An Indel molecular marker related to maize drought resistance and its application
By developing Indel molecular markers related to corn drought resistance and using the ZmSHH2 gene, the problem of mining drought resistance genes in the existing technology was solved, and effective screening and identification of corn drought resistance and yield was achieved.
Patent Information
- Application Number
- CN202410672535.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2044-05-28
AI Technical Summary
The prior art is difficult to effectively explore genes related to corn drought resistance, especially in the regulation of histone methylation, and lack of relevant Indel molecular markers, which affects corn drought tolerance and yield.
An Indel molecular marker related to corn drought resistance was developed, and corn materials with drought resistance were screened through PCR amplification technology using the DNA methylation regulator ZmSHH2.
The Indel molecular marker is significantly related to the yield traits of corn under drought conditions and can be used to screen drought-resistant corn materials, promote the assisted breeding of corn molecules and the identification of high-quality germplasm resources.
Smart Images

Figure CN118460780B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to an Indel molecular marker related to maize drought resistance and its application. Background Art
[0002] Maize (Zea mays L.) is an important crop in China for food, economy and feed. The production and sustainable development of maize are crucial for China's food security. Drought is one of the main abiotic factors leading to crop yield reduction. For maize, the seasonal drought stress faced before and after sowing, tasseling and silking is particularly severe. Therefore, exploring maize drought-related genes and studying the drought tolerance mechanism of drought-resistant genes are of great significance for improving maize drought tolerance and yield and ensuring future food security. Indels (insertions / deletions) are an important molecular genetic marker, which have the advantages of wide distribution and convenient detection, and are also of great significance for maize molecular breeding.
[0003] In recent years, a series of drought tolerance-related genes such as ZmDREB2.7, ZmNAC111, ZmSRO1d, ZmVPP1, ZmEXPA4, ZmPP2C, ZmTIP1, and ZmLBD5 have been cloned in maize. The differences in plant drought tolerance are mainly caused by changes in gene transcription levels. The latest research findings show that not only the differences in gene transcription levels but also the post-transcriptional modification levels of genes play important roles in plant growth, development, and stress responses. Histone modification is the main post-transcriptional modification, including methylation, phosphorylation, acetylation, crotonylation, ubiquitination, glycosylation, ADP-ribosylation, and other modification forms. Histone methylation is one of the main histone modifications, which is catalyzed by histone methyltransferases (HMTs) to transfer methyl groups (using S-adenosylmethionine (SAM) as the methyl donor) to the lysine residues of histone H3 and H4, and can respectively carry out monomethylation (me1), dimethylation (me2), and trimethylation (me3) of histone lysine residues. Current research shows that the modifications of H3K4, H3K36, and H3K79 at the N-terminal tail of histone H3 are considered active marks, usually associated with gene expression activation; the modifications of H3K9 and H3K27 at the N-terminal of histone H3 are called repressive marks, usually associated with gene silencing expression and chromatin condensation. Histone demethyltransferases (HDMs) have the opposite effect to transferases. Currently, two evolutionarily conserved histone demethylase families have been identified: the lysine-specific demethylase (LSD) and the Jumonji C (JMJC) protein family, which use different reaction mechanisms to demethylate. The LSD protein family consists of LSD1 and LSD2, which demethylate mono- and dimethylated lysine residues through a flavin adenine dinucleotide-dependent amine oxidase reaction. Among them, LSD1 (KDM1A) is the first discovered histone lysine demethylase (KDM), which catalyzes the demethylation of H3K4me1 / 2 and H3K9me1 / 2. The recognition of histone methylation is achieved through proteins with methyl-binding domains, and these binding domains include ADD, Ankyrin, BAH, Chromobarrel, Chromodomain, Double Chromodomain (DCD), MBT, PHD, PWWP, TTD, Tudor, WD40, and zf-CW. Currently, there is no report on the regulation of histone methylation modification on maize drought tolerance.The present invention aims to develop Indel molecular markers related to maize drought resistance based on the DNA methylation regulator ZmSHH2, so as to provide a theoretical basis and technical support for maize stress-resistant molecular marker-assisted breeding. Summary of the Invention
[0004] The object of the present invention is to provide an Indel molecular marker related to maize drought resistance and its application to solve the problems existing in the above-mentioned prior art. This Indel molecular marker is significantly correlated with the yield traits (single ear weight and grain weight per ear) of maize plants under drought conditions and can be used to screen maize materials with drought resistance.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides an Indel molecular marker related to maize drought resistance, and the nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO.4.
[0007] The present invention also provides a primer pair for amplifying the above Indel molecular marker, including primers with nucleotide sequences as shown in SEQ ID NOs.1-2.
[0008] The present invention also provides the application of the above primer pair in the preparation of a kit for identifying maize drought resistance.
[0009] The present invention also provides a kit for identifying maize drought resistance, including the above primer pair.
[0010] Further, the kit also includes 2×Rapid taq Master PCR mix.
[0011] The present invention also provides the application of the above Indel molecular marker in identifying maize drought resistance.
[0012] The present invention also provides the application of the above primer pair or kit in identifying maize drought resistance.
[0013] The present invention also provides a method for identifying maize drought resistance, including the following steps:
[0014] Extract the genomic DNA of the maize sample to be tested;
[0015] Using the genomic DNA as a template, perform PCR amplification with the above primer pair to obtain an amplification product; when the amplification product contains an amplification fragment as shown in SEQ ID NO.4, it indicates that the maize sample to be tested has high drought resistance.
[0016] Further, the reaction system for PCR amplification is as follows: 10 μL of 2×Rapid taq Master PCR mix, 0.4 μL each of upstream and downstream primers, 1 μL of DNA template, and 8.2 μL of double-distilled water.
[0017] Further, the reaction procedure for PCR amplification is as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 15 s, for 30 cycles; extension at 72°C for 5 min.
[0018] The present invention discloses the following technical effects:
[0019] The Indel molecular marker provided by the present invention is significantly correlated with the yield traits (single ear weight and grain weight per ear) of maize plants under drought conditions. The 34-bp Indel (deletion / insertion) can affect the yield traits such as single ear weight and grain weight per ear of maize. This Indel molecular marker can be used to screen maize materials with drought resistance. The Indel molecular marker of the present invention can also be used for maize molecular assisted breeding and identification of high-quality germplasm resources, thus facilitating the creation of drought-tolerant maize materials and the breeding process of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0021] Figure 1 PCR amplification results in different maize materials; among them, A is the DNA sequence alignment analysis diagram of different maize materials; B is the electrophoresis diagram of PCR amplification using different maize material DNAs as templates, and M represents Marker (DL2000);
[0022] Figure 2 Difference analysis diagram of the yield traits of different haplotype maize materials; among them, A - C are the ear pictures of some maize materials of type 0, Indel type, and heterozygous type respectively; D is the statistical chart of the single ear weight trait of different genotype maize materials; E is the statistical chart of the grain weight per ear trait of different genotype maize materials; WW: normal irrigation group; WS: drought and water shortage group; ** Represents P < 0.01; *** Represents P < 0.001. DETAILED DESCRIPTION OF THE INVENTION
[0023] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be construed as a limitation on the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0025] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0026] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0027] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0028] The different maize inbred line materials used in the embodiments of the present invention, such as the drought-tolerant maize inbred line P1 (AC7643), the drought-sensitive inbred line P2 (AC7729 / TZSRW), and the maize inbred line KN5585, etc., were all collected and preserved by Sichuan Agricultural University. The 336 drought population materials used in the following examples are shown in Table 1 and were all provided by the Germplasm Resource Bank of the Maize Research Institute of Sichuan Agricultural University, and it is promised to be open to the public within 20 years from the filing date of the present invention application.
[0029] Table 1 336 drought population materials
[0030]
[0031]
[0032] Example 1
[0033] Sequence alignment analysis through the MaizeGDB database revealed that there is an Indel mutation in the promoter region of the maize ZmSHH2 gene, located at position 179193995 on chromosome 2, with an allele of 34 bp insertion / deletion (genome version MaizeB73AGP_v3). The nucleotide sequence of this 34 bp is as follows: ATTGTTAAATTATTGCCAAACCAACTGTGATTTA (SEQ ID NO.3).
[0034] For the 336 drought population materials shown in Table 1, genotyping detection was carried out as follows:
[0035] Using maize DNA as a template, PCR amplification was performed with Novoprotein's 2×RapidTaq MasterMix. The reaction system for PCR amplification was: 2×Rapidtaq Master PCR mix 10 μL, both upstream and downstream primers 0.4 μL, DNA template 1 μL, and supplemented with 8.2 μL of double-distilled water to make up 20 μL. The reaction program was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 15 s, for a total of 30 cycles; incubation at 72°C for 5 min.
[0036] The PCR products were detected by agarose gel electrophoresis. Some of the detection results are as Figure 1 shown. It can be seen that in some of the drought population materials shown, according to this Indel mutation, the population can be divided into three genotypes, namely type 0 (Indel deletion homozygous type), Indel type (Indel insertion homozygous type), and heterozygous type. Figure 1 Among them, W64A1, PHT22, M14, MP064, NC338, FB091, P1, and KN5585 are of type 0; BP094A, FH258, Pa875, and R177 are heterozygous; P2, GT112, Hi27, and H95 are of Indel type.
[0037] The primer pairs used for the above genotyping detection are as follows:
[0038] SHH2-indel-up: 5’-GCACCATTTGCATTCGC-3’ (SEQ ID NO.1);
[0039] SHH2-indel-dn: 5’-GGCCATAAAAATGTCACC-3’ (SEQ ID NO.2).
[0040] The amplified fragment is as follows:
[0041] Amplification of full length 1 (Indel deletion, 141bp):
[0042] GCACCATTTGCATTCGCATAATAAAGCTCTAATATGAAGTATTGGATATCTCGTTATTG AATTCAGTTTATTTATATCTTTAATGTATTGTTAAATTATTGCCAAACCAACTGTGATTTAA AAGGTGACATTTTTATGGCC (SEQ ID NO.4).
[0043] Amplification of full length 2 (Indel insertion, 175bp):
[0044] GCACCATTTGCATTCGCATAATAAAGCTCTAATATGAAGTATTGGATATCTCGTTATTG AATTCAGTTTATTTATATCTTTAATGTATTGTTAAATTATTGCCAAACCAACTGTGATTTAAT TGTTAAATTATTGCCAAACCAACTGTGATTTAAAAGGTGACATTTTTATGGCC (SEQ ID NO.5).
[0045] The genotyping test results of 336 drought population materials were analyzed for correlation with the drought tolerance and yield (single ear weight, kernel weight per ear) trait data of maize under adult stage drought conditions (see Figure 2 and Table 2). The results showed that the drought tolerance in the field of maize materials with heterozygous and 0 genotypes was significantly higher than that of the Indel type; the ear seed setting rate of maize materials with heterozygous and 0 genotypes was significantly higher than that of the indel type; at the same time, the yield (single ear weight, singleEarweight(g), heterozygous P = 0.0337, 0 type P = 0.0031; kernel weight per ear, Kernelweight(g), heterozygous P = 0.0012, 0 type P = 0.0022, t-test) of maize materials with heterozygous and 0 genotypes was also significantly different from that of the Indel type plants.
[0046] Table 2 Drought tolerance and yield (single ear weight, kernel weight per ear) trait data of maize under adult stage drought conditions
[0047] Genotype Single ear weight (g) Grain weight per ear (g) Type 0 39.58934473 31.42920228 Heterozygous type 42.58878205 36.40608974 Indel type 37.24049296 29.07077465
[0048] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should all fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of a primer pair in preparing a kit for identifying drought resistance of corn, characterized in that: The primer pair is used to amplify Indel molecular markers related to drought resistance of maize, and the primer pair includes primers whose nucleotide sequences are shown in SEQ ID NO.1-2; The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.
4.
2. An application of an Indel molecular marker related to maize drought resistance in identifying maize drought resistance, characterized in that: The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.
4.
3. Use of a primer pair or a kit in identifying drought resistance of corn, characterized in that: The primer pair includes primers whose nucleotide sequences are shown in SEQ ID NO.1-2; The kit includes the primer pair.
4. The use according to claim 3, characterized in that: The kit also includes 2×Rapidtaq MasterPCR mix.
5. A method for identifying drought resistance of corn, characterized in that: The following steps are involved: Extracting genomic DNA from the corn sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using a primer pair to obtain an amplified product; when the amplified product contains an amplified fragment as shown in SEQ ID NO.4, it indicates that the drought resistance of the corn sample to be tested is high; The primer pair includes primers whose nucleotide sequences are shown as SEQ ID NO.1-2.
6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 10 μL of 2×RapidtaqMaster PCRmix, 0.4 μL of upstream and downstream primers, 1 μL of DNA template and 8.2 μL of double distilled water.
7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 15 s, 30 cycles; and 72°C for 5 min.