Application of LTP15 gene in regulating fatty acid composition of rapeseed

Abstract

The application discloses application of BnaLTP15 gene in regulation of components of rapeseed fatty acid, and the nucleotide sequence of the gene is shown as SEQ ID NO:1. Through obtaining overexpression and mutant materials, the content of the fatty acid components of mature seeds in the genetically transformed materials is analyzed, and it is found that BnaC02.LTP15 can positively regulate the content of oleic acid and negatively affect the content of erucic acid. The gene will provide a theoretical basis and resources for rapeseed variety fatty acid improvement, achievement transformation and oil molecular marker breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and molecular breeding, and relates to application of LTP15 gene in regulating fatty acid composition of Brassica napus. BACKGROUND

[0002] Oil and fat are collectively referred to as oil, which is an important storage material in plant seeds and plays an important role in food supply, industrial raw materials and renewable energy. With the growth of world population and the promotion of industrialization, the demand for vegetable oil is rising. With the increasing recognition of healthy diet, in addition to pursuing high oil content, reasonable fatty acid composition is also an important goal of Brassica napus variety improvement. According to the data statistics of vegetable oil consumption in recent years, the global vegetable oil consumption mainly comes from monocotyledon palm (36.2%) and dicotyledon soybean (28.6%), Brassica napus (13.3%), sunflower (9.1%), peanut (3%) and the like. Among them, palm oil and palm kernel oil are rich in saturated fatty acids accounting for about 50% and 80% of the total fatty acid content, which seriously endangers human health. Therefore, although the annual consumption of palm oil and palm kernel oil is high, it is mainly used in industrial processing rather than in edible oil field. The oleic acid content in rapeseed oil on the market accounts for about 60% of the total fatty acid content, the linoleic acid content is about 20%, the linolenic acid content is about 10%, and the saturated fatty acid and erucic acid contents are very low. At present, double-low rapeseed oil is internationally recognized as the most beneficial to human health bulk edible vegetable oil.

[0003] With the deepening of the research of oil metabolism, at least 700 genes involved in oil metabolism have been found in Arabidopsis. The carbon source of plant seed oil synthesis metabolism is mainly sucrose. In plants, plastids and endoplasmic reticulum are the main sites of fatty acid metabolism. 6-phosphogluconate (G6P), 3-phosphoglyceraldehyde (GAP) and the like are converted into pyruvic acid (PEP) in the cytoplasm by glycolysis, enter the mitochondria, and pyruvic acid undergoes tricarboxylic acid cycle (TCA) to form dihydroxyacetone phosphate (DHAP) and acetyl-CoA, which are the raw materials for TAG synthesis. In the process of de novo fatty acid synthesis, acetyl-CoA carboxylase (ACCase) is a key enzyme for catalyzing fatty acid biosynthesis. Under the catalysis of ACCase, acetyl-CoA is converted into malonyl-CoA (MAT). Under the action of fatty acid synthase complex (FAS), ACP is used as the center, and through the cyclic polymerization reaction of carbon chain extension such as condensation, reduction, dehydration and reduction, 16:0-ACP and 18:0-ACP are synthesized. Under the action of stearoyl-ACP desaturase (SAD), 18:0-ACP generates 18:1-ACP. Then, under the action of acyl-ACP thioesterase (FAT) and long-chain acyl-CoA synthetase (LACS), fatty acids are released from the medium fatty acyl-ACP and acyl-CoA is synthesized. Among them, FATA catalyzes 18:1-ACP to synthesize unsaturated 18:1 CoA, and FATB catalyzes 16:0-ACP and 18:0-ACP to synthesize saturated 16:0-CoA and 18:0-CoA.

[0004] Acyl-CoA enters the endoplasmic reticulum from the plastid, and further TAG synthesis is carried out on the endoplasmic reticulum by 3-phosphoglycerol acyltransferase (GPAT), lysophosphatidic acid acyltransferase (LPAT) and diacylglycerol acyltransferase (DGAT). Glycerol-3-phosphate acyltransferase (GPAT) is located on the endoplasmic reticulum in cells, and acts together with another lysophosphatidic acid acyltransferase (LPAAT) to insert a fatty acid carbon chain from ester acyl-CoA at the site of 3-phosphoglycerol to esterify to form another molecule of lysophosphatidic acid (LPA) and phosphatidic acid (PA). After PA is dephosphorylated by phosphatidic acid phosphatase (PAP) to generate DAG, under the catalysis of diacylglycerol acyltransferase (DGAT), fatty acids are transferred to DAG to generate TAG. The fatty acid groups in TAG are composed of saturated or unsaturated fatty acids of different carbon chain lengths, thereby constituting the diversity of plant seed fatty acid components. The regulation of fatty acid reaction occurs in the endoplasmic reticulum. After the fatty acid of 18:1 is transported from the plastid to the endoplasmic reticulum, under the catalysis of oleic acid desaturase (FAD2) and linoleic acid desaturase (FAD3), double bonds are formed by desaturation and dehydrogenation to form fatty acids of 18:2 and 18:3. Finally, after the synthesis of TAG in the endoplasmic reticulum, it is released to the cytoplasm in the form of oil bodies.

[0005] At present, the function of the reported fatty acid related genes in Arabidopsis is mainly studied by reverse genetics, and few new genes affecting the synthesis of fatty acids are identified by forward genetics. Meanwhile, the traditional gene mapping method is only aimed at a single gene, which is difficult to analyze the regulation mechanism of fatty acid composition in Brassica napus at the whole genome level. With the development of high-throughput sequencing technology, various omics technologies can accelerate the research of plant functional genes, understand the function of genes by using the information of whole genome sequence, clone key genes, and qualitatively transform plant traits. Genome wide association study (GWAS) plays an important role in identifying complex quantitative trait genes of crops and revealing important agronomic traits. In the study of plants, the accuracy of the target traits can be improved through multi-year and multi-point investigation, and multiple traits can be analyzed in the same batch, which greatly improves the positioning efficiency of major genes of important agronomic traits. With the continuous release of reference genomes of various crops, GWAS has become a routine method for complex agronomic traits of Arabidopsis, maize, rice and other crops. However, due to the fact that most of the variations are located in the non-coding region and are affected by the decay rate of LD, a large number of candidate genes often exist in a QTL, which makes it very difficult to identify key causal variations. At the same time, ordinary GWAS analysis cannot clarify the relationship between multiple candidate genes. In order to solve this problem, in recent years, based on the GWAS analysis method, the methods of expression genome-wide association study (eGWAS) and transcriptome-wide association study (TWAS) using population transcriptome data have been derived. eGWAS and TWAS are used to further reveal the regulatory relationship between genes and genes or genes and phenotypes.

[0006] The application predicts the candidate gene BnaLTP15 affecting the fatty acid composition by multi-omics association analysis, LTP15 is a lipid transfer protein family, and is a gene encoding PR (pathogenesis related) protein. The application designs a target site to create a CRISPR / Cas9 mutant rapeseed material of BnaLTP15 gene and its homologous genes, and the rapeseed mutant obtained by the rapeseed material. The results show that the content of erucic acid increases and the content of oleic acid decreases in the mutant. The results indicate that BnaC02.LTP15 can affect the fatty acid composition of Brassica napus, increase the content of oleic acid, and reduce the content of erucic acid, which provides a theoretical basis and gene resources for rapeseed oil quality improvement. SUMMARY

[0007] The purpose of the application is to provide the use of BnaLTP15 gene in regulating the fatty acid composition of rapeseed.

[0008] The applicant collected 7 kinds of rapeseed fatty acid component data from 505 natural populations of Brassica napus in Wuhan, Ezhou, Chengdu, Hefei, Kunming and Lanzhou. Through multi-omics correlation analysis, the key genes regulating the fatty acid composition of rapeseed seeds were mined at the whole genome level, and finally a LTP15 gene significantly associated with multiple fatty acids was found. The gene encodes a lipid transfer protein family that can transfer lipids in vitro and regulate plant growth and development. The LTP15 gene exists on the C02 chromosome of Brassica napus (BnaC02g42150D), which is named BnaC02.LTP15 gene. The nucleotide sequence of the gene is shown in SEQ ID NO: 1, which consists of 369 bp, and the protein sequence encoded by the gene is shown in SEQ ID NO: 2, which encodes 122 amino acids.

[0009] The applicant cloned the BnaLTP15 gene from rapeseed, and used Brassica napus 524 (low oleic acid and high erucic acid) as the receptor material to obtain BnaLTP15 overexpression lines by Agrobacterium-mediated genetic transformation method. At the same time, CRISPR / Cas9 gene editing technology was used to obtain BnaLTP15 gene function loss rapeseed varieties. The results show that BnaLTP15 can regulate the fatty acid composition of Brassica napus, wherein the oleic acid content of the overexpression material is increased, the erucic acid content is decreased, and the oleic acid content of the edited material is decreased, and the erucic acid content is increased.

[0010] Based on this, the application further provides a rapeseed quality improvement method. In order to promote the accumulation of oleic acid and inhibit the accumulation of erucic acid, an overexpression vector containing the BnaLTP15 gene is transformed into the genome of rapeseed by Agrobacterium-mediated genetic transformation method, and a BnaLTP15 gene overexpression rapeseed variety is obtained.

[0011] In order to promote the accumulation of erucic acid and inhibit the accumulation of oleic acid, a CRISPR / Cas9 plant gene editing vector containing the BnaLTP15 gene is transformed into the genome of rapeseed by Agrobacterium-mediated genetic transformation method, and a BnaLTP15 gene edited rapeseed variety is obtained. The variety can be used as a model plant for functional research of rapeseed fatty acid composition regulation genes.

[0012] The beneficial effects of the application are:

[0013] The rapeseed fatty acid composition is controlled by multiple major and minor QTLs, and the cloned genes regulating rapeseed fatty acid composition are still very limited, which restricts the further improvement of rapeseed fatty acid composition. Therefore, mining the genes regulating rapeseed fatty acid composition with breeding utilization value and analyzing the regulation mechanism thereof have important significance for breeding rapeseed varieties with reasonable fatty acid composition and high nutritional value. The genetic resources created by the present application have very important significance in the improvement breeding of rapeseed seed fatty acids. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 is an agarose gel electrophoresis detection diagram of the full-length fragment of the target gene gDNA.

[0015] Figure 2 is the expression amount detection of BnaC02.LTP15 gene in the super-expression transformation single plant OE-6, and ** indicates P<0.01 in Student's T-test.

[0016] Figure 3 is the sgRNA target site position of BnaC02.LTP15 and its homologous genes. The black sequence indicates the sgRNA sequence, the green indicates the PAM sequence, and the red / base indicates base deletion / insertion.

[0017] Figure 4 is the determination of the content of each component of fatty acid in the rapeseed of WT and bna.ltp15-L3, bna.ltp15-L11 and bna.ltp15-L20 mutant materials (n=3-6) by GC-FID. * indicates P<0.05 in Student's T-test, and ** indicates P<0.01 in Student's T-test. DETAILED DESCRIPTION

[0018] The present application will be further described in detail below in combination with specific examples. It should be understood that these examples are only used to illustrate the present application but not to limit the scope of the present application. The experimental methods not described in detail in the following examples are generally carried out according to the conventional methods or the methods described in the handbook "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods suggested in the operation manual provided by the manufacturer.

[0019] Strains used in this study: Escherichia coli (DH5a) was used for gene cloning, vector construction and plasmid extraction; Agrobacterium GV3101 was used for genetic transformation of Brassica napus; the genetic transformation material used in this study was a Brassica napus inbred line 524 (WH3411) with high erucic acid (34.9%) and high oil content (51.28%) obtained from the Brassica napus National Engineering Research Center in Wuhan, China.

[0020] Example 1B Construction of the overexpression vector of BnaC02.LTP15 gene

[0021] The candidate gene and protein sequence were obtained from Brassica napus Genome Browser (https: / / www.dev.genoscope.cns.fr / brassicanapus / ). The overexpression vector backbone was pCAMBIA2306, which contains the constitutive 35S promoter. The full-length cDNA fragment was amplified from the leaf cDNA of inbred line Brassica napus 524 (WH3411) using specific primers LTP15-L: CGGGATCCATGAGTAATTCGGTTTTTGTAGTTTCTT and LTP15-R: GCGTCGACATCTAAAAAATAAATATAAAAATTAATCATACCTATC with added enzyme digestion sites and Flag tag. I-5 TM 2x High-Fidelity Master Mix (TSINGKE Biotechnology) was used for PCR amplification. The PCR amplification system was as follows:

[0022]

[0023]

[0024] PCR amplification program: 98°C pre-denaturation for 1 min; 98°C denaturation for 15 sec, 55°C annealing for 15 sec, 72°C extension for 30 sec, 34 circles; 72°C total extension for 5 min.

[0025] After amplification, the product was detected by agarose gel electrophoresis Figure 1), and the 369 bp full-length BnaC02.LTP15 cDNA was obtained by amplification. The product was recovered by cutting the gel and using a TIANgel Recoveiy Kit (http: / / www.tiangen.com / ). The recovered product was directly subjected to enzyme cutting using a Fast Restriction Enzyme (Thermo Scientific) in a 37 °C water bath for 30 min. The enzyme cutting product was recovered using a TIANgel DNA Purification Kit. The transformed vector and the enzyme cutting recovered product of the target gene amplification fragment were connected, and then transformed into E. coli DH5a. After screening positive clones, plasmid enzyme cutting identification was performed, and three positive clones were selected for sequencing. After sequencing, the plasmid was extracted and transformed into Agrobacterium GV3101, and a positive clone was selected and stored at -80 °C in an ultra-low temperature environment.

[0026] Example 2BnaC02.LTP15 gene CRISPR vector construction

[0027] (1) According to CRISPR-P v2.0 (http: / / cbi.hzau.edu.cn / CRISPR2 / ), the CRISPR editing target was screened, and the CRISPR2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) was logged in. The sequence with a higher score was selected as the gene editing target by specifically targeting the candidate gene and its homologous gene, and the target position and score were used to screen the target sgRNA1: CTGTTTGGTCTTGGCACC and sgRNA2: GTCTTGTTGGCACCTGACC, both of which were located in the exon region of the gene BnaC02.LTP15.

[0028] (2) Design primers

[0029] BnaC02.LTP15-DT1-BsF: ATATATGGTCTCGATTGCTTGTTTGGTCTTGGCACCGTT

[0030] BnaC02.LTP15-DT1-F: TGCTTGTTTGGTCTTGGCACCGTTTTAGAGCTAGAAATAGC

[0031] BnaC02.LTP15-DT2-R0: AACGGTCAGGTGCCAACAAGACCAATCTCTTAGTCGACTCTAC

[0032] BnaC02.LTP15-DT2-BsR: ATTATTGGTCTCGAAACGGTCAGGTGCCAACAAGACCAA

[0033] (3) PCR amplification: four primers PCR amplification was performed with 100-fold diluted pCBC-DT1T2 as template. DT1-BsF and DT2-BsR were normal primer concentration; DT1-F0 and DT2-R0 were diluted 20-fold. The amplification system was as follows:

[0034]

[0035] PCR amplification procedure: 98℃ total denaturation for 1 min; 98℃ denaturation for 15 sec, 56℃ annealing for 25 sec, 72℃ extension for 25 sec, 34 circles; 72℃ total extension for 5 min.

[0036] (4) Purification and recovery of PCR product, and the following enzyme digestion-connection system was established:

[0037]

[0038] Reaction conditions: 5 hours at 37℃, 5 min at 50℃, 10 min at 80℃.

[0039] (5) Transformation of E. coli DH5a: 5 μL of plasmid containing target cloning fragment was taken to transform E. coli competent, Kan plate was selected, positive clone was identified by PCR and sequenced. The correct vector was the CRISPR vector of BnaC02.LTP15.

[0040] Example 3 Agrobacterium-mediated genetic transformation

[0041] (1) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and the positive single clone was selected and stored in -80℃ refrigerator. The introduction method was as follows:

[0042] a. Wash the electrotransformation cup: first wash with pure water, then wash with ultrapure water, pour out, then wash with anhydrous ethanol (blow with 1 ml gun head), pour out the anhydrous ethanol, and place it on the clean bench to dry;

[0043] b. Take 20 μl of Agrobacterium competent GV3101;

[0044] c. Take 0.8 μl of correctly constructed recombinant plasmid and add it to 20 μl of competent cells, mix gently to avoid air bubbles;

[0045] d. Place the washed and dried electrotransformation cup in ice for pre-cooling, and then pour the above mixture into the cup wall;

[0046] e. Adjust the electrotransformation instrument to 1800V;

[0047] f. Take the electrotransformation cup out of the ice and wipe the outer wall of the electrotransformation cup clean with a water-absorbing paper;

[0048] g. Put the electroporation cuvette into the instrument, press the "push" button twice, and if you hear a "drop" sound after a few seconds, it means success.

[0049] h. After successful electroporation, add 400 μl of LB without antibiotics to the electroporation cuvette, and then pipette several times and transfer to a sterile centrifuge tube.

[0050] i. Activate at 28°C for about 2 hours, take 100 μl and spread on double-antibiotic LB, seal with sealing film, and invert in a 28°C incubator for 2 days, and then pick and test.

[0051] (2) Agrobacterium colony detection

[0052] Select the colony in double-antibiotic LB, and culture at 28°C for 2 hours, then take an appropriate amount of bacterial solution for PCR detection, and save the positive Agrobacterium solution.

[0053] (3) Genetic transformation of rapeseed

[0054] The high-erucic-acid rapeseed germplasm WH3411 numbered 524 was used as the recipient material for transformation, and Agrobacterium-mediated genetic transformation of rapeseed was carried out using the hypocotyl genetic transformation and tissue culture system. The specific operation process is described in the reference: Anefficient Agrobacterium-mediated transformation method using hypocotyl asexplants for Brassica napus. The transformation steps are as follows:

[0055] a. Seed disinfection and sowing: First, immerse mature and full rapeseed in 75% alcohol for 1 min, disinfect with 0.15% mercury solution for 12 min, and wash with sterile ddH2O for 5-6 times; then sow the disinfected seeds in M0 medium and cultivate in the dark at 22°C for 6-7 days.

[0056] b. Agrobacterium activation: pick the target Agrobacterium monoclonal and inoculate into 5 mL of liquid LB medium, cultivate at 28°C and 180 r / min until the OD value is 0.6-0.8 (about 12-14 h), take 2 mL of bacterial solution, centrifuge at 6000 r / min for 10 min, discard the supernatant, resuspend with an equal volume of DM (Dilution Medium) liquid, centrifuge again, discard the supernatant, and resuspend with an equal volume of DM solution. When infecting, dilute with 20 mL of DM solution again (v:v=1:10, and perform in a sterile culture dish).

[0057] c. Infection and co-culture: Cut hypocotyls of seedlings with sterile forceps and scalpel, each 0.8-1.0 cm in length (try to cut vertically in one stroke when cutting explants); place the cut explants in a dish containing bacterial solution, and immerse for 20-30 min, shake once in a while; dry the infected explants with sterile filter paper, and transfer to Ml medium, and incubate in the dark at 22°C for 36-48 h, until cloud-like bacterial colonies appear around the explants.

[0058] d. Selection and induction of callus: transfer the hypocotyl explants after co-culture to M2 medium for induction of callus, which contains Timentin to inhibit growth of Agrobacterium and screening antibiotic kanamycin (kana), and incubate in the light for 21 days.

[0059] e. Differentiation and shoot regeneration: discard some explants that have browned and died, and transfer the normal growing explants with swollen ends to differentiation medium M3, and incubate in the light, subculture every 2-3 weeks until green shoots appear.

[0060] f. Shoot elongation and rooting: transfer the differentiated green shoots to M4 medium for 4 weeks, and after roots grow, transfer to a small flower pan for acclimation, take leaf blades to extract DNA for identification, and transfer positive single plants to the field, bag them and self-pollinate to obtain self-pollinated seeds.

[0061] Medium formula:

[0062] M0 medium: 2.2 g / L MS dry powder + 12 g / L Basic agar (agar powder), pH adjusted to 5.8, (MS dry powder, Sigma, M5519).

[0063] Dilution medium (DM): 4.4 g / L MS dry powder + 30 g / L sucrose + 100 μM / L AS.

[0064] Ml medium: 4.4 g / L MS dry powder + 30 g / L sucrose + 18 g / L mannitol + 1 mg / L 2,4-D + 0.3 mg / L KT + 100 μM / L AS + 6 g / L agarose.

[0065] M2 medium: Ml medium + 30 STS + 300 mg / L Timentin 25 mg / L Hyg / kana.

[0066] M3 medium: 4.4 g / L MS dry powder + 10 g / L glucose + 0.25 g / L xylose + 0.6 g / L MES + 2.0 mg / L ZT + 0.1 mg / L IAA + 200 mg / L Timentin + 25 mg / L Hyg / kana.

[0067] M4 medium: 4.4 g / L MS dry powder + 10 g / L sucrose + 10 g / L Basic agar + 100 mg / L Timentin.

[0068] STS preparation: 0.1M sodium thiosulfate (Na2S2O3) and silver nitrate (AgNO3) were prepared respectively, and then Na2S2O3 and AgNO3 were mixed in a volume ratio of 4:1. 100 mL of STS solution was prepared, i.e. 20 mL of AgNO3 solution was added to 80 mL of Na2S2O3 solution, which was prepared before use, and stored in a brown bottle after filtration.

[0069] (4) Identification of overexpression transformation single plants

[0070] Genomic DNA of the obtained rape overexpression transformation single plants was extracted, and the insertion of the exogenous gene fragment was detected by PCR. The overexpression backbone vector in the present application was 35S-pCAMBIA2306, and the overexpression backbone vector primer was E9-R: GGACTTGAAGTTTGGGGAAG, and the primer on the exogenous fragment was LTP15-L: CGGGATCCCGTTCAACTGATCCAAAAAAC. The PCR was performed by matching the vector backbone primer with the exogenous fragment primer.

[0071] qRT-PCR was performed on the PCR obtained rape transgenic positive seedlings to detect the gene expression amount. The RNA of the transformation single plant seeds was extracted and the synthesis of cDNA was performed. The specific operation is as follows:

[0072] RNA was extracted using Trizol reagent kit (ET101) from Invitrogen. 100 mg of ground sample was transferred into a 1.5 mL centrifuge tube, 1 mL of Trizol was added, and the mixture was thoroughly mixed by inverting the tube several times. The mixture was incubated at room temperature for 5 min, 0.2 mL of chloroform was added, and the mixture was vigorously shaken for 15 sec. The mixture was incubated at room temperature for 3 min, and centrifuged at 10,000 g for 15 min at 4°C. The colorless aqueous phase was transferred into a new centrifuge tube, 0.5 mL of isopropanol was added, and the mixture was mixed by inverting the tube. The mixture was incubated at room temperature for 10 min, and centrifuged at 10,000 g for 10 min at 4°C. The supernatant was discarded, and the gel-like precipitate was obtained. 1 mL of 75% ethanol (DEPC-treated water) was added, and the mixture was vortexed. The mixture was centrifuged at 7,500 g for 5 min at 4°C. The supernatant was discarded, and the precipitate was air-dried at room temperature. The precipitate was dissolved in 50-100 μL of RNA dissolving solution. 1 μL of the extracted total RNA was used to determine the RNA concentration using a Nanodrop. The RNA purity was determined according to 1.8 < OD260 / OD280 < 2.0. 1 μL of the extracted total RNA was used for 1% agarose electrophoresis to determine the RNA integrity. The reverse transcription kit from Qiagen was used to perform reverse transcription of the RNA according to the manufacturer's instructions. The obtained cDNA was stored at -80°C for long-term storage and at -20°C for short-term storage.

[0073] The quantitative primers were designed using Primer 5 software, and the product size was between 100 bp and 200 bp. The designed primers were subjected to BLAST comparison using a reference sequence to ensure the specificity of the primers qLTP15-L: GACCATAGTTTCCCCAATTTTCAATG and qLTP15-R: GTCGTTGCTTGGAACTCTATGGC. BnaACTIN7-L: CGCGCCTAGCAGCATGAA and BnaACTIN7-R: GTTGGAAAGTGCTGAGAGATGCA were used as the internal reference primers for qRT-PCR of Brassica napus (Zhou et al 2012: BnMs3 is required for tapetal differentiation and degradation, microspore separation, and pollen-wall biosynthesis in Brassica napus). The reaction system was as follows:

[0074] 6.9 μL of the diluted cDNA

[0075] Primer 1 (10 μmol / L) 0.3 μL

[0076] Primer 2 (10 μmol / L) 0.3 μL

[0077] 2x Green qPCR SuperMix 7.5 μL

[0078] Reaction procedure: 94°C 30 s; 94°C 10 s, 60°C 15 s, 72°C 30 s, 45 cycles; draw the melting curve. qRT-PCR was performed in Bio-Rad CFX96 Real-Time System.

[0079] According to the internal reference primer, the quantitative variation between different repeats was calculated by the method of delta-delta threshold cycle relative quantification (2 -ΔΔCT ). Finally, the analysis obtained the overexpression transformation single plant of rape OE-6 Figure 2 ).

[0080] (4) Identification of CRISPR transformation single plant

[0081] The obtained rape CRISPR transformation single plant was sequenced to screen the rape mutant. First, the Cas9 protein was identified by using primers Cas9-F and Cas-R, and the specific amplification and sequencing identification of the target gene were performed on the Cas9 protein positive single plant. The specific amplification method of the target gene is as follows: BnaC02.LTP15 was specifically amplified by using primers LTP15-C2L: GACCATAGTTTCCCCAATTTTC and LTP15AC-R: CTTCTTCTTTGCTTCAGACTTGG; BnaA02.LTP15 was specifically amplified by using primers LTP15-A2L: CACTTGTGGAATGGCGAAAGA and LTP15AC-R: CTTCTTCTTTGCTTCAGACTTGG. The amplification method is as follows:

[0082] The PCR system is as follows: Easy taq polymerase 0.15 μL, 10 mM dNTP 0.4 μL, 10x buffer 2 μL, DNA template 2 μL, F primer 2 μL, R primer 2 μL, and ddH2O to 20 μL. The PCR condition is as follows: 94°C total denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 30 sec, 32 circles; 72°C total extension for 5 min.

[0083] PCR product sequencing was performed on the amplified target fragments, and the sequencing results were analyzed using the DSDecode online website (http: / / www.dsdecode.com). http: / / skl.scau.edu.cn / dsdecode / ) The editing of the target site was analyzed. The sequencing results showed that multiple mutant independent lines L3, L11 and L20 of BnaC02.LTP15 were edited. Figure 3 ).

[0084] Example 4 Verification of the function of BnaC02.LTP15 gene

[0085] (1) Fatty acid determination

[0086] The seed fatty acid composition was determined by gas chromatography (Gas chromatography-flame ionization detector, GC-FID).

[0087] 1) Weigh 4-5 mature rapeseed seeds and record their weight, and place the weighed seeds in a previously numbered fat extraction tube;

[0088] 2) Add 4 mL of extraction solution (5% concentrated sulfuric acid, 95% methanol, containing 0.01% BHT) to the fat extraction tube;

[0089] 3) Gently crush the seed coat with a glass rod to expose the seed embryo (Arabidopsis seeds do not need this step);

[0090] 4) Add 100 μL of internal standard 16.2 μM / mL heptadecanoic acid (17:0, molecular weight 270.45) 100 μL with a glass needle, and tighten the lid of the fat extraction tube;

[0091] 5) Place the sample in a 85℃ water bath, after 10 minutes, tighten the lid again, and continue the water bath for 2 hours to allow the fatty acid to undergo methyl esterification reaction;

[0092] 6) After taking it out of the water bath, add 3.0 mL of n-hexane and 3.0 mL of H2O, and vortex to mix;

[0093] 7) Centrifuge at 1000 r / min for 10 minutes, and use a rubber bulb dropper to take 1.0 mL of supernatant to the sample bottle;

[0094] 8) Gas chromatography with hydrogen flame ionization detector and capillary RESTEK - wax column (0.25 mm x 30 m), helium carrier gas at 20 mL / min. The process parameters are described as follows: injection 1 μL, split ratio 20:1. The oven temperature was kept at 170℃ for 1 min, and then gradually increased to 210℃ at a rate of 3℃ / min;

[0095] 9) GC-MS automatic injection analysis;

[0096] 10) According to the retention time characteristics and peak pattern of different fatty acid composition, identify the fatty acid species, and organize the peak area data corresponding to each fatty acid composition. With the internal standard heptadecanoic acid (17:0) as the reference, the fatty acid ratio is calculated in nm%, combined with the molecular weight of each component of fatty acid, the mass of each component is calculated, combined with the weight of the seed, and finally the oil content is calculated as a percentage of dry weight.

[0097] The fatty acid results showed that the erucic acid content of the overexpression strain OE-6 decreased by 21.21%, and the oleic acid content increased by 23.89%. In the three mutants bna.ltp15-L3, bna.ltp15-L11 and bna.ltp15-L20, the erucic acid content increased by 7.19%-16.03%, and the oleic acid content decreased by 6.79%-18.58%, with significant difference (P<0.05). Figure 4 These results showed that BnaC02.LTP15 would affect the fatty acid composition of Brassica napus, increase the content of oleic acid, and at the same time reduce the content of erucic acid.

[0098] Attachment: Explanation of Sequence Listing

[0099] SEQ ID NO: 1: Full-length CDS sequence of BnaC02.LTP15 gene;

[0100] SEQ ID NO: 2: Protein sequence encoded by BnaC02.LTP15 gene.

Claims

1. Application of overexpressing LTP15 gene or the protein coded by the gene in promoting accumulation of oleic acid and inhibiting accumulation of erucic acid in Brassica napus, wherein the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO:

2. LTP15 ​ 2. A method for improving the quality of oilseed rape by promoting the accumulation of oleic acid and suppressing the accumulation of erucic acid, characterized by: Using Agrobacterium-mediated genetic transformation method, the overexpression vector containing the gene described in claim 1 is transformed into the genome of Brassica napus, and a Brassica napus variety with gene overexpression is obtained. LTP15 Using Agrobacterium-mediated genetic transformation method, the overexpression vector containing the gene described in claim 1 is transformed into the genome of Brassica napus, and a Brassica napus variety with gene overexpression is obtained. LTP15 Using Agrobacterium-mediated genetic transformation method, the overexpression vector containing the gene described in claim 1 is transformed into the genome of Brassica napus

Images