Construction and Application of a Lactose or Its Analogue Biosensor Screening System in Bacillus subtilis

Abstract

The present invention discloses the construction and application of a screening system for lactose or its analog biosensors in Bacillus subtilis. The present invention designs a "dual-screening" biosensor repressor screening gene circuit based on the lactose operon and applicable to Bacillus subtilis: the DNA binding activity of the repressor is screened through a negative screening lethal circuit; the allosteric activation activity is screened through a positive screening fluorescence signal; and finally, a biosensor with the recognition activity of the target lactose analog is obtained. Using this screening platform, novel biosensors responsive to substances such as lactose, 2'-fucosyllactose, and 3-fucosyllactose can be obtained. Moreover, it has been verified that the biosensors constructed according to the screening results of the present invention have high detection sensitivity and specificity.

Description

Technical Field

[0001] The present invention relates to the construction and application of a lactose or its analog biosensor screening system in Bacillus subtilis, belonging to the technical fields of synthetic biology and metabolic engineering. Background Art

[0002] In 1961, Monod and Jacob from the Pasteur Institute in France discovered that Escherichia coli could determine whether to produce enzymes related to lactose metabolism based on the presence or absence of glucose and lactose in the environment. Through the study of the above phenomenon, they proposed the concepts of operon and operator gene. After the concept of lactose operon was proposed, researchers successively discovered various operons such as tryptophan operon, histidine operon, and arabinose operon. The regulatory effect of operons on genes enables microorganisms to turn on or off the expression of certain genes according to changes in the external environment, so that when specific metabolites are needed, the required enzymes and metabolites can be rapidly synthesized, while the synthesis of other types of metabolites is stopped. Facing the rapidly changing complex external environment, this regulatory mechanism is indispensable for organisms, and the existence of operons endows organisms with stronger adaptability in the ever-changing external environment.

[0003] Researchers have developed a variety of metabolite biosensors using various operon elements as models. When the target metabolite is present, the metabolite biosensor can achieve response characteristics by changing the conformation of proteins and can convert the target metabolite concentration signal into fluorescence signals, growth rate signals, metabolic pathway signals, etc. In recent years, metabolite biosensors have played a huge role in the construction of microbial cell factories. At the same time, with the expansion of the application scope, complex application conditions have put forward higher requirements for factors such as the metabolite recognition range, molecular response level, and signal output intensity of biosensors. However, most of the currently used biosensors are mainly natural metabolite biosensors developed based on biological elements in nature that respond to a certain metabolite. The above situation has led to the inability of natural metabolite biosensors to meet the requirements of responding to multiple new metabolites.

[0004] To expand the application scope of metabolite biosensors, it is necessary to change the response target of natural metabolite sensing elements. Generally, it is difficult to change the inducer specificity of these biosensor response proteins because changing the inducer specificity may destroy their original allosteric properties, ultimately affecting their binding effect with specific gene elements and causing the entire system to fail and become unusable. Therefore, in order to increase the response range of biosensors to make them respond to different metabolites or inducer types and thus be used in a wider range, it is necessary to develop a rapid, accurate, and efficient screening platform for screening biosensors that respond to target substances. Summary of the Invention

[0005] To solve the above problems, the present invention provides a method for constructing a screening platform for lactose or its analog biosensors in Bacillus subtilis and its applications. The screening platform consists of a DNA-binding transcriptional repressor LacI expression cassette, a screening system gene circuit expression cassette (IPTG-inducible promoter, reporter gene, suicide gene), and gene expression elements such as promoters, RBSs, and terminators required for the above gene expression. The above screening platform can be constructed in a plasmid vector and transformed into the cytoplasm of Bacillus subtilis for use or integrated into the genome of Bacillus subtilis for use to achieve the screening of biosensors or their components.

[0006] The first object of the present invention is to provide a method for screening lactose or its analog biosensors, comprising the following steps:

[0007] S1. Construct a mutant library of DNA-binding transcriptional repressor LacI;

[0008] S2. Construct a recombinant cell library containing different DNA-binding transcriptional repressor LacI mutant gene expression cassettes and screening system gene circuit expression cassettes; the screening system gene circuit expression cassette contains an inducible promoter, a reporter gene, and a suicide gene;

[0009] S3. Negative screening: Culture the recombinant cell library obtained in S2 to express the DNA-binding transcriptional repressor LacI mutant and the genes in the screening system gene circuit expression cassette, and then transfer the recombinant cell library to a first culture medium for culture to screen out viable cells; the first culture medium contains a non-cytotoxic prodrug, and the protein encoded by the suicide gene can convert the non-cytotoxic prodrug into a cytotoxic active drug;

[0010] S4. Positive screening: Transfer the viable cells in S3 to a second culture medium for culture, and screen the cells according to the signal intensity of the reporter gene to obtain the target biosensor; the second culture medium contains lactose or its analog.

[0011] Further, the host cell of the recombinant cell library can select a suitable microbial cell according to the type of biosensor, such as common Bacillus subtilis, Escherichia coli, etc.

[0012] Further, in step S1, the methods for constructing the mutant library include saturation mutation and / or random mutation.

[0013] Further, in step S2, the DNA-binding transcriptional repressor LacI mutant gene expression cassette is any DNA sequence capable of transcribing and translating to produce a DNA-binding transcriptional repressor LacI mutant, which not only contains the LacI mutant coding gene, but also contains expression elements such as promoters, RBSs, and terminators required for the expression of this gene. For example, the expression cassette sequence includes but is not limited to the sequence set forth in SEQ ID NO.9.

[0014] Further, the promoter for initiating the expression of the DNA-binding transcriptional repressor LacI mutant gene is preferably a constitutive promoter, and the specific selection can be made according to the host cell, with relatively low expression or no leaky expression in the target host being appropriate (no leakage is optimal).

[0015] Further, in step S2, the screening system gene circuit expression cassette is integrated or free-expressed, and the DNA-binding transcriptional repressor LacI mutant gene expression cassette is free-expressed.

[0016] Further, in step S2, the reporter gene can be any gene that can directly or indirectly detect the signal of its encoded product. The types of reporter genes include but are not limited to emitting fluorescence without a substrate (such as a fluorescent protein gene), interacting with a radioactive or fluorescent substrate (such as luciferase), etc.

[0017] Further, the fluorescent protein genes include: green fluorescent protein gene, yellow fluorescent protein gene, red fluorescent protein gene, deep red fluorescent protein gene, near-infrared fluorescent protein gene, orange fluorescent protein gene, cyan fluorescent protein gene, blue fluorescent protein gene, dark blue fluorescent protein gene, etc., as well as mutant genes of the above fluorescent proteins or fluorescent protein genes derived by modification. For example, sfGFP with an amino acid sequence as shown in SEQ ID NO.3 or eGFP with an amino acid sequence as shown in SEQ ID NO.4.

[0018] Further, in step S2, the suicide gene can be a thymidine kinase gene (hsvTK), a cytosine deaminase gene (CD), etc. Correspondingly, the non-cytotoxic prodrugs selected in step S3 are 5-fluoro-2'-deoxyuridine (5FdU), 5-fluorocytosine (5-FC), etc. Among them, 5FdU generates a toxic substance, 5-fluoro-2'-deoxyuridine-5'-monophosphate (5FdUMP), under the action of thymidine kinase; 5-FC is metabolized into 5-fluorouracil in microorganisms, causing cell death.

[0019] Further, in step S2, the fluorescent protein gene is linked to the Herpes simplex virus thymidine kinase (hsvTK) gene through a flexible linker, that is, the screening platform gene circuit expression cassette is composed of an inducible promoter controlling a reporter gene, a tandem fusion protein linker (Linker), and a suicide gene in series. The amino acid sequence of the flexible linker can be any of those shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0020] Further, in step S3, the addition concentration of the non-toxic drug precursor in the first culture medium is 1 nM to 1000 mM.

[0021] Further, in step S4, the lactose analogs include, but are not limited to, 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), etc.

[0022] Further, in step S4, the addition concentration of the lactose or its analog in the second culture medium is 1 nM to 1000 mM.

[0023] Further, in step S4, screening cells according to the reporter gene signal intensity means that when the reporter gene is a fluorescent protein gene, cells with higher fluorescence intensity (as long as there is a fluorescent signal, which can reach the original signal or exceed the best) are selected as the target cell biosensors.

[0024] Further, in step S4, the methods for screening cells include, but are not limited to, flow cytometry screening method, microfluidic screening method, plate coating screening method, or liquid medium culture screening method, etc.

[0025] Further, after step S4, if necessary, it also includes a method for sequencing the LacI mutant in the target cells as an element for preparing the biosensor.

[0026] The second object of the present invention is to provide a screening system for a lactose or its analog biosensor, and the screening system includes:

[0027] A recombinant cell library containing a DNA-binding transcriptional repressor LacI mutant library gene expression cassette and a screening system gene circuit expression cassette; the screening system gene circuit expression cassette contains an inducible promoter, a reporter gene, and a suicide gene;

[0028] The first culture medium; the first culture medium contains a non-cytotoxic prodrug, and the protein encoded by the suicide gene can convert the non-cytotoxic prodrug into a cytotoxic active drug. Of course, those skilled in the art know that when the gene circuit expression cassette of the screening system is free-expressed, the first culture medium also contains the antibiotic corresponding to the resistance gene of the plasmid vector used;

[0029] The second culture medium; the second culture medium contains lactose or its analogs. Similarly, when the gene circuit expression cassette of the screening system is free-expressed, the second culture medium also contains the antibiotic corresponding to the resistance gene of the plasmid vector used.

[0030] The third object of the present invention is to provide the application of the above screening system in screening lactose or its analog biosensors or components for the biosensors.

[0031] The fourth object of the present invention is to provide a Bacillus subtilis biosensor for lactose or its analogs. The Bacillus subtilis biosensor includes: a recombinant Bacillus subtilis containing a gene expression cassette of a DNA-binding transcriptional repressor LacI mutant; the DNA-binding transcriptional repressor LacI mutant has an amino acid residue substitution at any of the following positions based on the sequence shown in SEQ ID NO. 10:

[0032] Replacing valine at position 150 with alanine;

[0033] Replacing serine at position 193 with glycine;

[0034] Replacing glutamine at position 291 with isoleucine;

[0035] Replacing glutamine at position 291 with valine;

[0036] Replacing isoleucine at position 79 with histidine;

[0037] Replacing glutamine at position 291 with phenylalanine.

[0038] Furthermore, the Bacillus subtilis biosensor further includes: an inducible promoter and a reporter gene expressed under the initiation of the promoter, so as to detect the presence or absence of lactose or its analogs according to the expression or non-expression of the reporter gene.

[0039] Furthermore, in step S2, the inducible promoter is derived from the P lac promoter in the lactose operon, including but not limited to the P hy-spank promoter, the P grac100 promoter, etc.; the P hy-spank promoter, the P grac100The nucleotide sequences of the promoters are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0040] The fifth object of the present invention is to provide a DNA-binding transcriptional repressor LacI mutant, wherein the DNA-binding transcriptional repressor LacI mutant has an amino acid residue substitution at any of the following positions based on the sequence shown in SEQ ID NO.10:

[0041] Replace the valine at position 150 with alanine;

[0042] Replace the serine at position 193 with glycine;

[0043] Replace the glutamine at position 291 with isoleucine;

[0044] Replace the glutamine at position 291 with valine;

[0045] Replace the isoleucine at position 79 with histidine;

[0046] Replace the glutamine at position 291 with phenylalanine.

[0047] The sixth object of the present invention is to provide a nucleic acid molecule encoding the DNA-binding transcriptional repressor LacI mutant.

[0048] The seventh object of the present invention is to provide an expression vector containing the nucleic acid molecule.

[0049] The eighth object of the present invention is to provide a recombinant cell containing the nucleic acid molecule. Among them, the host cell is preferably a microbial cell, and most preferably Bacillus subtilis.

[0050] The ninth object of the present invention is to provide the application of the Bacillus subtilis biosensor, the DNA-binding transcriptional repressor LacI mutant, the nucleic acid molecule, the expression vector or the recombinant cell in detecting lactose or its analogs.

[0051] The beneficial effects of the present invention:

[0052] (1) The present invention provides a method for constructing a screening platform for lactose and its analog biosensors. Specifically, a mutant library of the DNA-binding transcriptional repressor LacI and a screening system gene circuit expression cassette containing an inducible promoter, a reporter gene, and a suicide gene are transformed into cells. First, 5-fluoro-2'-deoxyuridine (5FdU) is added to the culture medium, and mutants of the DNA-binding transcriptional repressor LacI with promoter sequence binding activity are screened based on cell survival or death. Second, specific lactose analogs (such as lactose, 2'-FL, 3-FL, etc.) are added to the culture medium, and mutants of the DNA transcriptional repressor LacI with the ability to bind specific lactose analogs are screened based on the reporter gene signal. This screening platform is simple to construct and enables high-throughput screening of the mutant library of the DNA-binding transcriptional repressor LacI, obtaining mutants of the DNA-binding transcriptional repressor LacI that can respond to specific lactose analogs.

[0053] (2) Through the self-constructed screening platform of the present invention, LacI mutants with strong binding activity to the inducible promoter and sensitive response to lactose and its analogs are screened, such as V150A, S193G, I79H, Q291I, Q291V, Q291F, etc. These mutants have strong binding ability to the promoter in the absence of lactose and its analogs, thus inhibiting transcription. In the presence of the substance to be tested, they respond sensitively and dissociate from the promoter, and the reporter gene starts to express, realizing detection. After verification, the detection effects of these mutants are far better than that of the wild-type LacI and are specific. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 It is a schematic diagram of the gene circuit of the lactose analog biosensor screening platform in Bacillus subtilis of the present invention and a flow chart for screening mutants of the lactose analog biosensor.

[0055] Figure 2 It is the lactose response curve of the mutant. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0056] The present invention will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0057] The materials involved in the following embodiments are as follows:

[0058] Liquid LB medium (g / L): peptone 10, yeast extract 5, NaCl 10.

[0059] The primer sequences involved in the following embodiments are as follows:

[0060] Table 1 Primer Sequences

[0061] Primer Name Primer Sequence F1 cgaaacaataattggtacgtacgatctttcagccgactc R1 ctcctttgctcatagtagttcctccttatgtgctag F2 ggaggaactactatgagcaaaggagaagaacttttcac R2 accaccaccaccagaaccaccaccacctttgtagagctcatccatgcc F3 gtggtggttctggtggtggtggttctatggcttcttatcctggtcatc R3 ctgcagttaattagcttcacccatttctctagc F4 gggtgaagctaattaactgcaggtcgacgtcc R4 ctgaaagatcgtacgtaccaattattgtttcgtgattgttcaagcc F5 gtgccagctgcattaatgaatcggccaacgcgcg R5 ctggttacgatcaatcaaatattcaaacggagggagacgattttgatgatg F6 cttagttagcttggccagtgcctaccatcattgatggtttctttcggtaagt R6 ctgaaagatcgtacgtaccaattattgtttcgtcgacatggatgagcgatgatg F7 gaaatgggtgaagctaattaactgcagaattctgcgtgacatccc R7 tctgatctgccgttcgtaacaggatgtttgaatttccgtttaaagaatgggct

[0062] Example 1 Construction of a Lactose Biosensor Screening Platform for Bacillus subtilis

[0063] The lactose biosensor plasmid screening platform for Bacillus subtilis in this example consists of a DNA-binding transcriptional repressor LacI expression cassette, an IPTG-inducible promoter, an sfGFP fluorescent protein expression gene, a fusion protein linker Linker1, a herpes simplex virus thymidine kinase gene, and gene expression elements such as promoters, RBSs, and terminators required for the expression of the above genes.

[0064] (1) Construction of the screening system gene circuit expression cassette and the DNA-binding transcriptional repressor LacI expression cassette to obtain the lactose biosensor screening platform plasmid:

[0065] Using the P hy-spank promoter and its RBS sequence (nucleotide sequence shown in SEQ ID NO.1) as a template, primers F1 and R1 were designed, and the P hy-spank promoter and its RBS sequence DNA fragment was obtained by PCR amplification; using the sfGFP fluorescent protein DNA sequence (amino acid sequence shown in SEQ ID NO.3) as a template, primers F2 and R2 were designed, and the sfGFP fluorescent protein DNA fragment was obtained by PCR amplification; using the herpes simplex virus thymidine kinase sequence (amino acid sequence shown in SEQ ID NO.8) as a template, primers F3 and R3 were designed, and the herpes simplex virus thymidine kinase DNA fragment was obtained by PCR amplification; the DNA sequence of the fusion protein linker Linker1 is shown in SEQ ID NO.5. Since this sequence is short, this sequence was added to primers R2 and F3 respectively; using the pHT-LacI plasmid vector sequence as a template, primers F4 and R4 were designed and PCR amplification was carried out to obtain a plasmid vector fragment containing the DNA-binding transcriptional repressor LacI expression cassette sequence;

[0066] The above DNA fragments were subjected to fusion PCR and transformed into Escherichia coli DH5α to construct the pHT-GLH lactose biosensor screening platform plasmid.

[0067] (2) Construction of the LacI mutant library (including a saturated mutant library and a random mutant library):

[0068] Extract the pHT-GLH plasmid and design primers for the saturation mutagenesis of the DNA-binding transcriptional repressor LacI. Using the pHT-GLH plasmid as a template, obtain the saturation mutagenesis fragment of the pHT-GLH plasmid by PCR and transform it into Escherichia coli DH5α to construct a saturation mutagenesis library of the DNA-binding transcriptional repressor LacI. Expand the culture of Escherichia coli DH5α containing the saturation mutagenesis library of the DNA-binding transcriptional repressor LacI and extract the saturation mutagenesis library of the DNA-binding transcriptional repressor LacI. Similarly, design random mutagenesis primers F5 and R5, use a random mutagenesis kit to construct a random mutagenesis library of the DNA-binding transcriptional repressor LacI, expand the culture of Escherichia coli DH5α containing the random mutagenesis library of the DNA-binding transcriptional repressor LacI, and extract the random mutagenesis library of the DNA-binding transcriptional repressor LacI.

[0069] (3) Construction of genetically engineered strains:

[0070] Prepare competent cells of Bacillus subtilis and transform the saturation mutagenesis library or random mutagenesis library of the DNA-binding transcriptional repressor LacI into the competent cells of Bacillus subtilis to obtain a cell library of the lactose biosensor screening platform in Bacillus subtilis.

[0071] Above, construct the screening system gene circuit expression cassette and the DNA-binding transcriptional repressor LacI expression cassette on the same plasmid and express them freely in host cells to construct a screening cell library and use it for subsequent experiments. Of course, those skilled in the art can also choose the method of genomic integration to construct the lactose biosensor screening platform. The specific steps are as follows:

[0072] The genomic integration type lactose biosensor screening platform of Bacillus subtilis consists of a DNA-binding transcriptional repressor LacI expression plasmid (pHT-lacI plasmid), an IPTG-inducible promoter, a fluorescent protein expression gene, a fusion protein linker Linker, a herpes simplex virus thymidine kinase gene, and gene expression elements such as promoters, RBSs, and terminators required for the expression of the above genes.

[0073] Design PCR primers F6, R6, F7, and R7 for the upstream and downstream homologous arms used for gene integration using the DNA sequence of the amyE integration site of Bacillus subtilis as a template, and obtain the upstream and downstream homologous arm fragments used for gene integration by PCR amplification. Using P hy-spank The promoter and its RBS sequence (as shown in SEQ ID NO.1) as a template to design primers F1 and R1, and obtain P hy-spankPromoter and its RBS sequence DNA fragment; Using the sfGFP fluorescent protein DNA sequence (shown in SEQ ID NO.3) as a template, primers F2 and R2 were designed, and using the herpes simplex virus thymidine kinase sequence (shown in SEQ ID NO.8) as a template, primers F3 and R3 were designed. Through PCR amplification, the herpes simplex virus thymidine kinase DNA fragment was obtained; The DNA sequence of the fusion protein linker Linker1 is shown in SEQ ID NO.5. Since this sequence is short, this sequence was added to primers R2 and F3 respectively; The above DNA fragments were subjected to fusion PCR to construct a gene integration fragment; The above gene integration fragment was transformed into Bacillus subtilis 168 for gene integration. After colonies grew, colony PCR verification was carried out to screen and obtain Bacillus subtilis that had successfully integrated the fusion fragment; The successfully integrated Bacillus subtilis was prepared into competent cells for standby.

[0074] Using the pHT-lacI plasmid (kindly provided by Dr. Yang Li of Jiangnan University) as a template, the pHT-lacI plasmid saturation mutation fragment was obtained by using saturation mutation primers PCR and transformed into Escherichia coli DH5α to construct a DNA-binding transcriptional repressor LacI saturation mutation library; The Escherichia coli DH5α containing the DNA-binding transcriptional repressor LacI saturation mutation library was expanded in culture, and the DNA-binding transcriptional repressor LacI saturation mutation library was extracted; Similarly, random mutation primers F5 and R5 were designed, and a DNA-binding transcriptional repressor LacI random mutant library was constructed using a random mutation kit. The Escherichia coli DH5α containing the DNA-binding transcriptional repressor LacI random mutant library was expanded in culture, and the DNA-binding transcriptional repressor LacI random mutant library was extracted.

[0075] The DNA-binding transcriptional repressor LacI saturation mutation library or random mutant library was transformed into the competent cells of Bacillus subtilis that had successfully integrated the fusion fragment to obtain a lactose biosensor screening platform cell library in Bacillus subtilis.

[0076] Example 2 Screening of lactose-responsive LacI mutants using a lactose biosensor screening platform

[0077] This example aims to screen LacI mutants with strong binding activity to the promoter and sensitive response to lactose. The screening includes negative screening and positive screening: The LacI binding activity was screened through a negative screening lethal circuit, and the allosteric activation activity was screened through positive screening of fluorescence signals.

[0078] Prepare a screening plate containing 5FdU, and spread the Bacillus subtilis containing the lactose biosensor screening platform cell library on the screening plate for culture. The LacI mutants in Bacillus subtilis are constitutively expressed, and different mutants bind to the promoter P hy-spankHave different binding abilities, thus playing a role in inhibiting expression to different degrees. The LacI mutant binds to the promoter P hy-spank Binding will inhibit transcription, the herpes simplex virus thymidine kinase lethal gene will not be expressed, and the cells will survive (when the herpes simplex virus thymidine kinase gene is expressed, the engineered bacteria will convert the non-toxic 5FdU precursor in the culture medium into the cytotoxic 5FdUMP). Therefore, the single colonies grown on this plate are the LacI mutants with DNA binding ability obtained by negative screening. After the single colonies grow, elute the single colonies to prepare a bacterial solution;

[0079] Use liquid LB medium to elute the cells, add lactose with a final concentration of 1 mM for liquid shaking culture (37 °C, 220 rpm, 10 - 12 h). For the strain containing the LacI mutant with lactose response ability, since the protein conformation changes after the LacI mutant binds to lactose, it loses the ability to bind to the promoter P hy-spank Binding ability, the promoter P hy-spank Triggers the expression of sfGFP to produce a fluorescence signal. Therefore, after the bacterial solution becomes turbid, perform flow cytometry screening to obtain cells with sfGFP fluorescence signals (about 1 / 10000 - 1 / 100000 cells with fluorescence signals). The obtained cells contain the DNA-binding transcriptional repressor LacI mutant that can respond to lactose. Sequencing the obtained single colonies can obtain the DNA sequence information of the DNA-binding transcriptional repressor that can respond to lactose (the amino acid sequence of the wild type is shown in SEQ ID NO.10).

[0080] Example 3 Verification of lactose response

[0081] Inoculate the mutant strain screened in Example 2 into a liquid LB medium containing chloramphenicol antibiotic, and culture at 37 °C, 220 rpm for 10 - 12 h. Inoculate the fresh seed liquid into a 96-well plate containing 1 mM lactose and chloramphenicol antibiotic (inoculation amount 1%). Place the 96-well plate in a plate shaker for culture (37 °C, 700 rpm). After shaking culture for 6 h, use an enzyme-linked immunosorbent assay (ELISA) reader to measure the fluorescence intensity of the well plate every 3 h, and draw a fluorescence intensity change curve (as Figure 2 shown, note: Figure 2 In [ ], Blank represents the control group strain, which contains the original lacI repressor protein).

[0082] Obviously, the above examples are only for clear illustration and are not limitations on the implementation methods. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A screening method for a lactose or its analog biosensor, characterized in that: Comprising the following steps: S1. Construct a mutant library of DNA-binding transcriptional repressor LacI; S2. Construct a recombinant cell library containing expression cassettes of genes of different DNA-binding transcriptional repressor LacI mutants and expression cassettes of gene circuits of a screening system; the expression cassette of the gene circuit of the screening system contains an inducible promoter, a reporter gene and a suicide gene; S3. Culture the recombinant cell library obtained in S2 to express the DNA-binding transcriptional repressor LacI mutants and the genes in the expression cassette of the gene circuit of the screening system, and then transfer the recombinant cell library to a first culture medium for culture to screen out viable cells; the first culture medium contains a non-cytotoxic prodrug, and the protein encoded by the suicide gene can convert the non-cytotoxic prodrug into a cytotoxic active drug; S4. Transfer the viable cells in S3 to a second culture medium for culture, and screen the cells according to the signal intensity of the reporter gene to obtain a target biosensor; the second culture medium contains lactose or its analog; Wherein, the suicide gene is selected from the thymidine kinase gene or the cytosine deaminase gene, and the non-cytotoxic prodrug is selected from 5-fluorocytosine or 5-fluoro-2'-deoxyuridine; The reporter gene controlled by the inducible promoter is linked to the suicide gene through a flexible linker, and the amino acid sequence of the flexible linker is any one of those shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7; 2. The screening method according to claim 1, wherein The expression cassette of the gene circuit of the screening system is integrally expressed or freely expressed, and the expression cassette of the gene of the DNA-binding transcriptional repressor LacI mutant is freely expressed; 3. The screening method according to claim 1, wherein The lactose analog is 2'-fucosyllactose or 3-fucosyllactose; 4. A screening system for a lactose or its analog biosensor, characterized in that, The screening system includes: A recombinant cell library containing an expression cassette of a gene library of DNA-binding transcriptional repressor LacI mutants and an expression cassette of a gene circuit of a screening system; the expression cassette of the gene circuit of the screening system contains an inducible promoter, a reporter gene and a suicide gene; A first culture medium; the first culture medium contains a non-cytotoxic prodrug, and the protein encoded by the suicide gene can convert the non-cytotoxic prodrug into a cytotoxic active drug; A second culture medium; the second culture medium contains lactose or its analog; The suicide gene is selected from the thymidine kinase gene or the cytosine deaminase gene, and the non-cytotoxic prodrug is selected from 5-fluorocytosine or 5-fluoro-2'-deoxyuridine; The reporter gene controlled by the inducible promoter is linked to the suicide gene through a flexible linker, and the amino acid sequence of the flexible linker is any one of those shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7; 5. Use of the screening system according to claim 4 in screening biosensors or biosensor elements for lactose or its analogs.

Images