A molecular marker for identifying the feed utilization rate trait of ducks based on the ACLY gene, and its identification method and application

Abstract

The present invention relates to a molecular marker for identifying the feed utilization rate trait of ducks based on the ACLY gene, its identification method and application. The polymorphic site of the molecular marker is C2480989T, and the molecular marker is a nucleotide sequence composed of the C2480989T polymorphic site and its upstream and downstream bases. The present invention identifies the type of the molecular marker existing in the duck genome, selects the feed utilization rate trait of ducks according to the genotype, and establishes a breeding method for early selection of poultry feed utilization rate. This method is simple, fast, low-cost, does not require special instruments, and meets the needs of molecular marker-assisted breeding experiments.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker for identifying the feed utilization rate trait of ducks based on ACLY genes, and an identification method and application thereof. Background Art

[0002] In modern livestock and poultry production, the feed cost accounts for about 60% - 70% of the total production cost. The level of feed efficiency is closely related to the livestock and poultry breeding cost. With the continuous increase in the price of feed raw materials in recent years, the production cost has also increased accordingly. Therefore, improving feed efficiency and reducing production cost are important means for the efficient and orderly development of the livestock industry and also an important goal for meat duck breeding.

[0003] The selection of RFI traits can be used to create lines with different feed conversion efficiencies. These different lines can be used to establish a model for analyzing the molecular differences between high and low RFI lines, which will provide a basis for exploring the molecular mechanism of RFI trait differences and then be used to improve production efficiency.

[0004] ACLY (ATP Citrate Lyase) is a key enzyme connecting sugar / glutamine metabolism and de novo fatty acid synthesis. It cleaves citrate in the cytoplasm to generate acetyl-CoA and oxaloacetate, and this catalytic reaction depends on ATP, so it is called ATP-citrate lyase. ACLY Encodes ATP citrate lyase. ATP is the main enzyme that links carbohydrate catabolism and fat generation, and conducts fatty acid and cholesterol biosynthesis by synthesizing cytoplasmic acetyl-CoA from citrate.

[0005] Currently ACLY Gene research mainly focuses on mice, fish, and humans, and there is less research on poultry. The research content mainly focuses on fatty acid regulation and lipid deposition, such as ACLY downregulating the participation in lipid metabolism (Zhou, M., Z. Zhu, H.Z. Sun, et al. Breed dependent regulatory mechanisms of beneficial and non-beneficial fatty acid profiles in subcutaneous adipose tissue in cattle withdivergent feed efficiency. Sci Rep, 2022, 12(1): 4612.). ACLYis the rate-limiting enzyme of porcine lipogenesis (Yin, F., Y. Yin, Z. Zhang, et al. Digestion rate of dietary starch affects the systemic circulation of lipid profiles and lipid metabolism-related gene expression in weaned pigs. Br J Nutr, 2011, 106(3): 369-377 ; Lindholm-Perry, A. K., H. C. Freetly, et al. Genes associated with bodyweight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers. PLoS One, 2020, 15(1): e0227154.), and is considered a candidate gene for porcine lipogenesis (Albuquerque, A., C. Óvilo, Y. Núñez, et al. Transcriptomic Profiling of Skeletal Muscle Reveals Candidate Genes Influencing Muscle Growth and Associated Lipid Composition in Portuguese Local Pig Breeds. Animals (Basel), 2021, 11(5).). Davoli et al. (Davoli, R., S. Braglia, M. Zappaterra, C. et al. Association and expression analysis of porcine ACLY gene related to growth and carcass quality traits in Italian Large White and Italian Duroc breeds. Livestock Science, 2014, 165: 1-7.) showed that ACLYGenes are considered potential candidate biomarkers for selection programs that regulate fat content in carcasses and muscles. Han et al. (Han, J., L. Li, D. Wang and H. Ma. (-)-Hydroxycitric acid reduced fat deposition via regulating lipid metabolism-related gene expression in broiler chickens. Lipids Health Dis, 2016, 15: 37.) showed that inhibiting ACLY can regulate de novo lipogenesis in broiler chickens. Moreover, ACLY is involved in de novo lipogenesis and fatty acid oxidation in chicken liver tissues to regulate lipid accumulation (Marimuthu, S., S. Suresh and P. D'Souza. Identification of lipid regulatory genes modulated by polyherbal formulation in chicken liver tissues using transcriptome analysis. J Adv Vet Anim Res, 2022, 9(3): 432-439.). In chicken meat, ACLY is one of the many genes encoding key enzymes in de novo fatty acid synthesis (Nematbakhsh, S., C. Pei Pei, J. Selamat, et al. Molecular Regulation of Lipogenesis, Adipogenesis and Fat Deposition in Chicken. Genes (Basel), 2021, 12(3).).

[0006] It can be seen that the prior art has not studied whether ACLY genes are candidate genes affecting duck feed efficiency. The present invention has important practical significance for improving the feed efficiency of meat ducks and reducing the breeding cost of meat ducks by deeply studying the effects of ACLY gene variation and expression on the feed conversion rate of meat ducks and its molecular mechanism. SUMMARY OF THE INVENTION

[0007] The object of the present invention is to provide a molecular marker for identifying duck feed utilization traits based on ACLY genes, its identification method and application. Compared with the prior art, for candidate genes related to duck feed utilization traits ( ACLYSNP (single nucleotide polymorphism) molecular markers of the

[0008] The present invention achieves the above object through the following technical solutions:

[0009] A molecular marker for identifying the feed utilization trait of ducks based on ACLY gene, the polymorphic site of the molecular marker is located at the 2,480,989th position of the duck genome database, and the base at this site is C or T, hereinafter referred to as the C2480989T site; the gene where this site is located is duck ACLY gene (Gene ID: 101793308, NC_051799.1), the molecular marker for identifying the feed utilization trait of ducks based on ACLY gene is a nucleotide sequence composed of the C2480989T site and its upstream and downstream bases.

[0010] As a further optimized scheme of the present invention, the molecular marker includes the nucleotide sequence shown in SEQ ID NO.1, wherein the 154th base of the nucleotide sequence shown in SEQ ID NO.1 is C or T.

[0011] As a further optimized scheme of the present invention, the molecular marker includes the nucleotide sequence shown in SEQ ID NO.4, wherein the 89th base of the nucleotide sequence shown in SEQ ID NO.4 is C or T.

[0012] An application of a molecular marker for identifying the feed utilization trait of ducks based on ACLY gene in identifying the feed utilization trait of ducks.

[0013] A method for identifying the feed utilization trait of ducks using the above molecular marker, comprising the following steps:

[0014] (1) Extract the total DNA of the wing vein blood of the duck to be tested;

[0015] (2) Design specific amplification primers with the nucleotide sequence of the molecular marker as the target sequence, use the total DNA as the template, and perform PCR amplification with the specific amplification primers to obtain an amplification product containing the C2480989T site;

[0016] (3) Sequence or perform genotyping detection on the amplification product to obtain the molecular marker type of the duck to be tested;

[0017] (4)Judge the feed utilization trait of ducks according to the molecular marker type. If the molecular marker type of the duck to be tested is TT type, the feed utilization trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the feed utilization trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the feed utilization trait of this duck is medium.

[0018] As a further optimization scheme of the present invention, the sequence of the specific amplification primer is:

[0019] SEQ ID NO.2: Forward primer: GTGCTGACACAAACACCTCT;

[0020] SEQ ID NO.3: Reverse primer: TTAGGGTGAAACAGTATGAAGG.

[0021] As a further optimization scheme of the present invention, the genotyping detection method is to digest the amplified product with an enzyme to obtain a digested product, detect the digested product by agarose gel electrophoresis, and perform genotyping according to the image. If the digested product:

[0022] Contains 1 band, then it is TT type;

[0023] Contains 2 bands, then it is CC type;

[0024] Contains 3 bands, then it is CT type.

[0025] As a further optimization scheme of the present invention, use BsaA Type Ⅰ restriction endonuclease to digest the amplified product.

[0026] The present invention has the following beneficial effects:

[0027] By identifying the type of this molecular marker existing in the duck genome and selecting the feed utilization trait of ducks according to the genotype, the present invention establishes a breeding method for early selection of poultry feed utilization rate. This method is simple, fast, low-cost, and does not require special instruments, and is suitable for the needs of molecular marker-assisted breeding experiments. Description of the Drawings

[0028] Figure 1 It is the agarose gel electrophoresis pattern of the PCR amplification products of some samples;

[0029] Figure 2 It is the agarose gel electrophoresis pattern of the digested products obtained by digesting the PCR amplification products of some samples with an enzyme;

[0030] Figure 3 It is the sequencing result of the genotype verification at the C2480989T locus. Detailed Embodiments

[0031] The following further describes the present application in conjunction with the accompanying drawings. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present application and cannot be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0032] Example 1

[0033] 1. Materials

[0034] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art. The reagents and other materials used are commercially available products unless otherwise specified.

[0035] Methods

[0036] 2.1 Primer Design

[0037] Locate the locus where the molecular marker C2480989T of the present invention is located in the duck genome database. The gene corresponding to this locus is ACLY gene (Gene ID: 101793308, NC_051799.1). According to the known ACLY full-length DNA sequence of the gene, obtain the ACLY partial DNA sequence of the gene shown in SEQ ID NO.1 (a sequence composed of the locus where the molecular marker is located and its upstream and downstream bases. C2480989T is located at the 154th site of SEQ ID NO.1). Using the ACLY partial DNA sequence of the gene shown in SEQ ID NO.1 as a template, design specific amplification primers. The sequences of the specific amplification primers are as follows:

[0038] SEQ ID NO.2: Forward primer: GTGCTGACACAAACACCTCT;

[0039] SEQ ID NO.3: Reverse primer: TTAGGGTGAAACAGTATGAAGG.

[0040] The length of the amplifiable region of this primer is 377 bp. The amplified sequence is shown in SEQ ID NO.4 (C2480989T is located at the 89th site of SEQ ID NO.4), including the C / T mutation at the C2480989T locus.

[0041] 2.2 Extraction of Total Blood DNA

[0042] Select 408 Qiangying ducks, collect blood from the wing vein, extract total blood DNA, and use the blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. to extract the total DNA in the duck wing vein blood sample. The extraction steps can be carried out according to the kit instructions.

[0043] 2.3 PCR Amplification

[0044] Use the Mix produced by Shanghai Yisheng Biotech Co., Ltd. and perform PCR amplification reaction on the target fragment of the gene through the synthesized sequencing-specific primers. The PCR amplification system is shown in Table 1: ACLY The PCR amplification system is as follows:

[0045] Table 1 PCR Amplification System

[0046] ;

[0047] The PCR reaction conditions are as follows: pre-denaturation at 95 °C for 5 min; the first step: denaturation at 95 °C for 45 s; the second step: annealing at 55.2 °C for 45 s (the annealing temperature is set according to the primer); the third step: extension at 72 °C for 30 s. Among them, the second step to the third step are cycled 31 times, for a total of 32 cycles; extension at 72 °C for 10 min.

[0048] 2.4 Detection and Sequencing of PCR Amplification Products

[0049] Use 1.5% (mass ratio) agarose gel electrophoresis to detect the PCR amplification products. As Figure 1 shown, after imaging with a gel imager, a band with a length approximately 377 bp is obtained, which is consistent with the predicted length, indicating that the target fragment has been obtained. Send the PCR product to Beijing Qingke Biotech Co., Ltd. (Nanjing), and the sequence is as shown in SEQ ID NO.4, which is consistent with the predicted result.

[0050] 2.5 Genotyping

[0051] 2.5.1 Prepare the enzyme digestion system as shown in Table 2. The enzyme digestion condition is water bath at 37 °C for 1 hour, and use the restriction endonuclease of Beijing Biolegend Technology Co., Ltd. BsaA Ⅰ to digest the PCR amplification products;

[0052] Table 2 Enzyme Digestion System

[0053] ;

[0054] 2.5.2 Use 1.5% (mass ratio) low-voltage agarose gel electrophoresis for detection to obtain the results as Figure 2 shown (partial results); among them, if the enzyme digestion product: contains 1 band, it is TT type; contains 2 bands, it is CC type; contains 3 bands, it is CT type.

[0055] 2.6 Enzyme digestion sequencing verification

[0056] The agarose gel electrophoresis maps of gene enzyme digestion typing were statistically analyzed to obtain three types: TT, CT, and CC. One individual was selected from each of these three types for sequencing comparison. The sequencing comparison map is as Figure 3 shown. In the sequencing results, C mutated to T, and the mutation position was marked by an arrow, which was consistent with the enzyme digestion typing results.

[0057] 2.7 Effect verification

[0058] To determine the association between the C / T polymorphism at the C2480989T locus of the duck ACLY gene and important phenotypic traits of ducks, 408 Qiangying ducks in 2.2 were used as experimental materials, and the feed intake (ADFI), average daily gain (ADG), metabolic body weight gain (MBW 0.75 ), feed conversion ratio (FCR), and residual feed intake (RFI) from 21 to 42 days of age were statistically analyzed. Using the 2.5 gene typing method, 408 Qiangying ducks were genotyped. The results are shown in Table 3:

[0059] Table 3 Genotype detection results of individuals with different phenotypes

[0060] ;

[0061] Experimental conclusion: The chi-square test results showed that the genotypes of the experimental duck population were in Hardy-Weinberg equilibrium ( P >0.05).

[0062] 2.8 Statistical analysis

[0063] The least squares analysis method in SAS9.4 software was used to analyze the association between the three genotypes and the duck feed utilization traits. The results of the association analysis between different genotypes and each trait are shown in Table 4:

[0064] Table 4 Association analysis of duck ACLY genotype and duck feed utilization traits

[0065] ;

[0066] Note: Different lowercase letters in the same row indicate significant differences ( P <0.05), and different capital letters in the same row indicate extremely significant differences ( P <0.01).

[0067] Experimental conclusion: As can be seen from Table 4, for the ACLY gene at the C2480989T locus, the CC genotype individuals were extremely significantly lower than the CT and TT genotype individuals in the ADFI trait ( P<0.01); The CC type ducks were significantly lower than the CT and TT type ducks in terms of the FCR trait ( P <0.05), and the CT type ducks were significantly lower than the TT type ducks in this trait ( P <0.05); The RFI of the CC type ducks was extremely significantly lower than that of the CT and TT type ducks ( P <0.01), and the RFI of the CT type ducks was extremely significantly lower than that of the TT type ducks ( P <0.01); ACLY There were no significant differences in the BW 42 , ADG, and MBW 0.75 traits among the genotypes at the C2480989T locus of the gene ( P >0.05), indicating that the CC type was the favorable genotype.

[0068] The above-described embodiments only express several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A method based on ACLY The use of a molecular marker for genetically identifying a duck's feed utilization trait in identifying a duck's feed utilization trait is characterized in that: The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1 or SEQ ID NO.4, and the polymorphic site of the molecular marker is C2480989T, the base is C or T, and the C2480989T is located at the 154th position of the nucleotide sequence shown in SEQ ID NO.1 or the 89th position of the nucleotide sequence shown in SEQ ID NO.4; If the molecular marker type of the duck to be tested is TT type, the duck's feed utilization trait is poor; if the molecular marker type of the duck to be tested is CC type, the duck's feed utilization trait is the best; if the molecular marker type of the duck to be tested is CT type, the duck's feed utilization trait is medium, and the duck breed to be tested is Qiangying duck.

2. A method based on ACLY A method for identifying duck feed utilization traits using molecular markers of genes, characterized in that: The following steps are involved: (1) extracting total DNA from the wing vein blood of a duck to be tested, wherein the breed of the duck to be tested is Qiangying duck; (2) Designing specific amplification primers using the nucleotide sequence of the molecular marker as the target sequence, and using the total DNA as a template to perform PCR amplification using the specific amplification primers to obtain an amplification product containing the C2480989T polymorphic site, wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1 or SEQ ID NO.4, the C2480989T polymorphic site is located at the 154th position of the nucleotide sequence shown in SEQ ID NO.1 or the 89th position of the nucleotide sequence shown in SEQ ID NO.4, and the base is C or T; (3) Perform genotyping on the amplified product to obtain the molecular marker type of the duck to be tested; (4) The feed utilization trait of ducks was determined based on the molecular marker type. If the molecular marker type of the duck to be tested was TT type, the feed utilization trait of the duck was poor; if the molecular marker type of the duck to be tested was CC type, the feed utilization trait of the duck was the best; if the molecular marker type of the duck to be tested was CT type, the feed utilization trait of the duck was medium.

3. The method according to claim 2, characterized in that The sequence of the specific amplification primer is: SEQ ID NO.2: Forward primer: GTGCTGACACAAACACCTCT; SEQ ID NO.3: Reverse primer: TTAGGGTGAAACAGTATGAAGG.

4. The method according to claim 2, characterized in that: The genotyping detection method is to use Bsa I restriction endonuclease digests the amplified product to obtain digestion products, which are detected by agarose gel electrophoresis and genotyped according to the images. If the digestion products: If it contains 1 band, it is TT type; If it contains 2 bands, it is CC type; If it contains 3 bands, it is CT type.

Images