Indel molecular markers related to unsaturated fatty acid content in peony and their applications

Abstract

The present invention provides an Indel molecular marker related to the unsaturated fatty acid content of peony, and the nucleotide sequence of the Indel molecular marker is: ATGAGCCTTAGAATTGCAT. The present invention also provides the application of the Indel molecular marker in identifying or assisting in identifying the unsaturated fatty acid content of peony, analyzing and identifying peony germplasm resources, and molecular assisted genetic breeding. The present invention aims to screen key genes that regulate the synthesis of unsaturated fatty acids by detecting the unsaturated fatty acid accumulation pattern during the development process of oil-bearing peony seeds, analyzing the omics data of different developmental stages of seeds, and analyzing its regulatory factors and regulatory mechanisms through molecular biological means, in order to deeply analyze the laws of plant oil synthesis, and provide more gene resources for the molecular genetic breeding of oil-bearing peonies, and lay a foundation for further improving the oil quality of oil crops such as oil-bearing peonies.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular genetic breeding, and particularly relates to Indel molecular markers related to the unsaturated fatty acid content of peony and applications thereof. Background Art

[0002] Peony is a unique ethnic resource plant with ornamental, medicinal and oil value, and has a cultivation history of more than 1,600 years in my country. Oil-bearing peony has the characteristics of wide adaptability, high yield and high oil yield. Its seeds contain unsaturated fatty acids far higher than traditional oil crops, especially α-linolenic acid (ALA), a polyunsaturated fatty acid that is indispensable to the human body, cannot be synthesized by itself, cannot be replaced, and can only be absorbed from the outside. As a new type of woody oil crop, oil-bearing peony has received widespread attention. The development of the oil-bearing peony industry is of great significance in improving the diversity of my country's grain and oil demand and building a beautiful China.

[0003] Oil-bearing peony is one of the woody oil plant resources with the highest unsaturated fatty acid content discovered so far. Although it has become a research hotspot in recent years, research on it is still at the stage of omics detection and gene function verification, and there are still few reports on the analysis of the molecular regulatory mechanism of its high unsaturated fatty acid content.

[0004] Plant hormones participate in plant growth, development and life cycle, and function at the site of synthesis or are transported through the plant's vascular system to tissues far from the site of synthesis. They are both independent and synergistic. Plant hormones have been reported to participate in the development and synthesis of fatty acids in seeds of various crops such as rice. Although plant hormones have been confirmed to regulate seed fatty acid synthesis in a few species, in peonies, research on the effects of plant hormones on them has mainly focused on seed germination and seedling growth, early flowering, branch and leaf growth, petal shedding, etc. Little is known about how plant hormones regulate seed fatty acid synthesis and affect its components.

[0005] The quality of peony seed oil depends on the content and proportion of unsaturated fatty acids, and FAD2 located in the endoplasmic reticulum is the first step in the synthesis of polyunsaturated fatty acids, playing a key role in the synthesis of oleic acid (LA) and ALA. However, in peony, the research on this gene has only been partially reported in China, and is limited to the transcription level and preliminary functional analysis. Given the importance of FAD2 function, it is necessary to deeply analyze its function and its mechanism of unsaturated fatty acid synthesis in peony.

[0006] There are four FAD2 genes in peony, namely FAD2-1, FAD2-2, FAD2-3 and FAD2-4. △9 / C18:2 △9,12(oleic acid / linoleic acid; OA / LA) is highly related to FAD2-1, that is, among the four fatty acid dehydrogenases FAD2, FAD2-1 plays an important role in catalyzing the conversion of oleic acid (OA) to linoleic acid (LA). Therefore, the present invention chooses to perform functional analysis on the promoter of the FAD2-1 gene in different varieties. Summary of the invention

[0007] In order to solve the problems existing in the prior art, the present invention provides Indel molecular markers related to the content of unsaturated fatty acids in peony and applications thereof. The present invention focuses on the regulation of auxin on the synthesis of fatty acids in peony seeds.

[0008] The first object of the present invention is to provide an Indel molecular marker related to the unsaturated fatty acid content of peony, wherein the nucleotide sequence of the Indel molecular marker is: ATGAGCCTTAGAATTGCAT.

[0009] The Indel molecular marker is located on the promoter of the peony FAD2-1 gene.

[0010] The second object of the present invention is to provide a primer pair for detecting the above-mentioned Indel molecular marker, wherein the primer pair comprises a first round primer pair and a second round primer pair;

[0011] The first round primer pairs are:

[0012] FAD2pro-clone-F1:GGGAAGTATCATGATCATCCAATAAGAAGG;

[0013] FAD2pro-clone-R1:TAGGAGAATGAGTGAATGAGGGACC;

[0014] The second round primer pairs are:

[0015] FAD2pro-clone-F2:TTCCTTTTTTTTTTTGTTTCAAATGCACG

[0016] FAD2pro-clone-R2:TCACCAAGCGTGAATGGAGG.

[0017] The third object of the present invention is to provide a kit containing the above primer pair.

[0018] A fourth object of the present invention is to provide the use of the above-mentioned Indel molecular marker, primer pair or kit in any one of the following (1)-(4):

[0019] (1) Identify or assist in identifying the unsaturated fatty acid content of peony;

[0020] (2) Analysis and identification of peony germplasm resources;

[0021] (3) Molecular-assisted genetic breeding or genome editing breeding;

[0022] (4) FAD2-1 gene regulates or is used to initiate gene transcription.

[0023] Preferably, if the peony FAD2-1 promoter genome contains the Indel molecular marker, the peony unsaturated fatty acid content is low; if the peony FAD2-1 promoter genome does not contain the Indel molecular marker, the peony unsaturated fatty acid content is high;

[0024] As further preferred, the unsaturated fatty acid is linoleic acid.

[0025] The fifth object of the present invention is to provide a method for identifying or assisting in identifying the content of unsaturated fatty acids in peony, detecting the insertion or deletion of the above-mentioned Indel molecular marker in the FAD2-1 promoter of the peony to be identified. If the Indel molecular marker is present, the unsaturated fatty acid content of the peony is low; if the Indel molecular marker is not present, the unsaturated fatty acid content of the peony is high; preferably, the unsaturated fatty acid is linoleic acid.

[0026] Preferably, the above primer pair is used to perform nested PCR amplification to obtain the peony FAD2-1 promoter sequence to be identified;

[0027] Preferably, in step (1), the reaction procedure of the nested PCR is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 55-64°C for 25 s, extension at 72°C for 15 s / kb, 33 cycles; storage at 2°C for 5 min; the nested PCR reaction is divided into two rounds, and after the first round of PCR reaction, the PCR product is recovered using a DNA gel recovery kit, and the PCR product is diluted and then subjected to a second round of PCR reaction.

[0028] The sixth object of the present invention is to provide the use of the above-mentioned Indel molecular marker in inhibiting the transcriptional activity of FAD2-1 in peony germplasm.

[0029] The seventh object of the present invention is to provide the above-mentioned Indel molecular marker to inhibit the conversion of oleic acid to linoleic acid in peony by inhibiting the transcription activity of FAD2-1 in peony germplasm.

[0030] The eighth objective of the present invention is to provide an auxin response element CATATG GMSAUR that combines with an upstream transcription factor to inhibit the conversion of OA to LA in peony by inhibiting the transcriptional activity of peony germplasm FAD2-1.

[0031] The present invention aims to detect the unsaturated fatty acid accumulation pattern in the development process of oil-bearing peony seeds, analyze the omics data of different development stages of seeds, screen the key genes that regulate the synthesis of unsaturated fatty acids, and analyze the regulatory factors and regulatory mechanisms through molecular biological methods, so as to deeply analyze the laws of plant oil synthesis, provide a basis for the regulation of unsaturated fatty acid synthesis in oil-bearing peony, provide more gene resources and molecular markers for molecular genetic breeding, and lay a foundation for further improving the oil quality of oil crops such as oil-bearing peony. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0033] Figure 1 This is the analysis of cis-acting elements of FAD2-1 promoter in 'Fengdan'.

[0034] Figure 2 The following are the locations of InDel fragments in different peony germplasms with the promoter of the PoFAD2-1 gene of Fengdan as a reference. The fragments marked in red are the ones of particular interest.

[0035] Figure 3 pPoFAD2-1-ins d and pPoFAD2-1-ins d with 'Fengdan' pPoFAD2-1 as reference ▲ Insert sequence alignment.

[0036] Figure 4 The positions of auxin response elements in pPoFAD2-1-ins d. The elements in the boxes are the key elements.

[0037] Figure 5 This is the situation of the InDel fragment pPoFAD2-1-ins d of the FAD2-1 promoter in different peony germplasms.

[0038] Figure 6 LA and OA contents in peony germplasm with different types of FAD2-1 promoters.

[0039] Figure 7 PoFAD2-1, pPoFAD2-1 insd Promoter activity detection by in vivo imaging. DETAILED DESCRIPTION

[0040] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0041] Example 1

[0042] 1 Materials and methods

[0043] 1.1 Plant materials

[0044] Eight wild peony leaves, namely, P.ostii, P.qiui, P.decomposita, P.ludlowii, P.rockii, P.lutea, P.delavayi, and P.potaninii, were collected from Luoyang City, Henan Province, at 111.62° east longitude, 33.79° north latitude, and 342-1652m above sea level. They were collected in May 2023 and dried using color-changing silicon after picking for later use.

[0045] Leaves of 30 peony varieties were collected from Luoyang Academy of Agriculture and Forestry Sciences (longitude 112.49°, latitude 34.63°, altitude 114m-223m) in May 2023 and dried with color-changing silica gel for later use. All the names and numbers of peonies are shown in Table 1.

[0046] Table 1 Variety names and numbers of 38 peony materials

[0047] serial number Variety name abbreviation Variety name abbreviation 1 Sichuan Peony SC 21 Kao HW-1 2 Oval LY 22 Pink Jade Plate FYP-1 3 Large yellow peony DHH 23 Dark purple reflects gold MZYJ-1 4 Heavy Ink NMZC-1 24 pink lotus FH-1 5 Blue sea waves LHBB-1 25 Fruit on plate PZQG-1 6 Butterflies flying HDFW-1 26 Longyuan Red LYH-1 7 Pink Floor FLT-1 27 Blue Gold LJR-1 8 Pink Hibiscus FFR-1 28 Jincheng Blue JCL-1 9 Feng Dan FD 29 Black Whirlwind HXF-1 10 purple peony ZB 30 Pink crepe FZC-1 11 Purple Peony ZMD 31 Great achievements FGWJ-1 12 Yellow Peony HMD 32 Rose Purple MGZ-1 13 Paeonia suffruticosa XY 33 Ink is perfect MRJL-1 14 Blue Heart White QXB-1 34 Rose Gold MGSJ-1 15 Jingyu JY-1 35 Blue Jade Tricolor LYSC-1 16 Flesh Hibiscus RFR-1 36 Blue Sky Dream LTM-1 17 Azure Dragon Shining Gold Ink QLYJM-1 37 Chrysanthemum LJ-1 18 Autumn Moon over the Peaceful Lake PHQY-1 38 Red Concubine HGF-1 19 Linghuazhanlu LHZL-1 20 Blue Hibiscus LFR-1

[0048] The tobacco used in the experiment was wild-type Nicotiana benthamiana preserved in the laboratory.

[0049] 1.2 Extraction of Peony DNA

[0050] Peony DNA was extracted using the CTAB method. The CTAB lysis buffer used in this experiment was purchased from Beijing Coolable Technology Co., Ltd. (Coolaber). The BUFFERA used was prepared as follows (Table 2).

[0051] Table 2 BUFFERA preparation method

[0052]

[0053]

[0054] The extraction method of peony DNA is as follows:

[0055] (1) Fresh peony leaves were placed in a sealed bag containing 50 g of color-changing silica gel and dried for 24 h. During this period, the silica gel was replaced in time when it changed color.

[0056] (2) Weigh 20 mg of dried peony leaves and place them in a 2 ml centrifuge tube. Add a steel ball and grind them at 1500 rpm for 30 seconds using a high-throughput grinder (SCIENTZ-48L, purchased from Ningbo Xinzhi Biotechnology Co., Ltd.) to grind the leaves into powder;

[0057] (3) Add 1.5 mL of Buffer A to the centrifuge tube, invert and mix until the plant material powder is completely dissolved, place on ice for 10 min, and invert 2 to 3 times during this period to ensure that the precipitated powder is evenly distributed in Buffer A;

[0058] (4) After centrifugation at 12,000 g for 10 min, the supernatant was discarded;

[0059] (5) In a fume hood, add 800 μL of 2% CTAB solution to a centrifuge tube, vortex and suspend the precipitate in the centrifuge tube in the solution, and place the tube in an oven at 65°C for 1 h, inverting 2 to 3 times every 20 min; 2% CTAB was prepared according to Table 3.

[0060] (6) Take out the centrifuge tube and let it stand at room temperature, then add Buffer B solution (chloroform:isoamyl alcohol = 24:1), centrifuge and transfer the aqueous phase, and add Buffer B solution again;

[0061] (7) Add 400 μL of isopropanol (pre-cooled in a -20°C refrigerator for 2 h) to the centrifuge tube, invert to mix, and place the centrifuge tube in a -20°C refrigerator for 1 h;

[0062] (8) After centrifugation, a white DNA precipitate can be seen at the bottom of the 1.5 mL centrifuge tube. Use anhydrous ethanol to elute the DNA.

[0063] (9) Add 50 μL ddH2O to dissolve the DNA and mix well;

[0064] (10) Add 1 μL of RNase and incubate in a metal bath at 37°C for 30 min to decompose RNA.

[0065] Table 3 CTAB preparation method

[0066] Reagents Reaction system CTAB 2g NaCl 10mL 0.5M EDTA 1mL 1MTris-HCl(pH8.0) 1.46g β-Mercaptoethanol 2g <![CDATA[ddH2O]]> Make up to 100mL

[0067] 1.3 Cloning of the FAD2-1 promoter in tree peony

[0068] SnapGene and Primer Premier 5 were used to design primers with the FAD2-1 promoter sequence of 'Fengdan' as the reference sequence, and appropriate primers were selected for nested PCR reaction to clone the FAD2-1 promoters in different peonies. The FAD2-1 promoter was cloned by nested PCR. Among them, high-fidelity Taq enzyme was purchased from Beijing PolyBio Co., Ltd., and the PCR reaction system is shown in Table 4.

[0069] Table 4 PCR reaction system

[0070] system Dosage Template DNA 100ng 2×M5HiperplusTaqHiFiPCRmix 10μL Primer 1 (10 μM) 0.5μL Primer 2 (10 μM) 0.5μL <![CDATA[Nuclease-freeddH2O]]> Up to 20 μL

[0071] PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 55-64°C for 25 s, extension at 72°C for 15 s / kb, 33 cycles; storage at 2°C for 5 min.

[0072] The PCR products were electrophoresed at 160 V for 15 min using 1% gel and detected using a gel imaging system.

[0073] The nested PCR reaction was divided into two rounds. After the first round of PCR reaction, the PCR product was recovered using a DNA gel recovery kit, and the PCR product was diluted to 10 ng / μL before the second round of PCR reaction. The primer sequences used are shown in Table 5.

[0074] Table 5 Nested PCR primer sequences

[0075]

[0076] The PCR reaction products were subjected to gel electrophoresis detection and DNA gel recovery and then submitted to Qingke (Beijing) Biological Company for sequencing. The sequence obtained was aligned and analyzed using MEGA11, using the Clustal W method, and the DDC value was 30%.

[0077] 1.4 FAD2-1 promoter sequence analysis

[0078] The plant promoter online analysis website PlantCare (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) and New PLACE (https: / / www.dna.affrc.go.jp / PLACE / ?action=newplace) were used to analyze possible cis-acting elements. The cis-acting elements of the promoters of PoFAD2-1 and P. ovalifolia were screened and cleaned using EXCEL, and the cis-acting elements and their specific distribution locations were visualized using TBtoolsⅡ, and the results were beautified using AdobeIllustrator 2021.

[0079] 1.5PoFAD2-1 promoter fragment modification

[0080] The PqFAD2-1 promoter cloned from Paeonia ovata was used as a template to transform the PoFAD2-1 promoter by overlapping PCR. The fragment pPoFAD2-1-ins d obtained from Paeonia ovata was inserted into the corresponding position of the PoFAD2-1 promoter of Paeonia ovata to obtain pPoFAD2-1 insd .

[0081] Overlap PCR was performed using super-fidelity Taq enzyme, and primers were designed using SnapGene and Primer Premier 5. It was performed in two steps. In the first step, a promoter fragment containing complementary sticky ends was cloned from the promoter. The super-fidelity Taq enzyme PCR reaction system is shown in Table 6.

[0082] Table 6 Ultra-fidelity Taq enzyme PCR reaction system

[0083] system Dosage 2×MagicNeoPCRBuffer 12.5μL 2mM dNTPs 2.5μL Primer 1 (10 μM) 0.5μL Primer 2 (10 μM) 0.5μL Template DNA 100ng MagicNeoHigh-FidelityDNAPolymerase 0.5μL <![CDATA[ddH2O]]> Up to 25 μL

[0084] The primer sequences used are shown in Table 7. The PCR reaction procedure was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 25 s, annealing at 53-64°C for 25 s, extension at 68°C for 15 s / kb, 33 cycles; and storage at 68°C for 5 min.

[0085] The PCR products were electrophoresed using 1% gel at 160 V for 15 min and then placed on a gel imaging system for detection.

[0086] Table 7 Overlapping PCR primer sequences

[0087]

[0088] In the second step, the promoter fragments containing complementary sticky ends are connected, and the initial reaction system of super-fidelity Taq enzyme PCR is shown in Table 8.

[0089] Table 8 Ultra-fidelity Taq enzyme PCR initial reaction system

[0090] system Dosage 2×MagicNeoPCRBuffer 12.5μL 2mM dNTPs 2.5μL <![CDATA[pPoFAD2-1 insd -F]]> 10ng <![CDATA[pPoFAD2-1 insd -R]]> 10ng MagicNeoHigh-FidelityDNAPolymerase 0.5μL <![CDATA[ddH2O]]> Up to 25 μL

[0091] PCR reaction program: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 25 s, annealing at 55°C for 25 s, extension at 68°C for 45 s, 8 cycles; rapid addition of primers PoFAD2pro-F and PoFAD2pro-R, denaturation at 95°C for 25 s, annealing at 62°C for 25 s, extension at 68°C for 45 s, 25 cycles; extension at 68°C for 5 min.

[0092] The PCR reaction products were detected by gel electrophoresis and recovered from the gel.

[0093] 1.6 FAD2-1 promoter connected to T vector and transformed into Escherichia coli

[0094] The pEASY-Blunt Simple Cloning Kit from Beijing Quanshijin Biotechnology Co., Ltd. was used for T vector ligation, and Trans1-T1 Phage Resistant Chemically Competent Cell was used as the competent cell for E. coli. 20-50ng FAD2-1 recovery product (20ng for each kb of target gene length) and 1μL pEASY-BluntSimple Cloning Vector (10ng / μL) were used, and sterile water was added to make up to 5μL for T vector ligation. The E. coli transformation method is referenced to (Wang Ximeng, 2023).

[0095] 1.7 Escherichia coli single colony PCR

[0096] A single white colony was picked and cultured in LB liquid culture medium at 200 rpm and 37°C for about 6 h; high-fidelity Taq enzyme PCR reaction was used for identification, and the reaction system is shown in Table 9.

[0097] Table 9 High-fidelity Taq enzyme PCR reaction system

[0098] system Dosage Liquidculturesofmonoclonalcolony 0.5μL 2×M5HiperplusTaqHiFiPCRmix 5μL M13ForwardPrimer (10μM) 0.5μL M13ReversePrimer (10μM) 0.5μL <![CDATA[Nuclease-freeddH2O]]> 3.5μL

[0099] PCR reaction program: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 30 s, annealing at 55°C for 25 s, extension at 72°C for 15 s / kb, 33 cycles; extension at 72°C for 10 min.

[0100] Primer sequences:

[0101] M13 Forward Primer (10μM): GTAAAACGACGGCCAGT;

[0102] M13 Reverse Primer (10 μM): CAGGAAACAGCTATGAC.

[0103] The single colony liquid culture with correct sequencing results can be stored, and 50% glycerol and bacterial liquid are mixed in a volume ratio of 1:1 and stored in a -80°C refrigerator.

[0104] 1.8 Double restriction digestion vector

[0105] Snapgene was used to design the appropriate endonuclease on the vector, and the reaction system was configured according to the system shown in Table 10. The endonuclease was purchased from Beijing Bio-Rad Biotechnology Co., Ltd.

[0106] Table 10 Double enzyme digestion reaction system

[0107] system Dosage 10×Buffer 5μL Enzyme 1 (15U / μL) 1μL Enzyme 2 (15U / μL) 1μL Plasmids 2μg <![CDATA[ddH2O]]> Up to 50 μL

[0108] The reaction was carried out at 37°C for 3 hours. After the reaction was completed, 5 μL of 10× loading buffer was added to terminate the reaction and DNA was recovered. After recovery, the concentration was measured using Nanodrop2000 and the DNA was stored at -20°C for a long time.

[0109] 1.9 Construction of homology arms of FAD2-1 promoter

[0110] Snapgene was used to design homology arm primers, and super-fidelity Taq enzyme was used to perform homology arm construction PCR reaction, with the T vector constructed with the target gene as the template. The reaction system is shown in Table 11.

[0111] Table 11 PCR reaction system

[0112] system Dosage 2×MagicNeoPCRBuffer 12.5μL 2mM dNTPs 2.5μL pGreen-LUC-PoFAD2pro-F (10 μM) 0.5μL pGreen-LUC-PoFAD2pro-R (10 μM) 0.5μL TVectorPlasmid 100ng MagicNeoHigh-FidelityDNAPolymerase 0.5μL <![CDATA[ddH2O]]> Up to 25 μL

[0113] PCR reaction program: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 25 s, annealing at 55°C for 25 s, extension at 68°C for 15 s / kb, 33 cycles; extension at 68°C for 5 min.

[0114] Primer sequences:

[0115] pGreen-LUC-PoFAD2pro-F: GGCCCCCCCTCGAGGTCGACCCAAAATATTTCTTTTTTATACTAACAACC;

[0116] pGreen-LUC-PoFAD2pro-R:GCGGCCGCTCTAGAACTAGTTGTAAAAGGTAGGATCAGTTTCAAGCAAAG.

[0117] 1.10 Recombination of vector fragments

[0118] Use 2×Seamless Cloning Mix from Biomed Biotechnology, with a linearized vector dosage of 50-100 ng and a molar ratio of the target gene fragment to the vector fragment of 1:1. The PCR instrument was reacted at 50°C for 15 min. The vector fragment recombination ligation reaction system was prepared in a 200 μL centrifuge tube according to the system shown in Table 12.

[0119] Table 12 Vector fragment recombination ligation reaction system

[0120] system Dosage Target gene fragment XμL Linearized vector YμL (50~100ng) 2×SeamlessCloningMix 5μL <![CDATA[ddH2O]]> To10μL

[0121] 1.11 Dual luciferase reporter system

[0122] pPoFAD2-1pro, pPoFAD2-1 insd Connect to pGreenⅡ0800-LUC vector as a reporter and construct the vector. The experimental steps of the dual luciferase reporter system are as follows:

[0123] (1) PoFAD2-1 promoter (-9 to -2211 bp upstream of ATG), PqFAD2-1 promoter (-9 to -2512 bp upstream of ATG) and pPoFAD2-1 insd They were respectively connected into pGreenⅡ0800-LUC vector as reporters;

[0124] (2) The above four plasmids and the blank pGreenⅡ0800-LUC vector were transformed into Agrobacterium strain GV3101 (containing the auxiliary plasmid pSoup plasmid);

[0125] (3) Use PCR to detect positive colonies. After confirming that the plasmid is correct, culture 15 mL of positive Agrobacterium culture solution and centrifuge at 4000 rpm for 10 min to collect the bacteria;

[0126] (4) Prepare the injection buffer according to the system in Table 13, and adjust the pH to 5.7. Then resuspend the target gene Agrobacterium and P19 Agrobacterium in the injection buffer at a volume ratio of 1:1. Adjust the amount of injection buffer and Agrobacterium to the infection solution OD 600 =1.2. Place at 28℃ for 1h;

[0127] (5) Injection: Select healthy and uniformly growing Nicotiana benthamiana plants and inject different combinations of reporters into the back of the tobacco leaves. Use your thumb to press and fix the back of the leaf and the syringe. Slowly push the syringe at the bottom or middle of the back of the Nicotiana benthamiana, avoiding the leaf veins, and inject the injection buffer containing Agrobacterium into the interior of the Nicotiana benthamiana leaf. The back of the leaf will show 1m 2 Water stains of different sizes;

[0128] (6) After the injection, the Nicotiana benthamiana was cultured in the dark for 24 h, and then cultured under normal light for 48 h. The culture conditions were: 25°C, humidity 45±5%, 16 h light, 8 h dark;

[0129] (7) Tobacco in vivo imaging: In dark conditions, 1 mmol / L D-luciferin potassium salt (purchased from Beijing Coolbo Technology Co., Ltd.) was evenly sprayed on the back of the leaves as a luminescent agent, and the fluorescence was observed in the NightSHADE LB985 plant in vivo molecular imaging system (Berthold, Germany). The in vivo imaging results were visualized and analyzed using IndiGo.

[0130] Table 13 Concentration of components in injection buffer for transformed tobacco

[0131] Infectious fluid ingredients concentration MES-KOH 10mmol / L <![CDATA[MgCl2]]> 10mmol / L AS 200μmol / L

[0132] 1.12 Determination of seed fatty acids

[0133] The entire process of fatty acid extraction, methyl esterification and GC-MS analysis requires the use of glassware and operation in a fume hood.

[0134] 1.12.1 The fatty acid extraction method is as follows:

[0135] (1) The harvested peony seeds were placed in an oven at 70°C for 12 h, 0.5 g of seed kernels were weighed, placed in a 5 mL centrifuge tube, two 5 mm steel balls were added, and the tube was quickly immersed in liquid nitrogen, and ground at 1500 rpm for 60 s using a high-throughput grinder;

[0136] (2) Then weigh 0.1 g of ground seed kernels into a 10 mL conical bottom stoppered glass centrifuge tube, and set up 3 biological replicates for each treatment;

[0137] (3) Add 2 mL of Buffer M (chloroform: methanol = 1:2 (V / V)) to the test tube, add 1 mL of internal standard heptadecanoic acid methanol solution (1.5 mg / mL, dissolved in Buffer M), fill with nitrogen and vortex to mix thoroughly;

[0138] (4) Place the centrifuge tube at 4°C for 4 h, mixing by inverting it every 20 min to ensure that the sample is evenly distributed in the solution;

[0139] (5) Add 1 mL of chloroform to the centrifuge tube, mix well, then add 1.8 mL of KCl solution (concentration is 1 M), and vortex to mix thoroughly;

[0140] (6) Centrifuge the tube at 2,500 rpm for 10 min;

[0141] (7) 1 mL of the lower chloroform phase was taken and placed in a round-bottomed glass centrifuge tube with a stopper. The fatty acid extract was dried and concentrated using nitrogen gas and stored at -20°C for later use.

[0142] 1.12.2 The method for methyl esterification of fatty acids is as follows:

[0143] (1) The fatty acid extract was placed in a round-bottomed glass centrifuge tube with a stopper, and methyl esterification was performed according to the method of (Study on Comprehensive Evaluation of Oil Peony Fengdan Seed Quality, Men Siqi, 2019);

[0144] (2) adding a mixed solution of sulfuric acid and methanol (sulfuric acid: methanol = 5:95 (V / V)) to the fatty acid and incubating in a water bath at 90°C for 60 min for methyl esterification, and then adding 1 mL of ultrapure water and 1.5 mL of n-pentane to terminate the methyl esterification;

[0145] (3) Collect the fatty acid methyl esterified substances and store them at -20°C for future use.

[0146] 1.12.3 The GC-MS determination method of fatty acid methyl esters is as follows:

[0147] After the fatty acid methyl esterification, the sample was dissolved in 5 mL of n-hexane, and 1 mL of the sample solution was taken into a brown short-threaded wide-mouth sample bottle for analysis. The use of GC-MS instrument, procedures, and data analysis refer to (Study on Comprehensive Evaluation of Oil Peony Fengdan Seed Quality, Men Siqi, 2019). The analysis system used was an Agilent 7000C triple tandem quadrupole mass spectrometer, and the chromatographic column used was an HP-88 polysiloxane polymer chromatographic column (30m×0.25mm, 0.20μm), both produced by Agilent Technologies (China) Co., Ltd. Qualitative analysis was performed by searching the NIST05 Library standard spectral library combined with standard comparison.

[0148] 1.13 Correlation analysis between FAD2-1 promoter InDel fragment and unsaturated fatty acids

[0149] The nucleotide sequences of the 38 cloned FAD2-1 promoter sequences were aligned using MEGA11, and the correlation between the percentage of LA and OA in total unsaturated fats in different peony germplasms and InDel fragments was analyzed using the Two-way ANOVA method of Graphpad Prism 9. The bar graph and sequence diagram were made using Adobe illustrator.

[0150] 2 Results and discussion

[0151] 2.1 Analysis of the promoter sequence of FAD2-1 gene in different peony germplasms

[0152] 2.1.1 Analysis of promoter cis-acting elements

[0153] Fengdan is widely cultivated due to its high oil content and is the most important variety of oil-bearing peony. The present invention clones and focuses on analyzing the cis-acting element of the FAD2-1 gene promoter of Fengdan. In the PoFAD2-1 promoter, in addition to a large number of enhancer-related cis-acting elements, it also contains a variety of important cis-acting elements, such as the abscisic acid response element ABRE (ACGTG), the gibberellin response element P-box (CCTTTTG), the methyl jasmonate response element TGACG-motif, CGTCA-motif, the light response element G-box (CACGTT / CACGAC / CACGTC), GT1-motif (GGTTAA), Sp1 (GGGCGG), MRE (AACCTAA), Box4 (ATTAAT), AE-box (AGAAACA), BoxⅡ (ACACGTTGT), TCT-motif (TCTTAC), GA-motif (ATAGATAA), the zinc metabolism regulatory element O2-site (GATGA(C / T)(A / G)TG(A / G)), and the drought-induced response element MBS (CAACTG), see Figure 1 .

[0154] The nucleotide sequence amplified by nested PCR (containing the nucleotide sequence of the FAD2-1 promoter and part of the coding region) is as follows (SEQ ID NO.1 in the sequence table):

[0155]

[0156]

[0157] The bold part is the nucleotide sequence of part of the coding region, and the underlined part (ie ATG) is the start codon ATG of the coding region. In the following analysis of insertion and deletion fragments, the position of each insertion and deletion fragment is determined based on the start codon ATG.

[0158] Figure 1 This is the analysis of cis-acting elements of FAD2-1 promoter in 'Fengdan'.

[0159] 2.1.2 Analysis of insertion and deletion fragments

[0160] The FAD2-1 gene promoters of 38 peony germplasms were cloned, and the PoFAD2-1 promoter was used as the reference sequence. The results of comparison and analysis showed that there were insertions and deletions at 6 positions in the FAD2-1 promoter in different peony germplasms ( Figure 2 ), the InDel fragments at these 6 positions were named a to f in order from 5' to 3' end, including a 2 bp insertion at -1117 bp upstream of the start codon ATG in pPoFAD2-1-ins a, a 26 bp deletion at -929 bp in pPoFAD2-1-del b, a 5 bp deletion at -693 bp in pPoFAD2-1-del c, a 19 bp insertion at -664 bp in pPoFAD2-1-ins d, a 10 bp insertion at -130 bp in pPoFAD2-1-ins e, and a 304 bp insertion at -100 bp in pPoFAD2-1-insf.

[0161] It is worth noting that the second type of InDel fragment pPoFAD2-1-ins d appeared in different peony germplasms, which was a 21 bp insertion and was named pPoFAD2-1-ins d ▲ , compared with pPoFAD2-1-ins d, it has 2 more bases ( Figure 3 ).

[0162] The nucleotide sequence of the InDel fragment pPoFAD2-1-ins d is:

[0163] ATGAGCCTTAGAATTGCAT.

[0164] InDel fragment pPoFAD2-1-ins d ▲ The nucleotide sequence is:

[0165] TGAGCTCCATACGCGTGTGCA.

[0166] Figure 2 The following are the locations of InDel fragments in different peony germplasms with the promoter of the PoFAD2-1 gene of 'Fengdan' as a reference. The fragments marked in red are the ones of particular interest.

[0167] Figure 3 pPoFAD2-1-ins d and pPoFAD2-1-ins d with 'Fengdan' pPoFAD2-1 as reference ▲ Insert sequence alignment.

[0168] The cis-acting elements contained in the InDel fragments pPoFAD2-1-ins a, pPoFAD2-1-del b, pPoFAD2-1-del c, pPoFAD2-1-ins d, pPoFAD2-1-ins e, and pPoFAD2-1-insf at six positions on the FAD2-1 promoter were further analyzed. Interestingly, the insertion fragment pPoFAD2-1-ins d contains multiple cis-acting elements, which may affect the promoter activity of FAD2-1 and the interaction between other transcription factors and FAD2-1. In some peony germplasms, such as the FAD2-1 promoter of peony ovalifolia (P.qiui), the insertion sequence pPoFAD2-1-ins d contains the auxin response element CATATGGMSAUR (CATATGG), and another type of InDel fragment pPoFAD2-1-ins d ▲ This element is not included. This indicates that auxin may affect its transcriptional activity by interacting with the InDel fragment pPoFAD2-1-ins d. Therefore, the present invention chose to further study the molecular mechanism by which auxin may affect fatty acid synthesis in peony seeds through FAD2-1 in subsequent work.

[0169] Figure 4 The position of the auxin response element in pPoFAD2-1-ins d. The elements in the box are the key elements. 2.2 Analysis of the association between the sequence variation of the InDel fragment pPoFAD2-1-insd and the fatty acid content of different peony germplasms. The FAD2-1 promoter of 'Fengdan' was used as the reference sequence to clone the FAD2-1 promoter of 38 peony germplasms. Two types of insertion fragments, pPoFAD2-1-ins d and pPoFAD2-1-ins d, appeared at -664 bp upstream of ATG in different germplasms. ▲ The two insertion fragments were similar in sequence, but contained several SNP sites. Through MEGA comparison, it was found that 7 peony accessions contained the fragment pPoFAD2-1-ins d at -664bp upstream of ATG, 17 peony accessions had no InDel fragment at -664bp consistent with Fengdan, and 14 peony accessions contained the fragment pPoFAD2-1-ins d at this location. ▲ . See Figure 5 .

[0170] Figure 5 This is the situation of the InDel fragment pPoFAD2-1-ins d of the FAD2-1 promoter in different peony germplasms.

[0171] The fatty acid data of different peony germplasms (see Table 14) were combined with the InDel fragment at -664 bp upstream of ATG for statistical analysis. The results showed that the fatty acid composition of the germplasm containing the fragment pPoFAD2-1-ins d of the FAD2-1 promoter was different from that of the germplasm containing pPoFAD2-1-ins d ▲ Compared with the fatty acid components of germplasm without InDel fragment, the OA content was higher and the LA content was lower. It is speculated that the InDel fragment may affect the transcriptional activity of FAD2-1, thereby affecting the conversion of OA to LA in peony seeds.

[0172] Figure 6 The content of LA and OA in peony germplasm with different types of FAD2-1 promoters. Specifically, the InDel fragment of -664bp upstream of ATG in peony germplasm with different types of FAD2-1 promoters: pPoFAD2-1-ins d is peony germplasm containing pPoFAD2-1-ins d fragment, no indel is peony germplasm without InDel fragment, pPoFAD2-1-ins d ▲ To contain pPoFAD2-1-ins d ▲ Fragment of peony germplasm.

[0173] Table 14 The percentage of OA and LA in total unsaturated fatty acids in different peony germplasms

[0174]

[0175]

[0176] 2.3 Effect of InDel fragment pPoFAD2-1-ins d on FAD2-1 promoter activity

[0177] In order to clarify the effect of pPoFAD2-1-ins d on the activity of FAD2-1 promoter and exclude the influence of other SNPs on the activity detection results, pPoFAD2-1-ins d was inserted into the corresponding position of PoFAD2-1 promoter by overlapping PCR to obtain pPoFAD2-1 insd , and further explore its activity.

[0178] The above promoter was connected to the pGreenⅡ0800-LUC vector to obtain pPoFAD2-1 insd ::LUC, and co-injected with empty vector into tobacco for transient expression to detect promoter activity, and compared with Fengdan promoter pPoFAD2-1::LUC. The results showed that pPoFAD2-1 insd The promoter activity was significantly lower than that of pPoFAD2-1 ( Figure 7 ).

[0179] Figure 7 PoFAD2-1, pPoFAD2-1 insd In vivo imaging of promoter activity detection. A is the dual luciferase reporter system to detect different promoter activities, LUC is pGreenⅡ0800-LUC empty vector; B is the schematic diagram of the reporter and empty vector design; multiple comparisons P<0.05.

[0180] 3 Summary and discussion

[0181] 3.1 Summary

[0182] The present invention cloned and analyzed the FAD2-1 promoter of different peony germplasms and analyzed the sequence:

[0183] (1) The FAD2-1 promoters of different peony germplasms contain cis-acting elements that respond to hormones such as gibberellins, auxins, and abscisic acid. pPoFAD2-1-ins d contains an auxin-responsive element, CATATGGMSAUR (CATATGG).

[0184] (2) It was found that the InDel fragment pPoFAD2-1-ins d has three subtypes, and different subtypes are related to the fatty acid content of peony germplasm. pPoFAD2-1-ins d also contains another type pPoFAD2-1-ins d ▲ , but pPoFAD2-1-insd ▲ The auxin response element CATATGGMSAUR was not included. The three subtypes at -664 bp upstream of ATG were correlated with the fatty acid content of different varieties of peony. The results showed that the variety of peony containing the inserted fragment pPoFAD2-1-ins d had a higher OA content and a lower LA content.

[0185] (3) The InDel fragment pPoFAD2-1-ins d was complemented into the Fengdan FAD2-1 promoter to form a new promoter pPoFAD2-1 insd The results showed that pPoFAD2-1 insd The promoter activity was significantly decreased compared with that of pPoFAD2-1.

[0186] 3.2 Discussion

[0187] Cis-acting elements play an important role in the transcription level and specific expression of genes. Combined with the results of the association analysis between the three subtypes of pPoFAD2-1-ins d and the fatty acid content of different peony germplasms, it is speculated that the auxin response element CATATG GMSAUR on the InDel fragment may bind to the upstream transcription factor, inhibiting the transcriptional activity of FAD2-1 in different peony germplasms, thereby affecting the conversion of OA to LA in the seeds of different peony germplasms. Therefore, in the subsequent work of the present invention, the focus is on the effect of auxin on the synthesis of fatty acids in peony seeds, especially the desaturase FAD2-1.

[0188] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An Indel molecular marker for assisting identification of linoleic acid content in peony, characterized in that: The nucleotide sequence of the Indel molecular marker is: ATGAGCCTTAGAATTGCAT.

2. A primer pair for detecting the Indel molecular marker according to claim 1, characterized in that: The primer pairs include a first-round primer pair and a second-round primer pair; The first round primer pairs are: FAD2pro-clone-F1:GGGAAGTATCATGATCATCCAATAAGAAGG; FAD2pro-clone-R1:TAGGAGAATGAGTGAATGAGGGACC; The second round primer pairs are: FAD2pro-clone-F2:TTCCTTTTTTTTTTTGTTTCAAATGCACG FAD2pro-clone-R2:TCACCAAGCGTGAATGGAGG.

3. A kit comprising the primer pair according to claim 2.

4. Use of the Indel molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in any one of the following (1) to (4): (1) Identify or assist in identifying the linoleic acid content in peony; (2) Analysis and identification of peony germplasm resources; (3) Peony molecular-assisted genetic breeding or genome editing breeding; (4) Regulation of peony FAD2-1 gene expression.

5. The use according to claim 4, characterized in that: If Peony FAD2-1 If the promoter genome contains the Indel molecular marker, the linoleic acid content of peony is low; FAD2-1 If the Indel molecular marker does not exist in the promoter genome, the peony linoleic acid content is high.

6. A method for identifying or assisting in identifying the linoleic acid content of peony, characterized in that: Testing of Peonies to be Identified FAD2-1 The insertion or deletion of the Indel molecular marker of claim 1 in the promoter, if the Indel molecular marker exists, the peony linoleic acid content is low; if the Indel molecular marker does not exist, the peony linoleic acid content is high.

7. The method according to claim 6, characterized in that: The primer pair described in claim 2 is used for nested PCR amplification to obtain the peony to be identified. FAD2-1 Promoter sequence; The reaction procedure of the nested PCR is as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 55-64°C for 25 s, extension at 72°C for 15 s / kb, 33 cycles; storage at 2°C for 5 min; the nested PCR reaction is divided into two rounds, and after the first round of PCR reaction, the PCR product is recovered using a DNA gel recovery kit, and the PCR product is diluted and then subjected to the second round of PCR reaction.

8. The Indel molecular marker of claim 1 is used to inhibit the growth of peony germplasm FAD2-1 application in transcriptional activity.

Images