AAVs described herein are useful, in some aspects, for the treatment of cancer. In some embodiments, the AAVs are used as a neoadjuvant therapy. As is shown in an in vitro model (FIGs. 9A-9B, 11), infection with the AAV systems described herein caused selected breast cancer cells to undergo pyroptosis or necroptosis, releasing damage-associated molecular patterns (DAMPs). It is believed that intratumoral injection of the AAVs described herein will similarly cause infected breast cancer cells undergo pyroptosis or necroptosis, releasing DAMPs. Without wishing to be bound by theory, it is thought that the released DAMPs will signal to attract innate immune cells, initiate inflammatory responses, and enhance the infiltration of immune effector cells, thus turning 'cold' tumors into 'hot' tumors and improving tumor response to immune checkpoint inhibitor therapy. The resulting adaptive immunity from the immune checkpoint inhibitor therapy then attacks remaining, uninfected cancer cells based on antigen recognition.Nucleic Acids

[0066] In some aspects, provided are nucleic acids comprising a nucleotide sequence encoding a gasdermin polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a vertebrate gasdermin polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a mammalian gasdermin polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a human gasdermin polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a gasdermin A, B, C, D, or E polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a gasdermin D polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a human gasdermin A, B, C, D, or E polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a human gasdermin D polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a gasdermin protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a gasdermin A, B, C, D, or E protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a gasdermin D protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a human gasdermin A, B, C, D, or E protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a human gasdermin D protein.9#14580236vlAttorney Docket No. U1197.70256US00

[0067] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin A, B, C, D, or E protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D. The term “functional N-terminal domain of gasdermin A, B, C, D, or E” as used herein, refers to an amino acid sequence of a gasdermin A, B, C, D, or E protein, which amino acid sequence is located at the N-terminus of the gasdermin protein and which sequence exerts a function of the gasdermin protein, e.g., induction of cell death, e.g., by pore formation in a plasma membrane. A functional N-terminal domain of a gasdermin A, B, C, D, or E protein does not include the C-terminus of the gasdermin A, B, C, D, or E protein. For example, a functional N-terminal domain of a gasdermin D protein can comprise amino acids 1-450 of a gasdermin D protein. In some aspects, a nucleic acid provided herein encodes a gasdermin D polypeptide comprising an amino acid sequence of a human gasdermin D polypeptide of SEQ ID NO: 1.

[0068] The amino acid sequence of human gasdermin D polypeptide (GenBank AAH08904.1) is shown below:1 mgsafervvr rvvqeldhgg efipvtslqs stgfqpyclv vrkpssswfw kprykcvnls61 ikdilepdaa epdvqrgrsf hfydamdgqi qgsvelaapg qakiaggaav sdssstsmnv121 yslsvdpntw qtllherhlr qpehkvlqql rsrgdnvyvv tevlqtqkev evtrthkreg181 sgrfslpgat clqgegqghl sqkktvtips gstlafrvaq Ividsdldvl Ifpdkkqrtf241 qppatghkrs tsegawpqlp sglsmmrclh nfltdgvpae gaftedfqgl raevetiske301 lelldrelcq llleglegvl rdqlalrale ealeqgqslg pvepldgpag avleclvlss361 gmlvpelaip vvyllgaltm Isetqhklla ealesqtllg plelvgslle qsapwqerst421 mslppgllgn swgegapawv lldecglelg edtphvcwep qaqgrmcaly aslallsgls481 qeph (SEQ ID NO: 1)

[0069] In some aspects, provided is a nucleic acid that encodes a N-terminal domain of a gasdermin D protein comprising between about 20 and about 450 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 1, or about 50 to about 75 amino acids, about 75 to about 100 amino acids, about 100 to about 125 amino acids, about 125 to about 150 amino acids, about 150 to about 175 amino acids, about 175 to about 200 amino acids, about 200 to about 225 amino acids, about 225 to about 250 amino acids, about 250 to about 275 amino acids, about 275 to about 300 amino acids, about 300 to about 325 amino acids, about 325 to about 350 amino acids, about 350 to about 375 amino acids, about 375 to about 400 amino acids, about 400 to about 425 amino acids, or about 425 to about 450 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 1, or any number of amino acids between about 20 and about 450 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 1. In some 10#14580236vlAttorney Docket No. U1197.70256WO00aspects, a nucleic acid that encodes a N-terminal domain of a gasdermin D protein comprises about 20 amino acids, about 40 amino acids, about 60 amino acids, about 70 amino acids, about 80 amino acids, about 100 amino acids, about 110 amino acids, about 120 amino acids, about 130 amino acids, about 140 amino acids, about 150 amino acids, about 160 amino acids, about 170 amino acids, about 175 amino acids, about 180 amino acids, about 190 amino acids, about 200 amino acids, about 210 amino acids, about 220 amino acids, about 230 amino acids, about 235 amino acids, about 240 amino acids, about 245 amino acids, about 250 amino acids, about 260 amino acids, about 270 amino acids, or about 280 amino acids of an N-terminal domain of an amino acid sequence of SEQ ID NO: 1.

[0070] In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein comprising an amino acid sequence comprising amino acid 1 to about 100, amino acid 1 to about 105, amino acid 1 to about 110, amino acid 1 to about 115, amino acid 1 to about 120, amino acid 1 to about 125, amino acid 1 to about 130, amino acid 1 to about 135, amino acid 1 to about 140, amino acid 1 to about 145, amino acid 1 to about 150, amino acid 1 to about 155, amino acid 1 to about 160, amino acid 1 to about 165, amino acid 1 to about 170, amino acid 1 to about 175, amino acid 1 to about 180, amino acid 1 to about 185, amino acid 1 to about 190, amino acid 1 to about 195, amino acid 1 to about 200, amino acid 1 to about 205, amino acid 1 to about 210, amino acid 1 to about 215, amino acid 1 to about 220, amino acid 1 to about 225, amino acid 1 to about 230, amino acid 1 to about 235, amino acid 1 to about 236, amino acid 1 to about 237, amino acid 1 to about 238, amino acid 1 to about 239, amino acid 1 to about 240, amino acid 1 to about 241, amino acid 1 to about 242, amino acid 1 to about 243, amino acid 1 to about 244, amino acid 1 to about 245, amino acid 1 to about 246, amino acid 1 to about 247, amino acid 1 to about 248, amino acid 1 to about 249, amino acid 1 to about 250, amino acid 1 to about 251, amino acid 1 to about 252, amino acid 1 to about 253 amino acid 1 to about 254, amino acid 1 to about 255, amino acid 1 to about 256, amino acid 1 to about 257, amino acid 1 to about 258, amino acid 1 to about 259, amino acid 1 to about 260, amino acid 1 to about 265, amino acid 1 to about 270, amino acid 1 to about 275, amino acid 1 to about 280, amino acid 1 to about 285, amino acid 1 to about 290, amino acid 1 to about 295, amino acid 1 to about 300, amino acid 1 to about 325, amino acid 1 to about 350, amino acid 1 to about 375, amino acid 1 to about 400, amino acid 1 to about 425, amino acid 1 to about 450, or any number of amino acids between amino acid 1 and amino acid 450 of a gasdermin D amino acid sequence of SEQ ID NO: 1. In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein comprising about amino acid 80 to about amino acid 245 of SEQ ID NO: 1. In some aspects, a nucleic acid 11#14580236vlAttorney Docket No. U1197.70256WO00comprises a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein comprising about amino acid 90 to about amino acid 245 of SEQ ID NO: 1. In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein comprising about amino acid 100 to about amino acid 245 of SEQ ID NO: 1. In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein comprising about amino acid 110 to about amino acid 245 of SEQ ID NO: 1.

[0071] In some aspects, a gasdermin D polypeptide comprises an amino acid sequence that is about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to an amino acid sequence of SEQ ID NO: 1.

[0072] In comparing two sequences, the percent sequence identity that a Query sequence has to a Reference sequence (e.g., having a SEQ ID NO. provided herein) is calculated by (i) aligning the Query sequence to the Reference sequence, (ii) determining the number of matching nucleotides between the aligned Query and Reference sequences, and (iii) dividing the number of matching residues by the length of the Reference sequence, including any gaps introduced into the Reference sequence when the two sequences are aligned.

[0073] In some aspects, a nucleic acid encodes a gasdermin D polypeptide comprising an amino acid sequence that comprises about 1, 2, 3, 4, 5, 10, 15, or 20 amino acid substitutions, deletions and / or insertions compared to an amino acid sequence of SEQ ID NO: 1.

[0074] In some aspects, a nucleic acid encodes a gasdermin D polypeptide comprising an amino acid sequence that comprises an amino acid sequence of SEQ ID NO: 1. In some aspects, a nucleic acid encodes a gasdermin D polypeptide comprising an amino acid sequence that consists essentially of an amino acid sequence of SEQ ID NO: 1. In some aspects, a nucleic acid encodes a gasdermin D polypeptide comprising an amino acid sequence that consists of an amino acid sequence of SEQ ID NO: 1.

[0075] In some aspects, provided is a nucleic acid comprising a nucleotide sequence encoding a gasdermin D polypeptide, the nucleic acid comprising between about 60 nucleotides and about 1350 nucleotides of a nucleic acid sequence of SEQ ID NO: 2.

[0076] The nucleic acid sequence of human gasdermin D mRNA (NCBI NM_024736.7) is shown below, with the polypeptide coding region starting at nucleotide 111 (atg) and ending at nucleotide 1565 (tag).1 gcagtttcac ttttagctct gggcacctcc agctcctgct cgccggacgg ctcccaggga61 gagcagacgc gccagacgcg ccaccctcgg ggcgccgacg gtcacggagc atggggtcgg121 cctttgagcg ggtagtccgg agagtggtcc aggagctgga ccatggtggg gagttcatcc12#14580236vlAttorney Docket No. U1197.70256WO00181 ctgtgaccag cctgcagagc tccactggct tccagcccta ctgcctggtg gttaggaagc241 cctcaagctc atggttctgg aaaccccgtt ataagtgtgt caacctgtct atcaaggaca301 tcctggagcc ggatgccgcg gaaccagacg tgcagcgtgg caggagcttc cacttctacg361 atgccatgga tgggcagata cagggcagcg tggagctggc agccccagga caggcaaaga421 tcgcaggcgg ggccgcggtg tctgacagct ccagcacctc aatgaatgtg tactcgctga481 gtgtggaccc taacacctgg cagactctgc tccatgagag gcacctgcgg cagccagaac541 acaaagtcct gcagcagctg cgcagccgcg gggacaacgt gtacgtggtg actgaggtgc601 tgcagacaca gaaggaggtg gaagtcacgc gcacccacaa gcgggagggc tcgggccggt661 tttccctgcc cggagccacg tgcttgcagg gtgagggcca gggccatctg agccagaaga721 agacggtcac catcccctca ggcagcaccc tcgcattccg ggtggcccag ctggttattg781 actctgactt ggacgtcctt ctcttcccgg ataagaagca gaggaccttc cagccacccg841 cgacaggcca caagcgttcc acgagcgaag gcgcctggcc acagctgccc tctggcctct901 ccatgatgag gtgcctccac aacttcctga cagatggggt ccctgcggag ggggcgttca961 ctgaagactt ccagggccta cgggcagagg tggagaccat ctccaaggaa ctggagcttt1021 tggacagaga gctgtgccag ctgctgctgg agggcctgga gggggtgctg cgggaccagc1081 tggccctgcg agccttggag gaggcgctgg agcagggcca gagccttggg ccggtggagc1141 ccctggacgg tccagcaggt gctgtcctgg agtgcctggt gttgtcctcc ggaatgctgg1201 tgccggaact cgctatccct gttgtctacc tgctgggggc actgaccatg ctgagtgaaa1261 cgcagcacaa gctgctggcg gaggcgctgg agtcgcagac cctgttgggg ccgctcgagc1321 tggtgggcag cctcttggag cagagtgccc cgtggcagga gcgcagcacc atgtccctgc1381 cccccgggct cctggggaac agctggggcg aaggagcacc ggcctgggtc ttgctggacg1441 agtgtggcct agagctgggg gaggacactc cccacgtgtg ctgggagccg caggcccagg1501 gccgcatgtg tgcactctac gcctccctgg cactgctatc aggactgagc caggagcccc1561 actagcctgt gcccgggcat ggcctggcag ctctccagca gggcagagtg tttgcccacc1621 agctgctagc cctaggaagg ccaggagccc agtagccatg tggccagtct accatggggc1681 ccaggagttg gggaaacaca ataaaggtgg catacgaagg aaa (SEQ ID NO: 2).

[0077] In some aspects, a nucleic acid encoding a gasdermin D polypeptide comprises between about 65 nucleotides and about 1400 nucleotides of a N-terminal nucleic acid sequence of SEQ ID NO: 2, or about 70 nucleotides to about 100 nucleotides, about 100 nucleotides to about 125 nucleotides, about 125 nucleotides to about 150 nucleotides, about 150 nucleotides to about 175 nucleotides, about 175 nucleotides to about 200 nucleotides, about 200 nucleotides to about 225 nucleotides, about 225 nucleotides to about 250 nucleotides, about 250 nucleotides to about 275 nucleotides, about 275 nucleotides to about 300 nucleotides, about 300 nucleotides to about 325 nucleotides, about 325 nucleotides to about 350 nucleotides,13#14580236vlAttorney Docket No. U1197.70256WO00about 350 nucleotides to about 375 nucleotides, about 375 nucleotides to about 400 nucleotides, about 400 nucleotides to about 425 nucleotides, about 425 nucleotides to about 450 nucleotides, about 450 nucleotides to about 475 nucleotides, about 475 nucleotides to about 500 nucleotides, about 500 nucleotides to about 525 nucleotides, about 525 nucleotides to about 550 nucleotides, about 550 nucleotides to about 575 nucleotides, about 575 nucleotides to about 600 nucleotides, about 600 nucleotides to about 625 nucleotides, about 625 nucleotides to about 650 nucleotides, about 650 nucleotides to about 675 nucleotides, about 675 nucleotides to about 700 nucleotides, about 700 nucleotides to about 725 nucleotides, about 725 nucleotides to about 750 nucleotides, about 750 nucleotides to about 775 nucleotides, about 775 nucleotides to about 780 nucleotides, about 780 nucleotides to about 785 nucleotides, about 785 nucleotides to about 790 nucleotides, about 790 nucleotides to about 795, about 795 nucleotides to about 800 nucleotides, about 800 nucleotides to about 825 nucleotides, about 825 nucleotides to 850 nucleotides, about 850 nucleotides to about 875 nucleotides, about 875 nucleotides to about 900 nucleotides, about 900 nucleotides to about 1000 nucleotides, about 1000 nucleotides to about 1100 nucleotides, about 1100 nucleotides to about 1200 nucleotides, or about 1200 nucleotides to about 1350 nucleotides of a N-terminal nucleic acid sequence of SEQ ID NO: 2, or any number of nucleotides between about 20 and about 1350 nucleotides of a N-terminal nucleic acid sequence of SEQ ID NO: 2.

[0078] In some aspects, a nucleic acid comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 2.

[0079] In some aspects, a nucleic acid encoding a gasdermin D polypeptide comprises a nucleotide sequence that comprises about 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotide substitutions, deletion and / or insertions compared to nucleotide sequence of SEQ ID NO: 2.

[0080] In some aspects, a nucleic acid encoding a gasdermin D polypeptide comprises a nucleic acid sequence that comprises a nucleic acid sequence of SEQ ID NO: 2. In some aspects, a nucleic acid encoding a gasdermin D polypeptide comprises a nucleic acid sequence that consists essentially of a nucleic acid sequence of SEQ ID NO: 2. In some aspects, a nucleic acid encoding a gasdermin D polypeptide comprises a nucleic acid sequence that consists of a nucleic acid sequence of SEQ ID NO: 2.

[0081] In some aspects, provided is a nucleic acid comprising a nucleotide sequence encoding a Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a vertebrate MLKL polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a mammalian MLKL 14#14580236vlAttorney Docket No. U1197.70256WO00polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a human MLKL polypeptide. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a MLK protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding an N-terminal domain of a human MLK protein. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of MLKL. The term “functional N-terminal domain of MLKL,” as used herein, refers to a sequence of a MLKL protein, which sequence is located at the N-terminus of the MLKL polypeptide and which sequence exerts a function of the MLKL polypeptide, e.g., induction of cell death.

[0082] The amino acid sequence of human MLKL polypeptide (GenBank NP_689862.1) is shown below:1 menlkhiitl gqvihkrcee mkyckkqcrr Ighrvlglik plemlqdqgk rsvpsekltt61 amnrfkaale eangeiekfs nrsnicrflt asqdkilfkd vnrklsdvwk elslllqveq121 rmpvspisqg aswaqedqqd adedrrafqm Irrdnekiea slrrleinmk eiketlrqyl181 ppkcmqeipq eqikeikkeq Isgspwillr enevstlykg eyhrapvaik vfkklqagsi241 aivrqtfnke iktmkkfesp nilrifgici detvtppqfs ivmeycelgt Irelldrekd301 Itlgkrmvlv Igaarglyrl hhseapelhg kirssnflvt qgyqvklagf elrktqtsms361 Igttrektdr vkstaylspq eledvfyqyd vkseiysfgi vlweiatgdi pfqgcnseki421 rklvavkrqq eplgedcpse Ireiidecra hdpsvrpsvd eilkklstfs k (SEQ ID NO: 3)

[0083] In some aspects, provided is a nucleic acid that encodes a N-terminal domain of a MLKL protein comprising between about 20 and about 430 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 3, or about 50 to about 75 amino acids, about 75 to about 100 amino acids, about 100 to about 125 amino acids, about 125 to about 150 amino acids, about 150 to about 175 amino acids, about 175 to about 200 amino acids, about 200 to about 225 amino acids, about 225 to about 250 amino acids, about 250 to about 275 amino acids, about 275 to about 300 amino acids, about 300 to about 325 amino acids, about 325 to about 350 amino acids, about 350 to about 375 amino acids, about 375 to about 400 amino acids, about 400 to about 425 amino acids, or about 425 to about 430 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 3 or any number of amino acids between about 20 and about 430 amino acids, between about 40 and about 430 amino acids, or between about 60 and about 430 amino acids of an N-terminal amino acid sequence of SEQ ID NO: 3.

[0084] In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a MLKL protein comprising an amino acid sequence comprising amino acid 1 to about 20, amino acid 1 to about 30, amino acid 1 to about 35, amino acid 1 to about 15#14580236vlAttorney Docket No. U1197.70256WO0040, amino acid 1 to about 45, amino acid 1 to about 50, amino acid 1 to about 55, amino acid 1 to about 60, amino acid 1 to about 65, amino acid 1 to about 70, amino acid 1 to about 75, amino acid 1 to about 80, amino acid 1 to about 85 amino acid, 1 to about 90, amino acid 1 to about 95, amino acid 1 to about 100, amino acid 1 to about 105, amino acid 1 to about 110, amino acid 1 to about 115, amino acid 1 to about 120, amino acid 1 to about 125, amino acid 1 to about 130, amino acid 1 to about 135, amino acid 1 to about 140, amino acid 1 to about 145, amino acid 1 to about 150, amino acid 1 to about 155, amino acid 1 to about 160, amino acid 1 to about 165, amino acid 1 to about 170, amino acid 1 to about 175, amino acid 1 to about 180, amino acid 1 to about 185, amino acid 1 to about 190, amino acid 1 to about 195, amino acid 1 to about 200, amino acid 1 to about 205, amino acid 1 to about 210, amino acid 1 to about 215, amino acid 1 to about 220, amino acid 1 to about 225, amino acid 1 to about 230, amino acid 1 to about 235, amino acid 1 to about 236, amino acid 1 to about 237, amino acid 1 to about 238, amino acid 1 to about 239, amino acid 1 to about 240, amino acid 1 to about 241, amino acid 1 to about 242, amino acid 1 to about 243, amino acid 1 to about 244, amino acid 1 to about 245, amino acid 1 to about 246, amino acid 1 to about 247, amino acid 1 to about 248, amino acid 1 to about 249, amino acid 1 to about 250, amino acid 1 to about 251, amino acid 1 to about 252, amino acid 1 to about 253 amino acid 1 to about 254, amino acid 1 to about 255, amino acid 1 to about 256, amino acid 1 to about 257, amino acid 1 to about 258, amino acid 1 to about 259, amino acid 1 to about 260, amino acid 1 to about 265, amino acid 1 to about 270, amino acid 1 to about 275, amino acid 1 to about 280, amino acid 1 to about 285, amino acid 1 to about 290, amino acid 1 to about 295, amino acid 1 to about 300, amino acid 1 to about 325, amino acid 1 to about 350, amino acid 1 to about 375, amino acid 1 to about 400, amino acid 1 to about 425, amino acid 1 to about 430, or any number of amino acids between amino acid 1 and amino acid 430 of a MLKL amino acid sequence of SEQ ID NO: 3.

[0085] In some aspects, a nucleic acid comprises a nucleic acid sequence encoding a N-terminal domain of a MLKL polypeptide comprising between about 40 and about 125 amino acids, between about 50 and about 125 amino acids, or between about 50 and about 125 amino acids of an N-terminal MLKL amino acid sequence of SEQ ID NO: 3. In some aspects, a nucleic acid that encodes a N-terminal domain of a MLKL protein comprises about 20 amino acids, about 40 amino acids, about 50 amino acids, about 60 amino acids, about 70 amino acids, about 80 amino acids, about 90 amino acids, about 100 amino acids, about 110 amino acids, about 120 amino acids, or about 125 amino acids, about 130 amino acids, about 140 amino acids, about 150 amino acids, about 160 amino acids, about 170 amino acids, about 175 amino acids, about 180 amino acids, about 185 amino acids, about 190 amino acids, about 19516#14580236vlAttorney Docket No. U1197.70256WO00amino acids, about 200 amino acids, about 210 amino acids, about 220 amino acids, about 230 amino acids, about 240 amino acids, about 250 amino acids, or about 260 amino acids of an N-terminal domain of an amino acid sequence of SEQ ID NO: 3.

[0086] In some aspects, a nucleic acid provided herein encodes a MLKL polypeptide comprising an amino acid sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to an amino acid sequence of SEQ ID NO: 3.

[0087] In some aspects, a nucleic acid encodes a MLKL polypeptide comprising an amino acid sequence that comprises about 1, 2, 3, 4, 5, 10, 15, or 20 amino acid substitutions, deletions and / or insertions compared to an amino acid sequence of SEQ ID NO: 3.

[0088] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a MLKL polypeptide comprising an amino acid sequence of SEQ ID NO: 3. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a MLKL polypeptide consisting essentially of an amino acid sequence of SEQ ID NO: 3. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a MLKL polypeptide consisting of an amino acid sequence of SEQ ID NO: 3.

[0089] In some aspects, provided is a nucleic acid comprising a nucleotide sequence encoding a MLKL polypeptide, the nucleic acid comprising between about 60 nucleotides and about 1350 nucleotides of a nucleic acid sequence of SEQ ID NO: 4.

[0090] The nucleic acid sequence of human MLKL (NCBI NM_152649.4) is shown below with the polypeptide coding region starting at nucleotide 413 (atg) and ending at nucleotide 1828 (tag).1 gtgagcctgg tggttggcag ctggagccac gtcggagggg gaagtgtcgc agcattctct61 gcaggcatca cagacctgag gcagtggcct ccggagggca ctggacagaa acagccatcc121 aagtggctga gtggagggac cctgctcaag tgcagctgca gtggccgggg tttccctcag181 gtagggatcg gggcgccttg tcgccgccag ccacgtgtgg cgtccggtac agtcagcaga241 gtgcagggtg cgggcaccag gaaagggggc gcaggggaac tcccgcgggc ctcgcgtttg301 caaacttctc gcctgggcag gaggcggtcg tgggaaagaa ggtggaagag cgagcttttt361 ggaactgtgc acgggacaga ttggacgcac acccctcggg aggcgcgaag gcatggaaaa421 tttgaagcat attatcaccc ttggccaggt catccacaaa cggtgtgaag agatgaaata481 ctgcaagaaa cagtgccggc gcctgggcca ccgcgtcctc ggcctgatca agcctctgga541 gatgctccag gaccaaggaa agaggagcgt gccctctgag aagttaacca cagccatgaa601 ccgcttcaag gctgccctgg aggaggctaa tggggagata gaaaagttca gcaatagatc661 caatatctgc aggtttctaa cagcaagcca ggacaaaata ctcttcaagg acgtgaacag17#14580236vlAttorney Docket No. U1197.70256WO00721 gaagctgagt gatgtctgga aggagctctc gctgttactt caggttgagc aacgcatgcc781 tgtttcaccc ataagccaag gagcgtcctg ggcacaggaa gatcagcagg atgcagacga841 agacaggcga gctttccaga tgctaagaag agataatgaa aaaatagaag cttcactgag901 acgattagaa atcaacatga aagaaatcaa ggaaactttg aggcagtatt taccaccaaa961 atgcatgcag gagatcccgc aagagcaaat caaggagatc aagaaggagc agctttcagg1021 atccccgtgg attctgctaa gggaaaatga agtcagcaca ctttataaag gagaatacca1081 cagagctcca gtggccataa aagtattcaa aaaactccag gctggcagca ttgcaatagt1141 gaggcagact ttcaataagg agatcaaaac catgaagaaa ttcgaatctc ccaacatcct1201 gcgtatattt gggatttgca ttgatgaaac agtgactccg cctcaattct ccattgtcat1261 ggagtactgt gaactcggga ccctgaggga gctgttggat agggaaaaag acctcacact1321 tggcaagcgc atggtcctag tcctgggggc agcccgaggc ctataccggc tacaccattc1381 agaagcacct gaactccacg gaaaaatcag aagctcaaac ttcctggtaa ctcaaggcta1441 ccaagtgaag cttgcaggat ttgagttgag gaaaacacag acttccatga gtttgggaac1501 tacgagagaa aagacagaca gagtcaaatc tacagcatat ctctcacctc aggaactgga1561 agatgtattt tatcaatatg atgtaaagtc tgaaatatac agctttggaa tcgtcctctg1621 ggaaatcgcc actggagata tcccgtttca aggctgtaat tctgagaaga tccgcaagct1681 ggtggctgtg aagcggcagc aggagccact gggtgaagac tgcccttcag agctgcggga1741 gatcattgat gagtgccggg cccatgatcc ctctgtgcgg ccctctgtgg atgaaatctt1801 aaagaaactc tccacctttt ctaagtagtg tatcaaaatc taaaccaagg agtctctgga1861 caagaagctg ggagaggcac aaactggaca tctctctctc tcatatcctt cggcattggg1921 ttatctatgg gtgcaaggag tgggcacgct tctctgttac aaatagaaaa cgattccagt1981 catacaggac acatcccact ccaaatgata tttccaaaaa catacctctg acagtaactt2041 tgatagatgg tttgtcaaat gtatctttct gggtatccac acctcttggc aatgaaattt2101 gcagctcctc ccttccataa atgaagtctc tttccccacc atttgaatct gggctggcac2161 tgtgacttga tttgatcaat agaatgtgga agaagtgact gtatgccagt tccaagccta2221 ggtttcaaga ggccttataa atgtctgttg gaaccttacc cagccatgaa catgttgagt2281 gagcatgctg gagaatgaga gaccacatga agcagaaaca tgctttccta gctgaagtca2341 tactagccca accaacatgg cagctaacac atgaatgagg ccaatcaaga ccagaagaac2401 cactcaagca gatcccagcc caaattgccc attcacacaa tcaggagcta aataaattac2461 tgttgtctta acactaa (SEQ ID NO: 4).

[0091] In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence comprising between about 300 nucleotides and about 900 nucleotides of a N-terminal portion of a nucleic acid sequence of SEQ ID NO: 4.18#14580236vlAttorney Docket No. U1197.70256WO00

[0092] In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence comprising between about 350 nucleotides and about 850 nucleotides, or about 300 nucleotides, about 310 nucleotides, about 315 nucleotides, about 320 nucleotides, about 325 nucleotides, about 330 nucleotides, about 335 nucleotides, about 340 nucleotides, about 345 nucleotides, about 350 nucleotides, about 355 nucleotides, about 360 nucleotides, about 365 nucleotides, about 370 nucleotides, about 375 nucleotides, about 380 nucleotides, about 385 nucleotides, about 390 nucleotides, about 395 nucleotides, about 400 nucleotides, about 425 nucleotides, about 430 nucleotides, about 435 nucleotides, about 440 nucleotides, about 445 nucleotides, about 450 nucleotides, about 455 nucleotides, about 460 nucleotides, about 465 nucleotides, about 470 nucleotides, about 475 nucleotides, about 480 nucleotides, about 485 nucleotides, about 490 nucleotides, about 495 nucleotides, about 500 nucleotides, about 505 nucleotides, about 510 nucleotides, about 515 nucleotides, about 520 nucleotides, about 525 nucleotides, about 530 nucleotides, about 535 nucleotides, about 540 nucleotides, about 545 nucleotides, about 550 nucleotides, about 555 nucleotides, about 560 nucleotides, about 565 nucleotides, about 570 nucleotides, about 575 nucleotides, about 580 nucleotides, about 585 nucleotides, about 590 nucleotides, about 600 nucleotides, about 605 nucleotides, about 610 nucleotides, about 615 nucleotides, about 620 nucleotides, about 625 nucleotides, about 630 nucleotides, about 635 nucleotides, about 640 nucleotides, about 645 nucleotides, about 650 nucleotides, about 655 nucleotides, about 660 nucleotides, about 665 nucleotides, about 670 nucleotides, about 675 nucleotides, about 680 nucleotides, about 685 nucleotides, about 690 nucleotides, about 695 nucleotides, about 700 nucleotides, about 725 nucleotides, about 750 nucleotides, about 775 nucleotides, about 800 nucleotides, about 825 nucleotides, about 850 nucleotides, about 875 nucleotides, about 900 nucleotides of an N-terminal nucleic acid sequence of SEQ ID NO: 4, or any number of nucleotides therein between of an N-terminal nucleic acid sequence of SEQ ID NO: 4.

[0093] In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 4.

[0094] In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence that comprises about 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotide substitutions, deletions and / or insertions compared to nucleotide sequence of SEQ ID NO: 4.

[0095] In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence comprising a sequence of SEQ ID NO: 4. In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence consisting essentially of a nucleotide 19#14580236vlAttorney Docket No. U1197.70256WO00sequence of SEQ ID NO: 4. In some aspects, a nucleic acid encoding a MLKL polypeptide comprises a nucleotide sequence consisting of a nucleotide sequence of SEQ ID NO: 4.

[0096] In some aspects, provided is a nucleic acid comprising a nucleotide sequence encoding a N-terminal domain of a gasdermin D protein as described herein and a N-terminal domain of a MLKL protein as described herein.Regulatory elements

[0097] In some aspects, a nucleic acid further comprises a regulatory element. The term “regulatory element,” as used herein, refers to a nucleotide sequence or structural component of a nucleic acid described herein which regulates expression of the nucleic acid (e.g., a N-terminal gasdermin D domain and / or a N-terminal MLKL domain). Regulatory elements include, but are not limited to, promoters as described herein, enhancers, silencers, insulators, response elements, initiation sites, termination signals, and ribosome binding sites. In some aspects, regulatory elements can be one or more naturally occurring and / or engineered regulatory elements. In some embodiments, regulatory elements are naturally- occurring human regulatory elements. In some embodiments, a promoter is human promoter (e.g., a promoter of a human gene).

[0098] In some aspects, a nucleic acid comprises a promoter. In some aspects, a nucleic acid comprises a promoter that is active in a tumor. For example, in some aspects, a nucleic acid comprises a promoter that drives expression of the nucleic acid (e.g., a N-terminal gasdermin domain and / or a N-terminal MLKL domain) in a cancer cell. In some aspects, a nucleic acid comprises a promoter that is a cancer cell specific promoter. The term “cancer cell specific promoter,” as used herein refers to a promoter that drives expression of an operably linked nucleic acid only in cancer cells or drives preferential expression in cancer cells. The term “preferential expression,” refers to an expression that occurs, e.g., in 60%, 80% or 90% or more of cancer cells compared to only 40%, 20%, or 10% or less of non-cancer cells. A preferential expression in cancer cells can also refer to an expression that is 2-fold, 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, or higher in cancer cells than in non-cancer cells. In some embodiments, the non-cancer cells are virus-packaging cells (e.g., HEK293 cells). In some embodiments, the cancer- specific promoter is a breast cancer- specific promoter. In some aspects, a nucleic acid comprising a promoter that is a breast cancer- specific promoter (e.g., a promoter that drives expression of an operably linked nucleic acid only in breast cancer cells or drives preferential expression in breast cancer cells). In some aspects, a nucleic acid comprises a promoter that drives expression of the N-terminal gasdermin domain and / or a N-terminal 20#14580236vlAttorney Docket No. U1197.70256WO00MLKL domain encoded by the nucleic acid in a breast cancer cell. In some aspects, a nucleic acid comprises a promoter that drives expression of the N-terminal gasdermin domain and / or a N-terminal MLKL domain encoded by the nucleic acid in a melanoma cell. In some aspects, a nucleic acid comprises a promoter that drives expression of the N-terminal gasdermin domain and / or a N-terminal MLKL domain encoded by the nucleic acid in a glioblastoma cell. In some aspects, a nucleic acid comprises a promoter that drives expression of the N-terminal gasdermin domain and / or a N-terminal MLKL domain encoded by the nucleic acid in a prostate cancer cell. In some aspects, a nucleic acid comprises an epithelial cell specific promoter. In some aspects, a nucleic acid comprises a mesenchymal cell-specific promoter. Examples of breast cancer cell-specific promoters (e.g., epithelial cell- and / or mesenchymal cell-specific promoters) include a keratin 80 promoter and a stratifin promoter. In some aspects, a nucleic acid comprises a keratin 80 promoter. In some aspects, a nucleic acid comprises a stratifin promoter.

[0099] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D operably linked to a cancer- specific promoter (e.g., an epithelial cell- specific promoter and / or a mesenchymal cell- specific promoter).

[0100] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of MLKL operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter).

[0101] The term “epithelial cell specific promoter,” as used herein, refers to a promoter that drives transcription of an operably linked nucleic acid in an epithelial cell, e.g., a nucleic acid operably linked to an epithelial specific promoter is only expressed in epithelial cells or is preferentially expressed in epithelial cells. For example, preferential expression in epithelial cells refers to an expression that occurs, e.g., in 60%, 80% or 90% or more of epithelial cells compared to only 40%, 20%, or 10% or less of non-epithelial cells. Or, a preferential expression in epithelial cells refers to an expression that is 2-fold, 3-fold, 5-fold, 10-fold, 20 fold, 50-fold, or higher in epithelial cells than in non-epithelial cells. Non-limiting examples of epithelial cell specific promoters include a keratin promoter, e.g., a keratin 80 promoter, a stratifin promoter, epidermal growth factor receptor (EGFR) promoter, cytokeratin 18 promoter, and epithelial glycopolypeptide-2 promoter.

[0102] The term “mesenchymal cell specific promoter,” as used herein, refers to a promoter that drives transcription of an operably linked nucleic acid in a mesenchymal cell, e.g., a nucleic acid operably linked to a mesenchymal specific promoter is only expressed in mesenchymal cells or is preferentially expressed in mesenchymal cells. For example,21#14580236vlAttorney Docket No. U1197.70256WO00preferential expression in mesenchymal cells refers to an expression that occurs, e.g., in 60%, 80% or 90% or more of mesenchymal cells compared to only 40%, 20%, or 10% or less of non-mesenchymal cells. Or, a preferential expression in mesenchymal cells refers to an expression that is 2-fold, 3-fold, 5-fold, 10-fold, 20 fold, 50-fold, or higher in mesenchymal cells than in non- mesenchymal cells. Non-limiting examples of mesenchymal cell specific promoters include a keratin promoter, e.g., a keratin 80 promoter, a stratifin promoter, and a IL-6 promoter.

[0103] The term “keratin 80 promoter,” as used herein, refers to a nucleic acid sequence that drives the transcription of a keratin 80 gene.

[0104] In some aspects, a keratin 80 promoter comprises or consists of a nucleic acid sequence as shown below (SEQ ID NO: 1). In some aspects, a keratin 80 promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 14 (SEQ ID NO: 14 is SEQ ID NO: 5, excluding the underlined portion).

[0105] AGAGCTGCATTCAGCCATACCCATCGCCCCTGCTAGACTCAGCACCCGGAA GGCAGTACCACTGATTGAGGCCAACTTTGTCCCCTGTCCTCTACCAAGTGCTTTGT ACATGCTACCTCCTGTGAGGTGGGTGTTTTCATCCCCACTTTACAAATGAAGACAA AAGTCAAGTAACGTGCCTGAGGTCACATGAGTGGTGAGCAGTCCAGCTGAGTCTT GAACCAGGTCTCACATTTCCAATGCTGAGAGCTCCTTGGCCTTGACCGTCTATGTC CTCCCAGCCTCTGAGACAGTAGGGTGTACATAGTAGGTCCTCAATCAATGCTAGTT AAAGTGAAGGAAGGAAGGAAGGGAGAGGGGGTAGAAGGAAGGGGGAAGATAAG CCAGGGAGACTCTTTGGCAGCCAGAAAATAAATAATAAGTGCTGTTTTCCAGTGC CAGGCTGGCACGGTGCCCAGGATAGCTGCCCTACACTCGGGAGCTCAAGGCCTAT GCTTGACTCATCTTTTCCAGAAGTATGTGAGCCCAGATACGTCAGCCTTCAAGTAT GCAGTGAGGTCTGCGGTGAGGCGCTCTCTCTTCTCTCCTGCCCCCTTGAATGGCCT TCCTTTTGCCAACTCCCCACCCCCAACCCACCCGGCCAGTCCAGCCTTGGCCCCCT CCCCAGAGCTAGGCCTGCTTTCTTTGGGGCAGGGGGCTGTGGACCAGCCCCCTAA GCAATGCAGATACCTGTTGGGAGGGAGACCTACATGCTGCTGGGGGAGGGGCGGG AGCACCCACATCATCCAACAGGTTGGTCAGGCTGGGAGGCGTCCCGCCCTCCTGC AGCTAATGAGCACTGTGCAACAGGTGTCTGCTCCTCAGTCCCCAGCCCGCCCCAGC TGTGACCAGAGCAACCAGAG (SEQ ID NO: 5)

[0106] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein operably linked to a keratin 80 promoter. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of a MLKL protein operably linked to a keratin 80 promoter. In some aspects, a 22#14580236vlAttorney Docket No. U1197.70256WO00nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or a functional N-terminal domain of a MLKL protein operably linked to a keratin 80 promoter, wherein the keratin 80 promoter comprises between about 350 nucleotides and about 900 nucleotides, or about 300 nucleotides, about 350 nucleotides, about 375 nucleotides, about 400 nucleotides, about 425 nucleotides, about 450 nucleotides, about 460 nucleotides, about 465 nucleotides, about 470 nucleotides, about 475 nucleotides, about 480 nucleotides, about 485 nucleotides, about 490 nucleotides, about 495 nucleotides, about 500 nucleotides, about 505 nucleotides, about 510 nucleotides, about 515 nucleotides, about 520 nucleotides, about 525 nucleotides, about 530 nucleotides, about 535 nucleotides, about 540 nucleotides, about 545 nucleotides, about 550 nucleotides, about 555 nucleotides, about 560 nucleotides, about 565 nucleotides, about 570 nucleotides, about 575 nucleotides, about 580 nucleotides, about 585 nucleotides, about 590 nucleotides, about 595 nucleotides, about 600 nucleotides, about 605 nucleotides, about 610 nucleotides, about 615 nucleotides, about 620 nucleotides, about 625 nucleotides, about 630 nucleotides, about 635 nucleotides, about 640 nucleotides, about 645 nucleotides, about 650 nucleotides, about 655 nucleotides, about 660 nucleotides, about 665 nucleotides, about 670 nucleotides, about 675 nucleotides, about 680 nucleotides, about 685 nucleotides, about 690 nucleotides, about 695 nucleotides, about 700 nucleotides, about 705 nucleotides, about 710 nucleotides, about 715 nucleotides, about 720 nucleotides, about 725 nucleotides, about 730 nucleotides, about 735 nucleotides, about 740 nucleotides, about 745 nucleotides, about 750 nucleotides, about 755 nucleotides, about 760 nucleotides, about 765 nucleotides, about 770 nucleotides, about 780 nucleotides, about 790 nucleotides, about 800 nucleotides, about 825 nucleotides, about 850 nucleotides, about 875 nucleotides, about 900 nucleotides, about 920 nucleotides or any number of nucleotides therein between of a nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 14. In some aspects, a keratin 80 promoter of a nucleic acid described herein comprises 902 nucleotides of SEQ ID NO: 5. In some aspects, a keratin 80 promoter of a nucleic acid described herein consists of the 902 nucleotides of SEQ ID NO: 5. In some aspects, a keratin 80 promoter of a nucleic acid described herein comprises SEQ ID NO: 14. In some aspects, a keratin 80 promoter of a nucleic acid described herein consists of SEQ ID NO: 14.

[0107] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or a functional N-terminal domain of a MLKL protein operably linked to a keratin 80 promoter comprising a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 5. In some aspects, a nucleic acid comprises 23#14580236vlAttorney Docket No. U1197.70256WO00a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or a functional N-terminal domain of a MLKL protein operably linked to a keratin 80 promoter comprising a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 14.

[0108] In some aspects, a nucleic acid sequence of a keratin 80 promoter comprises about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotide substitutions (e.g., insertion and / or deletions) compared to a nucleotide sequence of SEQ ID NO: 5. In some aspects, a nucleic acid sequence of a keratin 80 promoter comprises about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotide substitutions (e.g., insertion and / or deletions) compared to a nucleotide sequence of SEQ ID NO: 14.

[0109] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein operably linked to a stratifin promoter. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of MLKL protein operably linked to a stratifin promoter. The term “stratifin promoter,” as used herein, refers to a nucleic acid sequence that drives the transcription of a stratifin gene.

[0110] In some aspects, a stratifin promoter comprises or consists of a nucleic acid sequence as shown below (SEQ ID NO: 6). In some aspects, a stratifin promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 15 (SEQ ID NO: 15 is SEQ ID NO: 6, excluding the underlined portion).GAGGCATCACGTAGCTGGAATTGCTGCCCCATAAAACAGAATGGTATGTGTCACT GCCACCTCCCTTTCTCAGTCCTCTCTCTCCCCAGGTTGCTAGCGTCCCCCCTGGGGG ATCAAACTGGACTGCTTCCCAGCCTCAGACAGAGAGCAGTCTGAGTCAGGCAGGA AAGTGGGACAGCCGGGGAGCTGGACCCCACCCTCTGTGAGCCCCGCTGGTACCTG ATGGCATGTGGCTTGGAGAGGGCAGGTGACCTGGCGTGGAGGGCCAGAGGGTAA ATCCTCAAACAAGTGGCAACAGGCCACCAACTTGAAAGGGAAAATTGTGTAGTGA TGGGAAATGTGTCCAACAAACCTACTGGGTGACTAATTACAAAGGCTGGGCTGGA GCTTCAGAGGCTGCTTGTTAAACACTTCATTAAGCGGCACTCTGAAAGCTGCCACC TGCGCATTCTGGGAGCTCAGAGGGGACCCTGAGGGGGAATGAGGCCTGGAGGATG GAACCATCTTCAGGTAGACTGAGAAGGAGCCTGGATCTCACTTCCAAACACAGTC TGGAGCTCATAGGTCAGAGGCCTCAATGGGAGAAAAGCTAAAGGAAGAGGGTGC AGAAAGGAGTTTCAGGGAATTGGTGGCTATGTGACTTTGAGCAAATCTCACCCCTC24#14580236vlAttorney Docket No. U1197.70256WO00 TCTGAGACTTAGTGTTCCCATCTCTATGGTCCTGTGTGTGTCACAGAGACATGGTG GGGATTAAATTCGATCGTGAATATGAAAGTGCTTGGGAAACTCCATGGCCCTACCT AAACATGAGTTATCCTCACCTGAACCAAGGGGGGAAGTTACCTGGCAGGATTAGG AACCCCATCCTCCTGAACCTTTATGGGCTCTGTCGAGGCTGAAGCAGCCAGGGGCT AAAGCCGTCCTTAGCCCCTGGAAGGGCACTGTGAAAGTGGATCTGATTTGAGAAG CCGTTTCCTGATGTGGGCAGCCATGTGATGCCAGCCCCGAACAAGAGGGGGCAGC CTGGAGCCTGGAAAGGTGCCAGTGCAGGTGGGGCCCACGCCCAGATTTCTCCTGC TGACTGTTCTGATGATTCACCCCCACATCCCAGCCTTTTTACCTTTACTGCAGAGCC GGAAAGGGTGTGGGGAAGAGAGGAGAGGGAGGCAGGTCTTGGGCCCTGGTCCCG CCCCCTGCTCCTCCCCACCCTTCTCTGGGCCTGGCCACCCAGCCAAAAGGCAGGCC AAGAGCAGGAGAGACACAGAGTCCGG (SEQ ID NO: 6)

[0111] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein operably linked to a stratifin promoter. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of a MLKL protein operably linked to a stratifin promoter. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or functional N-terminal domain of a MLKL protein operably linked to a stratifin promoter, wherein the stratifin promoter comprises between about 350 nucleotides and about 1300 nucleotides, or about 300 nucleotides, about 350 nucleotides, about 375 nucleotides, about 400 nucleotides, about 425 nucleotides, about 450 nucleotides, about 460 nucleotides, about 465 nucleotides, about 470 nucleotides, about 475 nucleotides, about 480 nucleotides, about 485 nucleotides, about 490 nucleotides, about 495 nucleotides, about 500 nucleotides, about 505 nucleotides, about 510 nucleotides, about 515 nucleotides, about 520 nucleotides, about 525 nucleotides, about 530 nucleotides, about 535 nucleotides, about 540 nucleotides, about 545 nucleotides, about 550 nucleotides, about 555 nucleotides, about 560 nucleotides, about 565 nucleotides, about 570 nucleotides, about 575 nucleotides, about 580 nucleotides, about 585 nucleotides, about 590 nucleotides, about 595 nucleotides, about 600 nucleotides, about 605 nucleotides, about 610 nucleotides, about 615 nucleotides, about 620 nucleotides, about 625 nucleotides, about 630 nucleotides, about 635 nucleotides, about 640 nucleotides, about 645 nucleotides, about 650 nucleotides, about 655 nucleotides, about 660 nucleotides, about 665 nucleotides, about 670 nucleotides, about 675 nucleotides, about 680 nucleotides, about 685 nucleotides, about 690 nucleotides, about 695 nucleotides, about 700 nucleotides, about 705 nucleotides, about 710 nucleotides, about 715 nucleotides, about 720 nucleotides, about 725 nucleotides, about 730 nucleotides, about 735 nucleotides, about 740 nucleotides,25#14580236vlAttorney Docket No. U1197.70256WO00about 745 nucleotides, about 750 nucleotides, about 755 nucleotides, about 760 nucleotides, about 765 nucleotides, about 770 nucleotides, about 780 nucleotides, about 790 nucleotides, about 800 nucleotides, about 825 nucleotides, about 850 nucleotides, about 875 nucleotides, about 900 nucleotides, about 925 nucleotides, about 950 nucleotides, about 975 nucleotides, about 1000 nucleotides, about 1100 nucleotides, about 1200 nucleotides, about 1300 nucleotide, or any number of nucleotides thereinbetween of a nucleic acid sequence of SEQ ID NO: 6 or SEQ ID NO: 15. In some aspects, a stratifin promoter comprises about 1243 nucleotides of SEQ ID NO: 6. In some aspects, a stratifin promoter consists about 1243 nucleotides of SEQ ID NO: 6. In some aspects, a stratifin promoter comprises SEQ ID NO: 15. In some aspects, a stratifin promoter consists of SEQ ID NO: 15.

[0112] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or a functional N-terminal domain of a MLKL protein operably linked to a stratifin promoter comprising a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 6. In some aspects, a nucleic acid comprises a nucleotide sequence encoding a functional N-terminal domain of gasdermin D protein or a functional N-terminal domain of a MLKL protein operably linked to a stratifin promoter comprising a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a nucleotide sequence of SEQ ID NO: 15.

[0113] In some aspects, a nucleic acid sequence of a stratifin promoter comprises about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotide substitutions, insertion and / or deletions compared to a nucleotide sequence of SEQ ID NO: 6. In some aspects, a nucleic acid sequence of a stratifin promoter comprises about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotide substitutions, insertion and / or deletions compared to a nucleotide sequence of SEQ ID NO: 15.

[0114] In some aspects, a nucleic acid comprises a nucleotide sequence encoding a N-terminal domain of a gasdermin D protein as described herein operably linked to a keratin 80 promoter or a stratifin promoter and a N-terminal domain of a MLKL protein as described herein operably linked to a keratin 80 promoter or a stratifin promoter. In some aspects, a N-terminal domain of a gasdermin D protein and a N-terminal domain of a MLKL protein are operably linked to a same promoter, keratin 80 promoter or a stratifin promoter. In some aspects, a N-terminal domain of a gasdermin D protein and a N-terminal domain of a MLKL protein are operably linked to different promoter, e.g., a N-terminal domain of a gasdermin D protein is 26#14580236vlAttorney Docket No. U1197.70256WO00linked to a keratin 80 promoter and a N-terminal domain of a MLKL protein is operably linked to a stratifin promoter or vice versa.

[0115] In some aspects, a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein and a nucleic acid sequence encoding a N-terminal domain of a MLKL protein are present on a same nucleic acid molecule. In some aspects, a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein and a nucleic acid sequence encoding a N-terminal domain of a MLKL protein are present on different nucleic acid molecules.

[0116] In some aspects, a nucleic acid provided herein further comprises a polyadenylation (poly(A)) sequence. In some aspects, the poly(A) sequence comprises a human growth hormone poly(A), bovine growth hormone poly(A) or a SV40 poly(A).Recombinant viral vectors and lipid nanoparticles

[0117] In some aspects, a nucleic acid comprising a nucleotide sequence encoding a functional N-terminal domain of gasdermin D operably linked to a cancer- specific promoter (e.g., an epithelial cell- specific promoter and / or a mesenchymal cell- specific promoter) is present in a vector, e.g., a plasmid or a recombinant viral genome.

[0118] In some aspects, a nucleic acid comprising a nucleotide sequence encoding a functional N-terminal domain of MLKL operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter) is present in a vector, e.g., a plasmid or a recombinant viral genome.

[0119] In some aspects, a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein and a nucleic acid sequence encoding a N-terminal domain of a MLKL protein are present on a same vector, e.g., plasmid or recombinant viral genome. In some aspects, a nucleic acid sequence encoding a N-terminal domain of a gasdermin D protein and a nucleic acid sequence encoding a N-terminal domain of a MLKL protein are present on different vectors, e.g., plasmids or a recombinant viral genomes. In some aspects, a recombinant viral genome is an adeno-associated virus recombinant genome. In some aspects, a recombinant viral genome is an adenovirus (Ad) recombinant genome.

[0120] In some aspects, a vector comprising a nucleic acid comprising a nucleotide sequence encoding a functional N-terminal domain of gasdermin D operably linked to a cancer-specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter) further comprises an inverted terminal repeat. In some aspects, a vector comprising a nucleic acid comprising a nucleotide sequence encoding a functional N-terminal domain of27#14580236vlAttorney Docket No. U1197.70256WO00MLKL operably linked to a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter) further comprises an inverted terminal repeat.

[0121] In some aspects, an inverted terminal repeat (ITR) is an adenoviral- associated virus ITR (AAV ITR). In some aspects, an inverted terminal repeat (ITR) is from an adenovirus (Ad ITR). In some aspects, a terminal repeat is a long terminal repeat (LTR). In some aspects, a long terminal repeat is from a retrovirus (retro LTR). In some aspects, a long terminal repeat is from a lenti virus (lenti ITR).

[0122] In some aspects, a vector (e.g., an AAV genome) as described herein comprises two AAV ITRs, e.g., a 5TTR and a 3’ ITR. Each ITR can independently be of any AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74), or both ITRs may be of the same serotype. ITRs are described, for example, in Grimm et al. J. Virol. 80(l):426-439 (2006). An exemplary 5’ ITR sequence of an AAV serotype 2 is shown below (SEQ ID NO: 7; SEQ ID NO: 16 is SEQ ID NO: 7 without the underlined nucleic acids).

[0123] Example of wild-type AAV25’ ITR:TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG GGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGG GGTTCCT (SEQ ID NO: 7)

[0124] In some aspects, a nuclei acid vector comprising a nucleic acid described herein is a recombinant AAV (rAAV) genome. In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome) comprises native AAV genes or native AAV nucleotide sequences, e.g., sequences encoding an AAV replication polypeptide (Rep78, Rep68, Rep52 and / or Rep40). In some aspects, one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome). In some aspects, one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome) and replaced with sequence of a nucleic acid described herein.

[0125] In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome) can be of any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74, or a combination of serotypes.

[0126] In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome) as provided herein is a single- stranded DNA. In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome) as provided herein is a self-complementary (double- stranded) DNA.

[0127] For example, a single- stranded wild-type AAV genome is approximately 4.7 kilobases (kb) in length; recombinant AAV genomes have typically been limited to approximately this 28#14580236vlAttorney Docket No. U1197.70256WO00same length. See, e.g., Wu, et al., Mol Ther. (2010) 18(1): 80-86. A self-complementary AAV genome is often even more limited, with maximum packaging capacities of about 2.3 kb.

[0128] In some aspects, an AAV genome described herein comprises an expression cassette comprising one or more regulatory elements, such as a promoter, e.g., a cancer- specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter) operably linked to a sequence encoding an immunogenic cell death executioner amino acid sequence.

[0129] In some aspects, a regulatory element is located between two ITRs, a 5' ITR and a 3' ITR. In some aspects, a regulatory element is located upstream of or 5' relative to a sequence encoding an immunogenic cell death executioner amino acid sequence, e.g., a cancer-specific promoter (e.g., an epithelial cell-specific promoter and / or a mesenchymal cell-specific promoter) is located upstream of or 5' relative to a sequence encoding an immunogenic cell death executioner amino acid sequence.

[0130] In some aspects, a regulatory element is located downstream of or 3' relative to a sequence encoding an immunogenic cell death executioner amino acid sequence, e.g., a polyadenylation sequence is located downstream of or 3' relative to a sequence encoding an immunogenic cell death executioner amino acid sequence.

[0131] In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome or a recombinant adenovirus genome) is comprised within or encoded by a plasmid.

[0132] In some aspects, a nucleic acid described herein further comprises a detectable molecule. A detectable molecule is a molecule that can be visualized (e.g., using a naked eye, under a microscope, or using a light detection device such as a camera). In some aspects, the detectable molecule is a fluorescent molecule, a bioluminescent molecule, or a molecule that provides color (e.g., P-galactosidase, P-lactamase, P-glucuronidase, or spheroidenone). In some aspects, the detectable molecule is a fluorescent, bioluminescent or enzymatic polypeptide or functional peptide or polypeptide thereof.

[0133] In some aspects, fluorescent polypeptide is a blue fluorescent polypeptide, a cyan fluorescent polypeptide, a green fluorescent polypeptide, a yellow fluorescent polypeptide, an orange fluorescent polypeptide, a red fluorescent polypeptide, or a functional peptide or polypeptide thereof.

[0134] In some aspects, a detectable molecule is a bioluminescent polypeptide or a functional peptide or polypeptide thereof. Non-limiting examples of bioluminescent polypeptides are firefly luciferase, click-beetle luciferase, Renilla luciferase, and luciferase from Oplophorus gracilirostris.29#14580236vlAttorney Docket No. U1197.70256WO00

[0135] In some aspects, a nucleic acid described herein is comprised in a delivery vehicle such as a nanoparticle, e.g., a lipid nanoparticle, liposome, nanocapsule, microparticle, microsphere, lipid particle, vesicle, and the like. In some aspects, a nucleic acid is formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle.Viral particles

[0136] In some aspects, a recombinant adenovirus (Ad) genome described herein is encapsidated within an Ad capsid. In some aspects, a recombinant AAV (rAAV) genome described herein is encapsidated within an AAV capsid. In some aspects, a recombinant AAV genome described herein is encapsidated within a wild-type AAV capsid. In some aspects, a recombinant AAV genome described herein is encapsidated within an AAV of one of various AAV serotypes as described herein, or an AAV capsid variants (e.g., comprising a capsid protein comprising one or more amino acid substitutions).

[0137] An AAV particle is a supramolecular assembly of 60 individual capsid protein subunits forming a non-enveloped T-l icosahedral lattice capable of protecting a single- stranded DNA genome. A mature AAV particle is approximately 20 nm in diameter, and its capsid is formed from three structural capsid proteins VP1, VP2, and VP3, with molecular masses of 87, 73, and 62 kDa, respectively, in a ratio of approximately 1:1:18. The 60 capsid proteins are arranged in an anti-parallel P-strand barreloid arrangement, resulting in a defined tropism and a high resistance to degradation.

[0138] In some aspects, an AAV particle comprises an empty capsid (e.g., a capsid without a cargo). In some aspects, an AAV particle comprises a capsid encapsidating a nucleic acid (e.g., a nucleic acid vector that comprises a nucleic acid described herein). In some aspects, a nucleic acid encapsidated within an AAV capsid to generate an AAV particle comprises a nucleic acid vector described herein. In some aspects, an AAV particle comprises a capsid protein, e.g., a wild-type AAV2 capsid protein. In some aspects, an AAV particle comprises a capsid protein, e.g., a wild-type AAV9 capsid protein. In some aspects, an AAV particle comprises a capsid protein comprising one or more mutations, e.g., one or more amino acid substitutions.

[0139] It is contemplated herein that any nucleic acid vector, e.g., recombinant AAV genome described herein can be combined with any AAV capsid, e.g., any wildtype AAV capsid and / or any modified AAV capsid, e.g., a AAV capsid protein comprising one or more amino acid substitutions, e.g., one mor more substitutions at a capsid surface-exposed tyrosine and / or threonine residue.30#14580236vlAttorney Docket No. U1197.70256WO00

[0140] In some aspects, an AAV particle described herein comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to capsid surface exposed tyrosine and / or threonine residues.

[0141] In some aspects, a nucleic acid vector (e.g., a recombinant AAV genome) encapsidated within an AAV capsid forms a pseudotyped AAV particle, such that the genome is of a serotype distinct from the capsid in which it is encapsidated. For example, a nucleic acid vector (e.g., an AAV genome) of serotype AAV2 may be encapsidated within a capsid of serotype AAV9.

[0142] In some aspects, an AAV particle disclosed herein is replicative. A replicative AAV particle is capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture). For example, in some aspects, an AAV particle disclosed herein comprises a nucleic acid vector described herein and further comprises a nucleic acid encoding an AAV replication polypeptide, e.g., a Rep78, Rep68, Rep52, and / or Rep40 polypeptide.

[0143] In some aspects, an AAV particle disclosed herein is non-replicating. A non-replicating AAV particle is not capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture) but can infect the host and incorporate a genetic component into the host’s genome for expression. In some aspects, an AAV particle disclosed herein is capable of infecting a host cell. In some aspects, an AAV particle disclosed herein is capable of facilitating stable integration of genetic components into the genome of a host cell. In some aspects, an AAV particle disclosed herein is not capable of facilitating integration of genetic components into the genome of a host cell.

[0144] An AAV particle disclosed herein may comprise a capsid protein of any AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74), including any derivative (including non-naturally occurring variants of a serotype) or pseudotype. Non-limiting examples of derivatives and pseudotypes include AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods of producing such derivatives / pseudotypes are known in the art (see, e.g., Mol. Ther. 2012 Apr; 20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A, Schaffer DV, Samulski RJ.). In some aspects, an AAV particle is a pseudotyped AAV particle, which comprises a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2 or AAV3)31#14580236vlAttorney Docket No. U1197.70256WO00and a capsid comprised of capsid proteins derived from another serotype (i.e., a serotype other than AAV2 or AAV3, respectively). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods, 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001)).

[0145] Example of an amino acid sequence of wild-type AAV2 capsid protein1 MAADGYLPDW LEDTLSEGIR QWWKLKPGPP PPKPAERHKD DSRGLVLPGY51 KYLGPFNGLD KGEPVNEADA AALEHDKAYD RQLDSGDNPY LKYNHADAEF101 QERLKEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEPVKTAP GKKRPVEHSP151 VEPDSSSGTG KAGQQPARKR LNFGQTGDAD SVPDPQPLGQ PPAAPSGLGT201 NTMATGSGAP MADNNEGADG VGNSSGNWHC DSTWMGDRVI TTSTRTWALP251 TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI301 NNNWGFRPKR LNFKLFNIQV KEVTQNDGTT TIANNLTSTV QVFTDSEYQL351 PYVLGSAHQG CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS401 QMLRTGNNFT FSYTFEDVPF HSSYAHSQSL DRLMNPLIDQ YLYYLSRTNT451 PSGTTTQSRL QFSQAGASDI RDQSRNWLPG PCYRQQRVSK TSADNNNSEY501 SWTGATKYHL NGRDSLVNPG PAMASHKDDE EKFFPQSGVL IFGKQGSEKT551 NVDIEKVMIT DEEEIRTTNP VATEQYGSVS TNLQRGNRQA ATADVNTQGV601 LPGMVWQDRD VYLQGPIWAK IPHTDGHFHP SPLMGGFGLK HPPPQILIKN651 TPVPANPSTT FSAAKFASFI TQYSTGQVSV EIEWELQKEN SKRWNPEIQY701 TSNYNKSVNV DFTVDTNGVY SEPRPIGTRY LTRNL ( SEQ ID NO: 8 )

[0146] Example of an amino acid sequence of wild-type AAV9 capsid protein is shown below.1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY51 KYLGPGNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF101 QERLKEDTSF GGNLGRAVFQ AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP151 QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE SVPDPQPIGE PPAAPSGVGS201 LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI TTSTRTWALP251 TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR301 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY351 QLPYVLGSAH EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF401 PSQMLRTGNN FQFSYEFENV PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT451 INGSGQNQQT LKFSVAGPSN MAVQGRNYIP GPSYRQQRVS TTVTQNNNSE501 FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS LIFGKQGTGR551 DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG601 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK651 NTPVPADPPT AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ701 YTSNYYKSNN VEFAVNTEGV YSEPRPIGTR YLTRNL (SEQ ID NO: 9)

[0147] Also provided herein are nucleic acids encoding capsid proteins. A nucleic acid may comprise a sequence that encodes a capsid protein disclosed here (e.g., a capsid protein comprising one or more amino acid substitutions). A sequence encoding a capsid protein disclosed herein can be determined by one of ordinary skill in the art by known methods. A nucleic acid encoding a capsid protein may comprise a promoter or other regulatory sequence operably linked to the coding sequence. A nucleic acid encoding a capsid protein may be in the form of a plasmid, an mRNA, or another nucleic acid capable of being used by enzymes or machinery of a host cell to produce a capsid protein. Nucleic acids encoding capsid proteins as provided herein can be used to make AAV particles. Methods of making AAV particles are32#14580236vlAttorney Docket No. U1197.70256WO00known in the art. For example, see Scientific Reports volume 9, Article number: 13601 (2019); Methods Mol Biol. 2012; 798: 267-284; and thermofisher.com / us / en / home / clinical / cell-gene-therapy / gene-therapy / aav-production-workflow.html. Example sequences of nucleic acids encoding capsid proteins are provided below.

[0148] Example of a nucleotide sequence encoding AAV2 capsid protein:

[0149] atggctgccgatggttatcttccagattggctcgaggacactctctctgaaggaataagacagtggtgga agctcaaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgg gtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgag cacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagt ttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggt tcttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcct gtggagccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcaga ctggagacgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaa tacgatggctacaggcagtggcgcaccaatggcagacaataacgagggcgccgacggagtgggtaattcctccgga aattggcattgcgattccacatggatgggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacct acaacaaccacctctacaaacaaatttccagccaatcaggagcctcgaacgacaatcactactttggctacagcac cccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcaaagactcatcaacaac aactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgcagaatgacg gtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgt cctcggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctc accctgaacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgc gtaccggaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgctcacagccagag tctggaccgtctcatgaatcctctcatcgaccagtacctgtattacttgagcagaacaaacactccaagtggaacc accacgcagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctg gaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtgaatactcgtggactggagc taccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaaggacgatgaa gaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaa aggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctac caacctccagagaggcaacagacaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctgg caggacagagatgtgtaccttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctc ccctcatgggtggattcggacttaaacaccctcctccacagattctcatcaagaacaccccggtacctgcgaatcc ttcgaccaccttcagtgcggcaaagtttgcttccttcatcacacagtactccacgggacaggtcagcgtggagatc gagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattcagtacacttccaactacaacaagtctg ttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcaccagatacctgactcg taatctgtaa (SEQ ID NO: 10 )

[0150] Example of a nucleotide sequence encoding an AAV9 capsid protein is shown below: atggctgccgatggttatcttccagattggctcgaggacaaccttagtgaaggaattcgcgagtggtgggctttga aacctggagcccctcaacccaaggcaaatcaacaacatcaagacaacgctcgaggtcttgtgcttccgggttacaa ataccttggacccggcaacggactcgacaagggggagccggtcaacgcagcagacgcggcggccctcgagcacgac aaggcctacgaccagcagctcaaggccggagacaacccgtacctcaagtacaaccacgccgacgccgagttccagg agcggctcaaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaaaaagaggcttcttga 33#14580236vlAttorney Docket No. U1197.70256WO00 acctcttggtctggttgaggaagcggctaagacggctcctggaaagaagaggcctgtagagcagtctcctcaggaa ccggactcctccgcgggtattggcaaatcgggtgcacagcccgctaaaaagagactcaatttcggtcagactggcg acacagagtcagtcccagaccctcaaccaatcggagaacctcccgcagccccctcaggtgtgggatctcttacaat ggcttcaggtggtggcgcaccagtggcagacaataacgaaggtgccgatggagtgggtagttcctcgggaaattgg cattgcgattcccaatggctgggggacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaaca atcacctctacaagcaaatctccaacagcacatctggaggatcttcaaatgacaacgcctacttcggctacagcac cccctgggggtattttgacttcaacagattccactgccacttctcaccacgtgactggcagcgactcatcaacaac aactggggattccggcctaagcgactcaacttcaagctcttcaacattcaggtcaaagaggttacggacaacaatg gagtcaagaccatcgccaataaccttaccagcacggtccaggtcttcacggactcagactatcagctcccgtacgt gctcgggtcggctcacgagggctgcctcccgccgttcccagcggacgttttcatgattcctcagtacgggtatctg acgcttaatgatggaagccaggccgtgggtcgttcgtccttttactgcctggaatatttcccgtcgcaaatgctaa gaacgggtaacaacttccagttcagctacgagtttgagaacgtacctttccatagcagctacgctcacagccaaag cctggaccgactaatgaatccactcatcgaccaatacttgtactatctctcaaagactattaacggttctggacag aatcaacaaacgctaaaattcagtgtggccggacccagcaacatggctgtccagggaagaaactacatacctggac ccagctaccgacaacaacgtgtctcaaccactgtgactcaaaacaacaacagcgaatttgcttggcctggagcttc ttcttgggctctcaatggacgtaatagcttgatgaatcctggacctgctatggccagccacaaagaaggagaggac cgtttctttcctttgtctggatctttaatttttggcaaacaaggaactggaagagacaacgtggatgcggacaaag tcatgataaccaacgaagaagaaattaaaactactaacccggtagcaacggagtcctatggacaagtggccacaaa ccaccagagtgcccaagcacaggcgcagaccggctgggttcaaaaccaaggaatacttccgggtatggtttggcag gacagagatgtgtacctgcaaggacccatttgggccaaaattcctcacacggacggcaactttcacccttctccgc t gat gggagggtttggaatgaagcacccgcctcctcagatcct cat caaaaacacacctgt acct gcggatcctcc aacggccttcaacaaggacaagctgaactctttcatcacccagtattctactggccaagtcagcgtggagatcgag tgggagctgcagaaggaaaacagcaagcgctggaacccggagatccagtacacttccaactattacaagtctaata atgttgaatttgctgttaatactgaaggtgtatatagtgaaccccgccccattggcaccagatacctgactcgtaa tctgtaa (SEQ ID NO: 11 )Pharmaceutical compositions

[0151] Any one of the nucleic acids, vectors, or AAV particles described herein may be comprised within a pharmaceutical composition comprising a pharmaceutically-acceptable carrier or may be comprised within a pharmaceutically-acceptable carrier. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which t nucleic acids, vectors, or AAV particles described herein is comprised or administered to a subject. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum oil such as mineral oil, vegetable oil such as peanut oil, soybean oil, and sesame oil, animal oil, or oil of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers. Non-limiting examples of pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, polyacrylic acids, lubricating agents (such as talc, magnesium stearate, and mineral oil), wetting agents, emulsifying agents, suspending agents, preserving agents (such as methyl-, ethyl-, and propyl-hydroxy-benzoates), and pH adjusting agents (such as inorganic and organic acids and bases), and solutions or compositions thereof. Other examples of carriers include phosphate buffered saline, HEPES-buffered saline, and water for injection, any of which may be optionally combined with one or more of calcium chloride34#14580236vlAttorney Docket No. U1197.70256WO00dihydrate, disodium phosphate anhydrous, magnesium chloride hexahydrate, potassium chloride, potassium dihydrogen phosphate, sodium chloride, or sucrose. Other examples of carriers that might be used include saline (e.g., sterilized, pyrogen-free saline), saline buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, polypeptides (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of AAV particles to human subjects.

[0152] Typically, such compositions may contain at least about 0.1% of the therapeutic agent (e.g., nucleic acid, vector, or AAV particle described) or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of therapeutic agent(s) (e.g., nucleic acid, vector, or AAV particle described herein) in each therapeutically-useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be designed.

[0153] Pharmaceutical compositions as disclosed herein, e.g., comprising nucleic acids, vectors, or AAV particles described herein can be prepared by one of ordinary skill in the art by known methods.Methods of contacting a cell

[0154] According to some aspects, provided are methods of contacting a cell with a nucleic acid, vector, or AAV particle described herein. Methods of contacting a cell may comprise, for example, contacting a cell in a culture with a composition comprising a nucleic acid, vector, or AAV particle described herein. In some aspects, contacting a cell comprises adding a composition comprising a nucleic acid, vector, or AAV particle described herein to the supernatant of a cell culture (e.g., a cell culture on a tissue culture plate or dish) or mixing a composition comprising a nucleic acid, vector, or AAV particle described herein with a cell culture (e.g., a suspension cell culture). In some aspects, contacting a cell comprises mixing a composition comprising a nucleic acid, vector, or AAV particle described herein with another solution, such as a cell culture media, and incubating a cell with the mixture.35#14580236vlAttorney Docket No. U1197.70256WO00

[0155] In some aspects, contacting a cell with a nucleic acid, vector, or AAV particle described herein comprises administering a composition comprising a nucleic acid, vector, or AAV particle described herein to a subject or device in which the cell is located. In some aspects, contacting a cell comprises injecting a composition comprising a nucleic acid, vector, or AAV particle described herein into a subject in which the cell is located. In some aspects, contacting a cell comprises administering a composition comprising a nucleic acid, vector, or AAV particle described herein directly to a cell, or into or substantially adjacent to a tissue of a subject in which the cell is present.Methods of treatment

[0156] In some aspects, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful. In some aspects, a nucleic acid as described herein is administered to a subject in need thereof, e.g., a subject having a carcinoma a manner that is pharmacologically useful. In some aspects, a subject has an enteric carcinoma and a nucleic acid, vector, or AAV particle described herein is administered to a subject enterally. In some aspects, an enteral administration of a nucleic acid, vector, or AAV particle described herein is oral. In some aspects, a subject has an enteric carcinoma and a nucleic acid, vector, or AAV particle described herein is administered to a subject by endoscopic administration to a carcinoma site. In some aspects, a nucleic acid, vector, or AAV particle described herein is administered to a subject parenterally. In some aspects, a nucleic acid, vector, or AAV particle described herein is administered to a subject subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intracisternally, intraperitoneally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs, e.g., intra-carcinoma injection. In some aspects, a nucleic acid, vector, or AAV particle described herein is administered to a subject by injection into a cell, tissue, or organ at a location adjacent to a tumor, e.g., a carcinoma (e.g., breast carcinoma). In some aspects, a nucleic acid, vector, or AAV particle described herein is administered to the subject by injection into an artery that provides blood supply to a tumor, e.g., a carcinoma or a tissue and / or organ that comprises a tumor, e.g., a carcinoma or carcinoma cells.

[0157] In some aspects, a composition comprising a nucleic acid, vector, or AAV particle described herein is administered to a subject to treat a disease, e.g., a carcinoma. To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease, e.g., a carcinoma of a subject. The compositions described above 36#14580236vlAttorney Docket No. U1197.70256WO00or elsewhere herein are typically administered to a subject in an effective amount, that is, an amount capable of producing a desirable result. The desirable result will depend upon the active agent being administered. For example, an effective amount of a nucleic acid, vector, or AAV particle described herein may be an amount that is capable of transferring a nucleic acid, vector, or AAV particle described herein to a host organ, e.g., an organ comprising a carcinoma, a tissue, e.g., a tissue comprising carcinoma cells, or a cell, e.g., a carcinoma cell. A therapeutically acceptable amount may be an amount that is capable of treating a disease, e.g., a carcinoma. As is well known in the medical and veterinary arts, dosage for any one subject depends on many factors, including the subject's size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently.

[0158] In some aspects, a composition comprising a nucleic acid, vector, or AAV particle described herein is administered to a subject as a neoadjuvant or as a combination therapy. In some aspects, a composition comprising a nucleic acid, vector, or AAV particle described herein is administered to a subject prior to and / or concurrently with and / or after a primary cancer treatment. In some aspects, the primary cancer treatment is an immune checkpoint inhibitor treatment. In some aspects, the immune checkpoint inhibitor is an antibody (e.g., a monoclonal antibody) or antigen-binding fragment thereof that binds (e.g., preferentially binds) and inhibits PD-1, PD-L1, PD-L2, TIGIT, TIM3, LAG3, and / or CTLA4. In some aspects, the primary cancer therapy further or alternatively comprises chemotherapy, radiotherapy, immunotherapy, or any combination thereof.

[0159] In some aspects, a cell disclosed herein is a cell, e.g., a carcinoma cell isolated or derived from a subject. In some aspects, a cell is a mammalian carcinoma cell (e.g., a cell isolated or derived from a carcinoma present in a mammal). In some aspects, a cell is in vitro. In some aspects, a cell is ex vivo. In some aspects, a cell in in vivo. In some aspects, a cell is within a subject (e.g., within a tissue or organ of a subject). In some aspects, a cell is a primary cell. In some aspects, a cell is from a cell line (e.g., an immortalized cell line). In some aspects a cell is a cancer cell, e.g., a carcinoma cell or an immortalized cell.

[0160] In some aspects, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful.

[0161] In some aspects, provided is a method of treating a carcinoma, the method comprising administering a composition comprising AAV particles described herein to a subject. In some aspects, a concentration of AAV particles in the composition may be on the order ranging from 106to 1014particles / ml or 103to 1015particles / ml, or any values therebetween for either range,37#14580236vlAttorney Docket No. U1197.70256WO00such as for example, about 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014particles / ml. In some aspects, a method comprises administering a composition comprising AAV particles of a higher concentration than 1013particles / ml. In some aspects, a method comprises administering AAV particles described herein to a subject at a concentration ranging from 106to 1014vector genomes (vgs) / ml or 103to 1015vgs / ml, or any values therebetween for either range (e.g., 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014vgs / ml). The AAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease, e.g., treat a carcinoma. In some aspects, 0.0001 ml to 10 ml are delivered to a subject, e.g., by parenteral administration. In some aspects, 0.0001 ml to 10 ml are delivered to a subject, e.g., by intra-carcinoma administration. In some aspects, the number of AAV particles administered to a subject may be on the order ranging from 106- 1014vgs / kg body mass of the subject, or any values therebetween (e.g., 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014vgs / kg). In some aspects, the dose of AAV particles administered to a subject may be on the order ranging from 1012-1014vgs / kg.

[0162] In some aspects, a composition disclosed herein (e.g., comprising a nucleic acid, vector or an AAV particle) is administered to a subject once. In some aspects, the composition is administered to a subject multiple times (e.g., twice, three times, four times, five times, six times, or more). Repeated administration to a subject may be conducted at a regular interval (e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently) as necessary to treat (e.g., improve or alleviate) one or more symptoms of a disease, e.g., a carcinoma in the subject.Subjects

[0163] Aspects of the disclosure relate to methods for use with a subject, such as human or non-human primate subjects; with a host cell in situ in a subject; or with a host cell derived from a subject (e.g., ex vivo or in vitro). Non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. In some aspects, the subject is a human subject. Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.

[0164] In some aspects, the subject has or is suspected of having a disease, e.g., a cancer that may be treated with gene therapy. In some aspects, a subject has a cancer of epithelial cell origin, e.g., carcinoma. In some aspects, a subject has a cancer of mesenchymal cells. In some38#14580236vlAttorney Docket No. U1197.70256WO00aspects, a subject has a melanoma. In some aspects, a subject has a glioblastoma. In some aspects, a subject has prostate cancer. In some aspects, a subject has a breast cancer. In some aspects, the breast cancer is triple negative breast cancer (e.g., the cancer cells are negative for ER, PR, and HER2). In some aspects, the breast cancer is estrogen receptor (ER)-positive cancer, progesterone receptor (PR)-positive, and / or HER2-positive cancer or any combination thereof. Cancer can be characterized and identified, e.g., through laboratory tests and / or evaluation by a clinician. In some aspects, the subject has or is suspected of having a carcinoma (e.g., based on an imaging study and / or a biopsy and histological evaluation of a cancer tissue. In some aspects, a nucleic acid isolated or derived from the subject (e.g., genomic DNA, mRNA, or cDNA from the subject) is identified via sequencing (e.g., Sanger or next-generation sequencing) to comprise a mutation (e.g., in a gene associated with development of cancer, e.g., a carcinoma).

[0165] In some aspects, a subject has been determined to have cancer. In some aspects, a subject has been determined to have a carcinoma. In some aspects, a subject has been determined to have a breast cancer. In some aspects, a subject has been determined to have a melanoma. In some aspects, a subject has been determined to have a glioblastoma. In some aspects, a subject has been determined to have prostate cancer.EXAMPLESExample 1. Materials and MethodsGeneration of AAV constructs

[0166] Human KRT80 and SFN promoters were amplified from human genomic DNA by PCR using Q5 High Fidelity DNA Polymerase, purified, double-digested with restriction enzymes Xbal and BamHI, and cloned into the pscAAV-CAG-GFP vector (pre-digested with restriction enzymes Avril and BamHI), generating AAV-KRT80-GFP and AAV-SFN-GFP, respectively.

[0167] cDNAs encoding human MLKL (aa 1-180, aa 1-190) and GSDMD (aa 1-245) were PCR-amplified using Q5 High Fidelity DNA Polymerase, purified, double-digested with BamHI and Notl, and cloned into AAV-KRT80-GFP and AAV-SFN-GFP (both pre-digested with BamHI and Notl), generating AAV-KRT80-MLKL180, AAV-KRT80-MLKL190, AAV-KRT80-GSDMD245; and AAV-SFN-MLKL180, AAV-SFN-MLKL190, AAV-SFN-GSDMD245.AAV Packaging and Purification39#14580236vlAttorney Docket No. U1197.70256WO00

[0168] AAV packaging was done following AAV Production in HEK293T Cells Addgene. Plasmid pscAAV-CAG-GFP was purchased from Addgene (Addgene, Cat # 83279, USA); pHelper plasmid and pRepCap / pACG2 plasmid were provided by Dr. Arun Srivastava.

[0169] HEK293T cells were seeded onto 15 10-cm plates at 70% confluency. The amount of each plasmid was calculated using the following Transfection Calculator (need to have a 1: 1: 1 molar ratio):

[0170] Table 1:Plasmid Name Length (bp) Concentration (ug / uL) Volume of DNA (uL) pHelper 11,854 1.0 1,185pRepCap 7,265 1.0 727.6pAAV-Transgene 5,842 1.0 584.2

[0171] Plasmids were transfected using Polyethylenimine (PEI) and corresponding plasmids in serum-free DMEM. HEK293T was incubated for 8-hours before the media was changed with fresh complete DMEM and incubated for 72 hours. Following incubation, cells and supernatant were harvested and lysed. The resulting lysate was then used for AAV purification by lodixanol Gradient Ultracentrifugation following AddGene protocol.AAV qPCR Titration

[0172] AAV Titration was done following AAV Titration by qPCR Using SYBR Green Technology Protocol from AddGene. This protocol follows a dilution series of both plasmid standard and virus to determine the amount of viral particles present per mL. Dilution series of virus is shown below:

[0173] Table 2. Dilution Series of AAVDilution Volume of Sample Volume of Nuclease Dilution Total Dilution (uL) Free Water (uL) Factor1 5 45 10X 10X2 5 95 20X 200X 3 20 80 5X 1000X 4 20 80 5X 5000X 5 20 80 5X 25000X 6 20 80 5X 125000X 7 20 80 5X 625000XTable 3. Primers used for qPCR Titering.Primers Sequence (5' to 3')ITR F GGA ACC CCT AGT GAT GGA GTT (SEQ. ID NO: 12)R CGG CCT CAG TGA GCG A (SEQ ID NO: 13)#14580236vlAttorney Docket No. U1197.70256WO00Cytotoxicity Assay

[0174] MCF7 cells were seeded onto 12- well tissue culture plates. The following day, the cells were transduced with MOI 1.0 of virus for 48-hours. Subsequently, cytotoxicity was determined by propidium iodide staining and measurement of extracellular ATP levels using the ATPlitelstep kit (Revvity Inc., USA.)Example 2 - Plasmid Transfections

[0175] AAV plasmids containing cancer-specific promoters (Krt80 & SFN), green fluorescent polypeptide (GFP) reporter, or cytotoxic forms of immunogenic cell death executioners a Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) and gasdermin D (GSDMD) were generated (see FIG. 1).

[0176] Promoters that transduce carcinoma cells were identified. HEK293 cells were transiently transfected with five indicated gene promoters linked to the GFP reporter. No GFP expression was observed (FIG. 2A). In contrast, fluorescence microscopy images of MCF7 human breast cancer cells transiently transfected with the five indicated gene promoters linked to the GFP reporter demonstrated GFP expression from the SFN promoter and the Krt80 promoter, respectively (FIG. 2B). These results showed cancer- specific (epithelial-specific) promoter activity in breast carcinoma cells.

[0177] Next, the cytotoxicity of N-terminal domains of MLKL (540 nucleotides and 570 nucleotides, respectively) and GSDMD (735 nucleotides) was evaluated. HEK293 cells and MCF7 cells were transfected with MLKL and GSDMD driven by the constitutive / ubiquitous CMV promoter. GFP was co-transfected to monitor transfection efficiency. Cells were subsequently stained with propidium iodide (PI) that labels dying / dead cells. The CMV promoter drove expression of MLKL or GSDMD in both HEK293 and MCF7 cells, and consequently caused cell death in both cell lines as indicated by increased PI signals (circled) (FIGs. 3A, 3B). Cell death also decreased GFP signals.

[0178] Next, promoters that are active in hormone receptor-positive (HR+) breast cancer cells but inactive in virus-packaging cells (e.g., HEK293) were identified. RNA-seq gene expression data of HR+ breast cancer cells (MCF7 and T47D) and virus-packaging HEK293 cells was analyzed. Among the top 50 differentially expressed genes, EHF, GRHL2, KRT80, SFN, and VTCN1 were initially selected, as they are not expressed in HEK293 cells, but highly expressed in breast cancer cells. The ENCODE epigenomics data at these genes (e.g., histone marks, cis elements, sequence conservation) was then examined to identify putative41#14580236vlAttorney Docket No. U1197.70256WO00enhancers / regulatory elements. The genomic regions containing putative enhancers / promoters of each gene by PCR and fused the genomic fragments to the GFP reporter were isolated, and the reporter constructs were transfected into MCF7 and HEK293 cells. The promoters of KRT80 and SFN were found to be active in MCF7 cells but inactive in HEK293 cells (data not shown). Based on DepMap gene expression in human cancer cells, KRT80 and SFN are not only expressed in HR+ breast cancer cells but also other subtypes including triple negative breast cancer (TNBC), as well as in a wide variety of other types of carcinoma cells. Analysis of TCGA tumor datasets revealed that KRT80 and SFN often exhibit higher expression in cancers than in corresponding normal tissues.

[0179] Expression of MLKL and GSDMD under cancer-specific promoters was tested to determine the cell type selective cytotoxicity of KRT80 / SFN-driven GSDMD and MLKL. To verify if the KRT80 and SFN promoters could drive the expression of cytotoxic ICD inducers in a cell type- selective manner, they were fused to GSDMD (amino acids 1-245) and MLKL (amino acids 1-180 or 1-190), and transiently transfected into HEK293 and MCF7 cells. For the KRT80 promoter, in HEK293 cells, strong GFP expression indicated efficient transfection, and the lack of PI staining indicated no cell death (circled) (FIG. 4A). In contrast, in MCF7 cells, MLKL and GSDMD induced PI staining (circled) and diminished GFP signals, indicating cell death (FIG. 4B). The results confirmed that the KRT80 promoter was active selectively in MCF7 cells and could drive sufficient expression of MLKL / GSDMD to induce cell death. SFN-driven MLKL and GSDMD were also tested for induction of cell death. In HEK293 cells, strong GFP expression indicated efficient transfection, and the lack of PI staining indicated no cell death (circled) (FIG. 5A). In contrast, in MCF7 cells, MLKL and GSDMD induced PI staining (circled) and diminished GFP signals, indicating substantial cell death (FIG. 5B). The results confirmed that the SFN promoter was active selectively in MCF7 cells and could drive sufficient expression of MLKL / GSDMD to induce cell death.Example 3 - AAV Transductions

[0180] Adeno-associated virus (AAV) viruses were packaged by triple transfection (BioRender). Briefly, GFP (as a reporter / control); the transgene (GSDMD (aa 1-245), MLKL (aa 1-180 or 1-190)) under the KRT80 or SFN promoter was cloned in AAV vectors. Due to the small sizes of the promoters and genes, these constructs were made in a self-complementary AAV (scAAV) vector, which is more efficient in AAV packaging. The pAAV-transgene plasmids depicted in FIG. 1 were packaged into AAV2 capsids, as AAV2 is a serotype that can infect various breast cancer cells. Plasmids KRT80 / SFN-promoter- 42#14580236vlAttorney Docket No. U1197.70256WO00MLKL / GSDMD and the indicated packaging plasmids were transfected into HEK293 packaging cells. AAV particles were harvested and purified by ultracentrifugation of iodixanol gradients. AAV titration by qPCR using SYBR green was used to determine the number of transgene-containing particles. As proof of concept that the constructs were non-cytotoxic in virus packaging cells, it is noted that high-titer AAV viruses were produced (Table 1).Table 1. AAV Titration by qPCR using SYBR green. ( - = in progress)Virus Titer (vg / mL)AAV2-CAG-GFP 1.50 x 1010AAV2-Krt80-GFP 1.35 x 1013AAV2-SFN-GFP 1.22 x 109AAV2-Krt80-MLKL 180 8.59 x 109AAV2-SFN-MLKL 180 - AAV2-Krt80-MLKL 190 - AAV2- SFN-MLKL 190 - AAV2-Krt80-GSDMD 245 6.71X108AAV-SFN-GSDMD 245 2.51X1011

[0181] AAV2 carrying KRT80 / SFN-driven GFP could infect MCF7 cells and selectively express GFP in MCF7 and MDA-MB-231 cells (FIGs. 7A-7C). Fluorescence microscopy of HEK293 cells 3 days after infection with AAV2 viruses carrying the GFP reporter driven by a ubiquitous CAG promoter or breast cancer-specific KRT80 / SFN promoters showed no GFP expression (FIG. 7A). In contrast, fluorescence microscopy of MCF7 cells 3 days after infection with AAV2 viruses carrying the GFP reporter driven by the ubiquitous CAG promoter or breast cancer-specific KRT80 / SFN promoters demonstrated GFP expression (FIG. 7B). Similarly, fluorescence microscopy of MDA-MB-231 cells 3 days after infection with AAV2 viruses carrying the GFP reporter driven by the ubiquitous CAG promoter or cancer-specific KRT80 / SFN promoters demonstrated GFP expression (FIG. 7C). CAG-driven GFP was expressed all three cell lines, whereas KRT80- or SFN-driven GFP was expressed only in MCF7 and MDA-MB-231 cells but not in HEK293 cells (circled in FIGs. 7A, 7B).

[0182] AAV2 carrying breast cancer- specific promoter KRT80 or SFN-driven MLKL / GSDMD selectively induced cell death in MCF7 cells but not in HEK293 cells 48 hours after infection. AAV2-Krt80-MLKL, AAV2-Krt80-GSDMD, AAV2-SFN-MLKL, and AAV2-SFN-GSDMD viruses were used to infect HEK293 and MCF7 cells and induction of cell death only in MCF7 but not in HEK293 cells (circled) was observed (FIGs. 8A, 8B).

[0183] This finding was further explored. HEK293, MCF7, and MDA-MB-231 cells were infected with AAV2 viruses carrying KRT80- or SFN-driven GSDMD or MLKL. As lytic cell43#14580236vlAttorney Docket No. U1197.70256WO00death releases cytosolic lactate dehydrogenase (LDH), extracellular LDH levels (in supernatants) was measured to monitor cell lysis. Supernatants were collected three days postinfection and subjected to an LDH assay. It was found that infection by these AAV2 viruses resulted in cell lysis selectively in breast cancer cells but not in HEK293 cells (FIG. 10).

[0184] ATP is one of the DAMPs. Release of ATP into extracellular space indicates cell lysis and immunogenic cell death. Media supernatants were collected 48-hr post transduction for ATP measurement (n=6). Extracellular ATP was not released from HEK293 cells transduced with AAV2-Krt80-MLKL, AAV2-Krt80-GSDMD, AAV2-SFN-MLKL, or AAV2-SFN-GSDMD viruses (FIG. 9A). However, substantial levels of ATP were released from MCF7 cells transduced with AAV2-Krt80-MLKL, AAV2-Krt80-GSDMD, AAV2-SFN-MLKL, or AAV2-SFN-GSDMD viruses (FIG. 9B). The highest amounts of ATP release were observed in MCF7 cells infected with KRT80-driven GSDMD and SFN-driven GSDMD.

[0185] In a further experiment, extracellular ATP levels in HEK293, MCF7, and MDA-MB-231 cells infected with AAV2 viruses carrying KRT80- or SFN-driven GSDMD or MLKL were measured. Supernatants were collected three days post-infection and analyzed for ATP. The results are shown in FIG. 11 and demonstrate that the AAV2 viruses caused ATP release in breast cancer cells (especially the MDA-MB-231 cells), but not in HEK293 cells.EQUIVALENTS AND SCOPE

[0186] While several inventive aspects have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive aspects described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive aspects described herein. It is, therefore, to be understood that the foregoing aspects are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive aspects may be practiced otherwise than as specifically described and claimed.Inventive aspects of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or 44#14580236vlAttorney Docket No. U1197.70256WO00more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0187] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0188] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0189] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0190] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one aspect, to A only (optionally including elements other than B); in another aspect, to B only (optionally including elements other than A); in yet another aspect, to both A and B (optionally including other elements); etc.

[0191] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.45#14580236vlAttorney Docket No. U1197.70256WO00

[0192] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one aspect, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another aspect, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another aspect, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0193] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0194] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that aspects described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative aspects, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure also contemplates the alternative aspects “a composition consisting of A and B” and “a composition consisting essentially of A and B.”46#14580236vl

Claims

Attorney Docket No. U1197.70256US00CLAIMSWhat is claimed is:

1. A nucleic acid comprising a nucleotide sequence encoding a N-terminal domain of a gasdermin D (GSDMD) protein operably linked to cancer- specific promoter.

2. A nucleic acid comprising a nucleotide sequence encoding a N-terminal domain of a Mixed lineage kinase domain like pseudokinase (MLKL) protein operably linked to cancerspecific promoter.

3. The nucleic acid of claim 1 or 2, wherein the cancer- specific promoter is a Keratin 80 (Krt80) promoter or a Stratifin (SFN) promoter.

4. The nucleic acid of claim 1, wherein the N-terminal domain of GSDMD comprises between about 100 and about 250 amino acids, e.g., about 241 amino acids.

5. The nucleic acid of claim 2, wherein the N-terminal domain of MLKL comprises between about 100 amino acids and about 250 amino acids, e.g., 125 amino acids.

6. The nucleic acid of any one of claims 3-5, wherein the Krt80 promoter comprises about 920 nucleotides, e.g., 902 nucleotides.

7. The nucleic acid of any one of claims 3-5, wherein the SFN promoter comprises about 1300 nucleotides, e.g., 1243 nucleotides.

8. The nucleic acid of any one of claims 1-7, further comprising an inverted terminal repeat (ITR).

9. The nucleic acid of claim 8, wherein the inverted terminal repeat is an adeno-associated virus (AAV) inverted terminal repeat.

10. The nucleic acid of claim 8, wherein the inverted terminal repeat is an adenovirus (Ad) inverted terminal repeat.47#14580236v1Attorney Docket No. U1197.70256US0011. The nucleic acid of any one of claims 8-10, wherein the nucleotide sequence encoding a N-terminal domain of GSDMD operably linked to a cancer-specific promoter and / or the nucleotide sequence encoding a N-terminal domain of MLKL operably linked to a cancerspecific promoter are flanked by two ITRs.

12. The nucleic acid of claim 11, wherein the two ITRs are AAV ITRs.

13. The nucleic acid of claim 11, wherein the two ITRs are Ad ITRs.

14. The nucleic acid of any one of claims 1-13, further comprising a long terminal repeat (LTR).

15. The nucleic acid of claim 14, wherein the LTR is a lenti virus LTR.

16. The nucleic acid of claim 14, wherein the LTR is a retrovirus LTR.

17. The nucleic acid of any one of claims 14-16, wherein the nucleotide sequence encoding a N-terminal domain of GSDMD operably linked to a cancer- specific promoter and / or the nucleotide sequence encoding a N-terminal domain of MLKL operably linked to a cancer-specific promoter are flanked by two LTRs.

18. The nucleic acid of claim 17, wherein the two LTRs are lentivirus LTRs.

19. The nucleic acid of claim 17, wherein the two LTRs are retrovirus LTRs.

20. A vector comprising a nucleic acid of any one of claims 1-19.

21. A viral particle comprising a nucleic acid of any one of claims 1-19 or a vector of claim 20.

22. The viral particle of claim 21, further comprising a viral capsid protein.48#14580236v1Attorney Docket No. U1197.70256US0023. The viral particle of claim 22, wherein the viral capsid protein is an AAV capsid protein.

24. The viral particle of claim 22, wherein the viral capsid protein is an Ad capsid protein.

25. The viral particle of claim 22, wherein the viral capsid protein is a lentivirus envelope protein.

26. The viral particle of claim 22, wherein the viral capsid protein is a retrovirus envelope protein.

27. A composition comprising the nucleic acid of any one of claims 1-19, the vector of claim 20, or the viral particle of any one of claims 21-26.

28. A composition comprising the nucleic acid of any one of claims 1-19 or the vector of claim 20, further comprising a lipid.

29. The composition of claim 28, wherein the lipid is an ionizable lipid, a phospholipid, a sterol, a PEG-lipid, or combinations thereof.

30. A nanoparticle comprising the nucleic acid of any one of claims 1-19 or the vector of claim 20.

31. A method for producing a viral particle, the method comprising:co-expressing the nucleic acid of any one of claims 1-19 or the vector of claim 20 in a cell with a nucleic acid encoding a packaging cassette, the packaging cassette comprising at least one nucleotide sequence encoding a replication protein and at least one nucleotide sequence encoding a capsid protein or an envelope protein.

32. The method of claim 31, wherein the at least one replication polypeptide is an AAV replication protein and the at least one capsid protein is an AAV capsid protein.

33. The method of claim 31, wherein the at least one replication polypeptide is an Ad replication protein and the at least one capsid protein is an Ad capsid protein.49#14580236v1Attorney Docket No. U1197.70256US0034. The method of claim 31, wherein the at least one replication protein is a lentivirus Gag polypeptide, lentivirus Pol polypeptide, lentivirus Rev polypeptide, lentivirus Tat polypeptide, or combinations thereof; and the at least one capsid protein is a lentivirus envelope (Env) polypeptide.

35. The method of claim 31, wherein the at least one replication protein is a retrovirus Gag polypeptide, retrovirus Pol polypeptide or a combination thereof; and the at least one capsid protein is a retrovirus envelope (Env) polypeptide.

36. A method for producing a lipid nanoparticle, the method comprising:mixing the nucleic acid of any one of claims 1-19 or the vector of claim 20 with a lipid solution, the lipid solution comprising an ionizable lipid, a phospholipid, a sterol, a PEG-lipid, or combinations thereof.

37. A method of contacting a cell, the method comprising contacting the cell with the nucleic acid of any one of claims 1-19, the vector of claim 20, the viral particle of any one of claims 21-26, the composition of any one of claims 27-29, or the nanoparticle of claim 30.

38. The method of claim 37, wherein the cell is a carcinoma cell.

39. The method of claim 38, wherein the carcinoma cell is a breast carcinoma cell.

40. A method of inducing immunogenic cell death in a cell, the method comprising contacting the cell with the nucleic acid of any one of claims 1-19, the vector of claim 20, the viral particle of any one of claims 21-26, the composition of any one of claims 27-29, or the nanoparticle of claim 30.

41. The method of claim 40, wherein the cell is a carcinoma cell.

42. The method of claim 41, wherein the carcinoma cell is a breast carcinoma cell.

43. A method of inducing release of tumor antigens from a tumor cell, the method comprising contacting a tumor cell with the nucleic acid of any one of claims 1-19, the vector 50#14580236v1Attorney Docket No. U1197.70256US00of claim 20, the viral particle of any one of claims 21-26, the composition of any one of claims 27-29, or the nanoparticle of claim 30.

44. The method of claim 43, wherein the tumor cell is a carcinoma cell.

45. The method of claim 44, wherein the carcinoma cell is a breast carcinoma cell.

46. A method of treating cancer in a subject, the method comprising administering to a subject in need thereof the nucleic acid of any one of claims 1-19, the vector of claim 20, the viral particle of any one of claims 21-26, the composition of any one of claims 27-29, or the nanoparticle of claim 30.

47. The method of claim 46, further comprising administering to the subject an immune checkpoint therapy.

48. The method of claim 46 or 47, wherein the subject has a carcinoma.

49. The method of claim 48, wherein the carcinoma is a breast carcinoma.51#14580236v1

Images