Application of maize miRNA172 and its precursor sequence Zma-MIR172c in changing maize strains

Abstract

The present invention relates to the technical field of molecular biology and molecular breeding, and specifically discloses the application of corn miRNA172 and its precursor sequence Zma-MIR172c in changing the height of corn plants. The present invention finds that the plant height of corn can be reduced after knocking out Zma-MIR172c or miRNA172 in corn by CRISPR technology and STTM technology, while overexpressing the Zma-MIR172c gene can increase the plant height of corn. Further, the application of corn miRNA172, the precursor sequence Zma-MIR172c of corn miRNA172 or a biological material containing its encoding gene in changing the height of corn plants is proposed, and the sequence of the Zma-MIR172c is shown in SEQ ID NO.1. The Zma-MIR172c or miRNA172 of the present invention can be used to cultivate dwarf / tall corn varieties, and has good market application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and molecular breeding, in particular to the application of corn miRNA172 and its precursor sequence Zma-MIR172c in changing the growth of corn plants. Background Art

[0002] Corn is the crop with the widest planting range, the most uses, and the highest total yield. Plant height is one of the important agronomic traits. Dwarf plants have the advantages of tolerance to dense planting, resistance to lodging, suitability for mechanized harvesting, and avoidance of reduced grain quality caused by lodging. Appropriately reducing plant height can not only increase the number of plants per unit area and improve the total yield per unit area, but also avoid the occurrence of lodging, which is extremely important for enhancing the plant's tolerance to dense planting and resistance to lodging. The semi-dwarf genetic improvement of plant height traits has become one of the important directions of corn breeding. At present, there are more than 60 known dwarfing genes in corn, of which about 40 genes have been cloned. The first dwarfing gene in corn is Brachytic2 (Br2), and the discovery of this gene laid the foundation for dwarf breeding in corn.

[0003] Feed corn is a variety of corn specifically grown for animal feed, unlike standard edible corn. It is distinguished by its tall plants, sometimes reaching 2.5 to 3.5 meters. Its primary production is straw, while edible corn primarily produces kernels. Therefore, when breeding feed corn varieties, tall plants and high biomass are also considered key selection criteria.

[0004] MicroRNA (miRNA) is a class of small RNA molecules, typically approximately 21 nucleotides in length, derived from a single-stranded RNA precursor that forms a stem-loop structure. They can target specific target genes through complementary base pairing, negatively regulating their expression. In plants, miRNAs are involved in regulating plant growth and development and tolerance to abiotic stresses. However, there are currently no reports of regulating plant height in maize through the regulation of miRNAs. Summary of the Invention

[0005] One of the purposes of the present invention is to provide a new method for changing the height of corn plants.

[0006] In order to achieve this object, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides use of corn miRNA172, the precursor sequence Zma-MIR172c of corn miRNA172 or biological materials containing the encoding gene thereof in changing the high quality of corn plants. The sequence of Zma-MIR172c is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides the use of maize miRNA172, the precursor sequence Zma-MIR172c of maize miRNA172 or biological materials containing the encoding gene thereof in breeding transgenic plants with altered plant height. The sequence of Zma-MIR172c is shown in SEQ ID NO.1.

[0009] In a third aspect, the present invention provides applications of maize miRNA172, maize miRNA172 precursor sequence Zma-MIR172c, or biological materials containing the encoding gene thereof in maize germplasm resource improvement. The sequence of Zma-MIR172c is shown in SEQ ID NO.1.

[0010] There are five precursor genes of corn miRNA172, namely Zma-MIR172a / b / c / d / e. During the study of the present invention, it was found that although microRNA172b in rice can regulate rice plant height, Zma-MIR172b in corn has no significant effect on the plant height phenotype. In addition, through literature review, it was found that Zma-MIR172e plays an important role in the development of corn flower organs, but it was found that it has no significant effect on the corn plant height phenotype. Then the present invention further searches for genes that can affect corn plant height through genome-wide association analysis (GWAS). Specifically, the field phenotypic statistics of 486 corn inbred line populations for many years and multiple points (2021, 2022, 2023, Beijing, Hainan) data are used to explore the key genes that regulate corn plant height through GWAS genome-wide association analysis of plant height phenotypes. The present invention utilized 12,588,716 SNP data points and, through a mixed linear model (MLM), identified 413 SNPs, which were associated with 64 gene loci. Among these, the Zma-MIR172c gene was found to be significantly associated with plant height phenotypes in maize.

[0011] The present invention also uses CRISPR gene knockout technology and overexpression to obtain transgenic materials for phenotypic observation. It was found that after knocking out the Zma-MIR172c gene, the height of corn plants decreased, and the height of Zma-MIR172c plants driven by ubiquitin overexpression increased, indicating that Zma-MIR172c can positively regulate corn plant height. The present invention further analyzed the expression profiles of the five members of Zma-MIR172a / b / c / d / e (the expression abundance of Zma-MIR172c was detected in different tissues of corn using Real-time qPCR method). It was found that Zma-MIR172c is expressed in different corn tissues, and the expression level of Zma-MIR172c is the highest among these five members. The gene has a higher expression level in the corn stem and apical meristem, further indicating that Zma-MIR172c plays a major biological function in the corn stem and apical meristem.

[0012] In addition, the present invention also found that knocking out the miRNA172 gene would also reduce the height of corn plants, and the height of corn plants could be changed directly by regulating the expression level of the miRNA172 gene.

[0013] In the application of the present invention, the sequence of the corn miRNA172 is shown as SEQ ID NO.15.

[0014] The biological material is an expression cassette, a vector or a host cell (eg, a recombinant microorganism, a transgenic cell line).

[0015] In a fourth aspect, the present invention provides a method for increasing corn plant height, which enhances the function of corn miRNA172 or the precursor sequence Zma-MIR172c of corn miRNA172 through transgenic, hybridization, backcrossing, selfing or asexual reproduction. The sequence of Zma-MIR172c is shown as SEQ ID NO.1, and the sequence of corn miRNA172 is shown as SEQ ID NO.15.

[0016] In the method of the present invention, the transgenic method includes introducing a recombinant expression vector containing Zma-MIR172c into corn using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated methods to obtain a transgenic plant strain.

[0017] In a fifth aspect, the present invention provides a method for reducing corn plant height, which inactivates the function of corn miRNA172 or the precursor sequence Zma-MIR172c of corn miRNA172 in corn through genetic modification, gene knockout, RNA interference, hybridization, backcrossing, selfing or asexual reproduction. The sequence of Zma-MIR172c is shown in SEQ ID NO.1, and the sequence of corn miRNA172 is shown in SEQ ID NO.15.

[0018] In the method of the present invention, the gene knockout includes knocking out Zma-MIR172c using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology to obtain a transgenic plant strain.

[0019] In the method of the present invention, the transgenic method includes introducing a recombinant expression vector containing a sequence that inhibits corn miRNA172 or Zma-MIR172c into the plant using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated methods to obtain a transgenic plant strain.

[0020] The beneficial effects of the present invention are at least:

[0021] The Zma-MIR172c and miRNA172 provided by the present invention can be widely used in the fields of corn genetic breeding, germplasm resource improvement and cultivation of transgenic plants of dwarf / tall corn, and play an important role in improving and modifying the germplasm resources of crops such as corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Figure 1 shows the molecular identification and expression level detection results of Zma-MIR172c overexpressing and Zma-MIR172c knockout plants, as well as sequencing peaks of CRISPR knockout plants. Figure A shows the molecular identification results of plants from four overexpressing lines. The rightmost band is the marker, and the remaining bands are the identification results of transgenic materials. Figure B shows the molecular identification results of plants from a representative CRISPR knockout line. The rightmost band is the marker, and the remaining bands are the identification results of transgenic materials. Figure C shows the expression level detection results of overexpressing plants. In the figure, 1#, 2#, 4#, and 6# represent the four overexpressing lines. Figure D shows the expression level detection results of CRISPR knockout plants. In the figure, miR172C CR1 and miR172C CR2 represent two representative knockout lines. 55, 59, 68, 70, and 76 are the biological replicate numbers of each line. Figure E shows the sequencing results of the CRISPR material.

[0023] Figure 2Figure 1 shows the plant height phenotypes of Zma-MIR172c CRISPR knockout (miR172C-CR) and overexpression (miR172C-OE) strains. Figure A shows a representative photograph of each strain, with the scale representing 30 cm. Figure B shows the plant height statistics for each strain.

[0024] Figure 3 This is the expression profile of the five members of Zma-MIR172a / b / c / d / e (Pre-miR172a / b / c / d / e) in different tissues of corn.

[0025] Figure 4 Molecular identification results of STTM172 transgenic materials (A) and representative plant photos (B).

[0026] In each figure (if available), ** represents P < 0.01, and *** represents P < 0.001. DETAILED DESCRIPTION

[0027] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources or prepared according to conventional methods in the art. The maize genetic transformation of the present invention was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0029] Example 1 Acquisition and Expression Pattern Analysis of Zma-MIR172c Gene

[0030] 1. Preparation of plant materials: After sowing corn B73 seeds, wait for them to grow for about 2 weeks, cut off the flag leaves, and store them in liquid nitrogen.

[0031] 2. Extraction of Plant Total RNA: Grind 300 mg of corn leaves in liquid nitrogen until powdered. Add 1 ml of TRizol and shake thoroughly. Centrifuge at 12,000 rpm for 10 min at 4°C. Transfer the supernatant to a fresh centrifuge tube, add 1 / 5 the volume of TRizol to chloroform, mix thoroughly, let stand at room temperature for 3 min to separate, and then centrifuge at 12,000 g for 15 min at 4°C. Transfer the supernatant to a fresh centrifuge tube, mix thoroughly, and then add 1 / 2 the volume of isopropanol to the supernatant volume. Mix thoroughly and let stand at -20°C for 30 min. Centrifuge at 10,000 g for 15 min at 4°C, discard the supernatant, and wash the pellet twice with 75% ethanol, each time for 10 min at room temperature. Centrifuge at 7500 rpm for 5 min at 4°C, and let the pellet air-dry at room temperature for 10 min. Dissolve the pellet in 60 μl of DEPC water to obtain plant total RNA.

[0032] 3. Reverse transcription to obtain cDNA:

[0033] (1) Reverse transcription system and process:

[0034] Mix 2.5 μl of RNA, 1 μl of Oligo-dT, and 6.5 μl of DEPC-H2O in a centrifuge tube, incubate at 70°C for 5 min, and then place on ice for another 5 min.

[0035] Continue to add M-MLV 5×Buffer 5μl, dNTP mix 1.25μl, Inhibitor 0.625μl, M-MLV 1μl, DEPC-H2O 7.125μl, incubate at 48℃ for 1h, 70℃ for 15min, and 4℃ for 10min.

[0036] The reverse transcription product was added to 25 μl ddH2O, and 1 μl was used for subsequent PCR reaction to obtain cDNA.

[0037] (2) Cloning pre-zma-MIR172c:

[0038] The primers required for PCR amplification are as follows:

[0039] F: GTGCAGCACCACCAAGATTCA (SEQ ID NO. 2);

[0040] R: ATGCAGCATCATCAAGATTCTC (SEQ ID NO. 3).

[0041] The PCR system is shown in Table 1.

[0042] Table 1

[0043] KOD buffer 5μl <![CDATA[MgSO4]]> 2 μl dNTP 5μl cDNA 2 μl Primer F 1.5 μl Primer R 1.5 μl KOD plus 1 μl <![CDATA[H2O]]> 32 μl

[0044] PCR procedure:

[0045]

[0046] A 123 bp PCR product was obtained, and the PCR product was sent for sequencing. The result showed that the PCR product had the nucleotide sequence shown in SEQ ID NO. 1, and the gene shown in the sequence was named Zma-MIR172c.

[0047] Example 2 Molecular Identification of Zma-MIR172c Transgenic Material

[0048] 1. Determination of Zma-MIR172c CRISPR knockout targets

[0049] For non-coding proteins, we used the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to design targets with high target scores, low off-target rates, and appropriate locations. The target design for Zma-MIR172c is as follows:

[0050] Target1:GAGTTGGATGTGAATCTTGGTGG(SEQ ID NO.6);

[0051] Target2:AAGGGTGAGAGACGACGAATCGG (SEQ ID NO. 7).

[0052] 2. Construction of Zma-MIR172c overexpression vector

[0053] The PCR product obtained in Example 1 was constructed into the wmv011 vector (from Weimi Biotechnology (Jiangsu) Co., Ltd.) to obtain an overexpression transformation vector.

[0054] 3. Molecular identification of Zma-MIR172c CRISPR knockout and overexpression maize materials

[0055] The primers for identifying Zma-MIR172c CRISPR materials are as follows:

[0056] F: CGAGAACCATGCATCATCAG (SEQ ID NO.8);

[0057] R: GTCCAGCACTGCTAGCTTCC (SEQ ID NO. 9).

[0058] The primers for identifying Zma-MIR172c overexpressing materials are as follows:

[0059] F:CGATGCTCACCCTGTTGTTT(SEQ ID NO.10);

[0060] R:TCCTAGTTTGCGCGCTATATT (SEQ ID NO. 11).

[0061] The reagent used for PCR was 2X M5 HiPer plus Taq HiFiPCR mix (with blue dye) from Beijing Juhemei Biotechnology Co., Ltd.

[0062] The PCR system includes: 2xMix 10 μl; template 2 μl, primer F 0.5 μl, primer R 0.5 μl, H2O 7 μl.

[0063] The PCR procedure is as follows:

[0064]

[0065] The sequencing primers for the Zma-MIR172c CRISPR material were SEQ ID NO. 8 and SEQ ID NO. 9, and the sequencing reaction was performed by Beijing Qingke Biotechnology Co., Ltd.

[0066] 4. Expression level detection:

[0067] The detection primers for Zma-MIR172c Real time PCR expression profile are SEQ ID NO.4 and SEQ ID NO.5.

[0068] The real-time PCR system includes: qPCR Mix 10 μl, template 2 μl, primer F 0.4 μl, primer R 0.4 μl, and H2O 7.2 μl.

[0069] The real-time PCR program was as follows: 95°C for 10 min, 95°C for 15 sec, and 60°C for 1 min, for 40 cycles. A melting curve was set up: 95°C for 10 sec, 65°C for 1 min, with a 0.2°C step increase. Fluorescence readings were taken, and the temperature was raised to 95°C before the end.

[0070] In this example, transgenic plants were identified by PCR molecular identification. A total of 4 overexpression lines and 10 CRISPR knockout lines were obtained. The PCR identification results of the overexpression and representative knockout lines are shown in Figure 2. Figure 1 A and B in the figure. Then, through the expression level detection, it was found that the expression level of Zma-MIR172c was reduced in CRISPR plants, while overexpression of Zma-MIR172c significantly increased its expression level. The expression level detection results of overexpression and representative knockout lines are shown in Figure 2. Figure 1C and D in the figure. At the same time, the knockout sites of the CRISPR transgenic material were further confirmed by sequencing. The sequencing results of the CRISPR material are shown in Figure 1 Figure E illustrates the effectiveness of gene editing with CRISPR materials.

[0071] Example 3 Phenotypic Identification of Zma-MIR172c Transgenic Material

[0072] The four Zma-MIR172c overexpression lines and ten Zma-MIR172c knockout lines obtained after molecular identification in the above example were planted in the field and phenotypic observation and statistics were performed. Ten plants of each line were planted. The results are as follows: Figure 2 Phenotypic statistics show that the average plant height of the KN5585 wild-type strain was 168.75 cm, the average plant height of the Zma-MIR172c CRISPR strain was 119.75 cm, and the average plant height of the Zma-MIR172c overexpressing strain was 201.25 cm. Compared to the KN5585 wild-type strain, the plant height of the Zma-MIR172c CRISPR strain was 29.03% lower, while the plant height of the Zma-MIR172c overexpressing strain was 19.26% higher.

[0073] Example 4 Analysis of the expression pattern of the Zma-MIR172c gene

[0074] In this example, the expression profiles of Zma-MIR172c in different tissues were detected as follows:

[0075] After sowing corn B73 seeds, wait for about two weeks to grow. Roots, stems, leaf sheaths, leaves, and apical meristems were collected for RNA extraction and reverse transcription (system and method as in Example 1). The reverse transcription product was diluted 10-fold, and 2 μl was used for real-time PCR. The real-time PCR system and procedure were similar to those of the Yeasen kit. qPCR SYBR Green Master Mix (Low Rox Plus) operating instructions.

[0076] The primers for real-time PCR are as follows:

[0077] F:GCAGCACCACCAAGATTC(SEQ ID NO.4);

[0078] R: CTGCTGCGAGACATCACAG (SEQ ID NO. 5).

[0079] The real-time PCR system includes: qPCR Mix 10 μl, template 2 μl, primer F 0.4 μl, primer R 0.4 μl, and H2O 7.2 μl.

[0080] The real-time PCR program was as follows: 95°C for 10 min, 95°C for 15 sec, and 60°C for 1 min, for 40 cycles. A melting curve was set up: 95°C for 10 sec, 65°C for 1 min, with a 0.2°C step increase. Fluorescence readings were taken, and the temperature was raised to 95°C before the end.

[0081] The results are as follows Figure 3 As shown in the results, Zma-MIR172c has the highest expression level among the five members of MIR172, and its expression level is also high in maize stem and apical meristem, which proves that Zma-MIR172c has an effect on plant height.

[0082] Example 5 Phenotypic Observation of STTM172 Transgenic Material

[0083] STTM can specifically induce the degradation of mature miRNA in plants, thereby reducing the level of endogenous mature miRNA. It is an effective method for studying mature miRNA.

[0084] When constructing a specific STTM (Short Tandem Target Mimic) sequence, the following steps were used:

[0085] 1. Design and synthesis of STTM primers: First, STTM primers were designed based on the target gene miRNA172. These primers contain SwaI sites at both ends for subsequent self-ligation of PCR products.

[0086] The sequence of the STTM fragment of STTM172 is:

[0087] ATGCAGCATCACTATCAAGATTCTGTTGTTGTTGTTATGGTCTAATTTAAATAT GGTCTAAAGAAGAAGAATATGCAGCATCACTATCAAGATTCA (SEQ ID NO. 14).

[0088] 2. PCR amplification and self-ligation: Using the primers with SwaI sites, amplify the STTM fragment by PCR. Because the primers contain SwaI sites, the PCR product can self-ligate and be inserted into the pOT2-Poly-Cis vector to form pOT2-STTM172.

[0089] 3. Using the pOT2-STTM172 vector as a template, generate an STTM-CmR (chloramphenicol resistance) fragment with two PacI sites.

[0090] 4. Insert it into a binary vector such as pTF101.1 (see Paz M, Shou H, Guo Z, Zhang Z, Banerjee A, Wang K (2004) Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary node explant. Euphytica 136:167–179) by enzyme digestion and ligation. The final construct is verified by sequencing to ensure the accuracy and integrity of the sequence and to ensure that the desired target sequence has been correctly inserted into the vector for subsequent transgenic experiments.

[0091] In this example, the final constructed vector was transferred into wild-type corn B104 to obtain STTM172 transgenic material, and molecular identification was performed. After positive plants were identified, their phenotypes were observed in the field. A total of 6 positive plants were identified (see Figure 4 The A in the figure, the rightmost band is the marker, and the remaining bands are the results of transgenic material identification). The six STTM172 transgenic positive lines obtained were planted in the field, with 10 plants of each line planted, and the phenotypic observations were performed. The results are shown in Figure 4 B in the figure, where L28 and L24 are two representative lines. A statistical analysis of the planting results of all lines revealed that the plant height of the STTM172 transgenic material was about 40% lower on average than that of the wild-type corn B104, indicating that corn lacking the miRNA172 gene has reduced plant height.

[0092] The primers for STTM172 material identification are as follows:

[0093] F: CAGAATTCGGTACGCTGAAA (SEQ ID NO. 12);

[0094] R: GGGGCTTATGCGGATTATTT (SEQ ID NO. 13).

[0095] The reagent used for PCR was 2X M5 HiPer plus Taq HiFiPCR mix (with blue dye) from Beijing Juhemei Biotechnology Co., Ltd.

[0096] The PCR system includes: 2xMix 10 μl; template 2 μl, primer F 0.5 μl, primer R 0.5 μl, H2O 7 μl.

[0097] The PCR procedure is as follows:

[0098]

[0099] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Application of corn miRNA172, the precursor sequence Zma-MIR172c of corn miRNA172 or biological materials containing the coding gene thereof in changing the high quality of corn strains, wherein the sequence of Zma-MIR172c is shown in SEQ ID NO.1; the sequence of corn miRNA172 is shown in SEQ ID NO.15; the biological material is an expression cassette, a vector or a host cell.

2. The use of corn miRNA172, the precursor sequence Zma-MIR172c of corn miRNA172 or biological materials containing the coding gene thereof in breeding transgenic corn with altered plant height, wherein the sequence of Zma-MIR172c is shown in SEQ ID NO.1; the sequence of corn miRNA172 is shown in SEQ ID NO.15; the biological material is an expression cassette, a vector or a host cell.

3. Application of corn miRNA172, the precursor sequence Zma-MIR172c of corn miRNA172 or biological materials containing the coding gene thereof in corn germplasm resource improvement, wherein the sequence of Zma-MIR172c is shown in SEQ ID NO.1; the sequence of corn miRNA172 is shown in SEQ ID NO.15; the biological material is an expression cassette, a vector or a host cell.

4. A method for increasing corn plant height, characterized in that: The expression level of corn miRNA172 or the precursor sequence Zma-MIR172c of corn miRNA172 is enhanced by transgenic, hybridization, backcrossing, selfing or asexual reproduction. The sequence of Zma-MIR172c is shown in SEQ ID NO.1, and the sequence of corn miRNA172 is shown in SEQ ID NO.

15.

5. The method according to claim 4, characterized in that The transgenic method comprises introducing a recombinant expression vector containing Zma-MIR172c into corn by using a plant virus vector or a direct DNA transformation method to obtain a transgenic plant strain.

6. A method for reducing corn plant height, characterized in that: The expression level of corn miRNA172 or the precursor sequence Zma-MIR172c of corn miRNA172 is reduced by genetic modification, hybridization, backcrossing, selfing or asexual reproduction. The sequence of Zma-MIR172c is shown in SEQ ID NO.1, and the sequence of corn miRNA172 is shown in SEQ ID NO.

15.

7. The method according to claim 6, characterized in that The transgenic plant includes gene knockout, and the gene knockout includes knocking out Zma-MIR172c by using DNA homologous recombination technology to obtain a transgenic plant strain.

8. The method according to claim 6, characterized in that The transgenic method comprises introducing a recombinant expression vector containing a sequence that inhibits corn miRNA172 or Zma-MIR172c into corn using a plant virus vector or a direct DNA transformation method to obtain a transgenic plant line.

Images