Pomegranate abcg9 gene and applications thereof

By cloning the pomegranate PgABCG9 gene and overexpressing it in Arabidopsis thaliana to inhibit lignin synthesis, the problem of the key gene for pomegranate seed hardness formation was not identified, and the effects of seed softening and improved Arabidopsis thaliana growth were achieved.

CN118497215BActive Publication Date: 2026-07-03INST OF HORTICULTURE RES ANHUI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF HORTICULTURE RES ANHUI ACAD OF AGRI SCI
Filing Date
2024-05-27
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

The key genes for pomegranate seed hardness formation have not yet been identified in the existing technology, especially the function of ABCG family members in lignin monomer transport has not been identified, which hinders the development of molecular markers affecting pomegranate seed hardness and the breeding of soft-seeded pomegranate varieties.

Method used

The PgABCG9 gene of pomegranate was cloned and found to negatively regulate seed hardness. By constructing a recombinant vector and overexpressing it in Arabidopsis thaliana, lignin synthesis and accumulation were inhibited, and the gene was localized to the Golgi apparatus to exert its function.

Benefits of technology

The negative regulation of pomegranate seed hardness was successfully achieved in Arabidopsis thaliana, providing a theoretical basis for pomegranate seed softening, laying the foundation for the genetic improvement of pomegranate germplasm resources, and improving the growth status of Arabidopsis thaliana.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118497215B_ABST
    Figure CN118497215B_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant biotechnology, and specifically discloses a Punica granatum ABCG9 gene and application thereof. The PgABCG9 gene of the Punica granatum is cloned for the first time, and the nucleic acid sequence is shown as SEQ ID No. 1. The PgABCG9 is only expressed in the inner seed coat of the Punica granatum, and the transcription level is negatively correlated with the hardness of the Punica granatum seeds. Under the same growth conditions, the PgABCG9 transgenic Arabidopsis plants show slow growth, reduced lignin deposition, reduced expression level of lignin biosynthesis genes, and reduced content of metabolic products in the lignin biosynthesis pathway. Subcellular localization analysis shows that the PgABCG9 is located in the Golgi apparatus. The PgABCG9 plays a negative regulation role in the lignin biosynthesis, and can regulate the lignin synthesis of the inner seed coat of the Punica granatum, and adjust the kernel hardness, thereby laying a foundation for improving the fruit quality of the Punica granatum and other drupes from the direction of lignin in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the pomegranate ABCG9 gene and its application in negatively regulating lignin synthesis. Background Technology

[0002] Pomegranates belong to the genus Punica genus in the family Lythraceae of the order Myrtales. They are deciduous shrubs or trees. Pomegranates have a long history of cultivation and possess high nutritional, medicinal, and ornamental value. The edible part of the pomegranate is its seeds. The hardness of the seeds affects the fruit's taste and consumer acceptance; based on seed hardness, pomegranate varieties can be divided into hard-seeded and soft-seeded varieties. Soft-seeded pomegranates have soft, edible seeds and are popular with consumers.

[0003] Pomegranate seed hardness is a unique characteristic of each variety, primarily determined by genotype. Identifying key genes influencing seed hardness and developing molecular markers will help accelerate the breeding process of soft-seeded pomegranate varieties. Pomegranate seeds mainly consist of an outer seed coat, an inner seed coat, and a kernel. The inner seed coat contains more lignin, cellulose, and hemicellulose; the accumulation of large amounts of lignin in the inner seed coat leads to increased seed hardness.

[0004] Lignin is the main phenolic polymer in the secondary cell wall of plants. The synthesis of lignin is complex. Lignin monomers, such as coumarin, coniferyl alcohol, and sinapyl alcohol, are synthesized intracellularly, transported to the cell wall, and polymerized into H, G, and S-type lignin under the action of laccase and peroxidase, respectively. Alternatively, they are transported to intracellular septa such as vacuoles for storage, reducing lignin synthesis. The synthesis, transport, and oxidative polymerization of lignin monomers all play important roles in lignin biosynthesis. While the intracellular synthesis and oxidative polymerization of lignin monomers in the cell wall are relatively well understood, the transport mechanism of lignin monomers remains unclear, particularly the genes involved in intracellular transport, which need to be identified.

[0005] ATP-binding cassette (ABC) transporters are one of the largest and oldest known protein families, widely distributed in eukaryotes and prokaryotes. ABCG is the largest subfamily within the ABC transporter family, with a broad range of transport substrates; the same protein can transport multiple substrates. The functions of many ABCG transporters have been identified, playing important roles in antibiotic resistance, hormone transport, cellular detoxification and metal resistance, cuticle formation, pathogen resistance, and pollen wall formation. Studies have shown that ABCG family members participate in the transport of lignin monomers / monomer glycosides. In Arabidopsis thaliana, AtABCG9, 11, and 14 are involved in lipid / sterol homeostasis regulation, playing a role in vascular bundle development. AtABCG29 transports the lignin monomer p-coumarol from the cell wall, participating in lignin synthesis. Currently, there are no reports of other ABCG proteins negatively regulating lignin synthesis.

[0006] Pomegranate seed hardness is significantly positively correlated with the lignin content in the inner seed coat. Pomegranate ABCG9 is specifically expressed in the inner seed coat, and its expression level is higher in soft-seeded varieties than in hard-seeded varieties. Currently, there are no reports on the functional identification of the pomegranate ABCG9 gene. Conducting research on the function of the PgABCG9 gene is of great significance and lays the foundation for further exploring the role of PgABCG9 in the formation of pomegranate seed hardness. Summary of the Invention

[0007] One of the objectives of this invention is to propose a pomegranate PgABCG9 gene, the nucleic acid sequence of which is shown in SEQ ID No. 1.

[0008] Preferably, the PgABCG9 gene is located in the Golgi apparatus.

[0009] The second objective of this invention is to propose the application of the above-mentioned PgABCG9 gene in negatively regulating the hardness of pomegranate seeds.

[0010] The third objective of this invention is to propose the application of the aforementioned PgABCG9 gene in the breeding of soft-seeded pomegranate varieties.

[0011] The fourth objective of this invention is to provide a recombinant vector containing the aforementioned PgABCG9 gene.

[0012] The fifth objective of this invention is to provide a host cell containing the above-mentioned recombinant vector.

[0013] The sixth objective of this invention is to propose the application of the above-mentioned PgABCG9 gene, or the above-mentioned recombinant vector, or the above-mentioned host cell in inhibiting the synthesis and accumulation of lignin in plants.

[0014] Preferably, the plant is pomegranate or Arabidopsis thaliana.

[0015] The seventh objective of this invention is to propose a set of primer pairs, as shown in SEQ ID No. 2 and SEQ ID No. 3.

[0016] The eighth objective of this invention is to propose the application of the above primer pair in amplifying the PgABCG9 gene.

[0017] This invention successfully cloned the functional gene PgABCG9 from pomegranate. Quantitative fluorescence analysis revealed that PgABCG9 is specifically expressed in the inner seed coat of pomegranate seeds. The relative expression levels of PgABCG9 in different pomegranate tissues and in the inner seed coat of pomegranates with different seed hardness were measured. The expression level increased with seed development and was negatively correlated with pomegranate seed hardness, confirming that the PgABCG9 gene may negatively regulate seed hardness formation, which is of great significance for improving soft-seeded pomegranate varieties.

[0018] This invention involves inserting the PgABCG9 gene into an overexpression vector to form a recombinant plasmid, thus constructing an overexpression vector for the PgABCG9 gene. Through Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana, a positive transgenic line overexpressing the PgABCG9 gene was successfully obtained, achieving overexpression in Arabidopsis. The PgABCG9 gene overexpressing plants exhibited slow growth, with inhibited lignin synthesis and accumulation. However, in a culture medium containing the lignin monomers coniferyl alcohol and sinigrin, overexpression of the PgABCG9 gene improved Arabidopsis plant growth, confirming that the PgABCG9 gene is involved in the transport of lignin monomers.

[0019] This invention demonstrates the subcellular localization of the PgABCG9 gene in Arabidopsis protoplasts, indicating that the gene is located in the Golgi apparatus and functions there. This invention provides a theoretical basis for the study of pomegranate seed hardness and the genetic improvement of pomegranate germplasm resources. Attached Figure Description

[0020] Figure 1 This study investigated the expression pattern of PgABCG9 and its correlation with pomegranate seed hardness. Figure A shows the relative expression level of the PgABCG9 gene at different developmental stages of pomegranate roots, flowers, pericarps, and inner and outer seed coats. Figure B shows the relative expression level of the PgABCG9 gene in eight pomegranate varieties with different seed hardness. Figure C presents the statistical analysis of seed hardness measurements for the eight varieties. Figure D shows the correlation analysis between the relative expression level of the PgABCG9 gene and pomegranate seed hardness.

[0021] Figure 2 The statistical results show the phenotype and growth-related traits of Arabidopsis thaliana overexpressing PgABCG9. Figure A shows the phenotype of plants grown in soil for 60 days, Figure B shows the plant height, and Figure C shows the plant biomass.

[0022] Figure 3 Image of lignin staining in the stem of a PgABCG9 transgenic plant using the phloroglucinol method.

[0023] Figure 4 The figures show the statistical measurements of stem diameter, lignin content, and cell wall thickness of PgABCG9 transgenic plants. Figure A shows the stem diameter, Figure B shows the lignin content, and Figure C shows the cell wall thickness.

[0024] Figure 5 This study presents a targeted metabolomics analysis of the stems of PgABCG9 transgenic plants. Figure A shows the lignin synthesis pathway, and Figures BO show the metabolite content.

[0025] Figure 6 A comparison of the relative expression levels of genes related to the lignin synthesis pathway in PgABCG9 transgenic plants and WT plants.

[0026] Figure 7 The figures show the phenotypic observations and related traits of Arabidopsis plants treated with exogenous lignin monomers. Figure A shows the phenotypic characteristics of Arabidopsis plants treated with 1.5 mmol / L coniferyl alcohol and sinigrin after 10 days of growth; Figure B shows the biomass statistics of Arabidopsis plants in the treatment and control groups; and Figure C shows the root length statistics of Arabidopsis plants in the treatment and control groups.

[0027] Figure 8 Subcellular localization of PgABCG9 protein is shown, with GFP representing green fluorescent protein and RFP representing red fluorescent protein. Figure A shows the localization of PgABCG9 and the trans-Golgi marker (ST-mRFP) co-expressed in Arabidopsis protoplasts, while Figure B shows the localization of PgABCG9 and the cis-Golgi marker (Man1-mRFP) co-expressed in Arabidopsis protoplasts. Detailed Implementation

[0028] The present invention will be further explained below with reference to specific embodiments.

[0029] The materials used in the following examples were root, leaf, flower, pericarp, and seed coat tissues of the 'Dabenzi' pomegranate variety cultivated in the pomegranate germplasm resource nursery of the Anhui Academy of Agricultural Sciences, as well as the inner seed coats of eight varieties with different seed hardness, 75 days after pollination, including 'Dabenzi', 'Ahhb 47', 'Sxxa 18', 'Yssls', 'Zhh', and 'Tunisia'. After sampling, the samples were flash-frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80°C.

[0030] Example 1 Expression pattern analysis of PgABCG9 gene

[0031] Previous studies have shown that the seed coat of pomegranate begins to lignify within 45 days after flowering, and the seed hardness increases rapidly, reaching its maximum around 120 days after flowering.

[0032] The expression levels of PgABCG9 in different tissues at different developmental stages of the 'Dabenzi' pomegranate variety were detected by qRT-PCR. Using qRT-PCR as the quantitative primer, and with the pomegranate PgActin 7 gene as an internal control, the qRT-PCR experiment was performed using the ChamQ Universal SYBR qPCR Master Mix kit, following the kit instructions. -ΔΔCt The method calculates the relative expression of genes.

[0033] The results are as follows Figure 1As shown in -A, the PgABCG9 gene is highly expressed in the inner seed coat, and its expression increases rapidly with fruit development, reaching its highest level 75-135 days after pollination. The expression level of this gene in the inner seed coat is 40 times that in the outer seed coat, while its expression level is very low in other tissues.

[0034] To further understand the potential function of PgABCG9 in pomegranate seed hardness formation, the expression level of PgABCG9 in the seed coat of pomegranate varieties with different seed hardness was analyzed.

[0035] The results are as follows Figure 1 -B and Figure 1 As shown in -C, the relative expression level of PgABCG9 in soft-seeded varieties (Nj 8, Zhh, Yssls and Tunisia) is significantly higher than that in hard-seeded varieties (Dabenzi, Ahhb 47 and Sxxa 18).

[0036] like Figure 1 As shown in Figure -D, regression analysis revealed a negative correlation between PgABCG9 transcription levels and seed hardness in these pomegranate varieties. Therefore, it is hypothesized that PgABCG9 may negatively regulate the formation of pomegranate seed hardness.

[0037] Example 2 Construction of PgABCG9 gene overexpression vector and obtaining transgenic Arabidopsis thaliana

[0038] RNA was extracted from the inner seed coat of “Dabenzi” pomegranate using the plant total RNA and polysaccharide / polyphenol RNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The cDNA obtained by reverse transcription using the reverse transcription kit from Takara Biotechnology Co., Ltd. was used as a template. PgABCG9-F and PgABCG9-R were used as upstream and downstream primers. The amplified fragment was sequenced and found to be consistent with the PgABCG9 sequence annotated in the published pomegranate genome.

[0039] The primer sequences used are as follows:

[0040] PgABCG9-F: ATGATGAGAGATCAAACGGGAGAG

[0041] PgABCG9-R:TCACCTCTTTCTGGACTTGGTGAC

[0042] Using correctly sequenced fragments as templates, primers PgABCG9-1300-F and PgABCG9-1300-R were used to amplify the gene, which was then ligated into the Kpn I and BamHI sites of the pCAMBIA1300 overexpression vector. After successful sequencing, the gene was transformed into Agrobacterium competent cells EHA101 using the heat shock method. Colony PCR detection was performed using primers PgABCG9-1300-F and PgABCG9-1300-R. Single colonies showed a single bright band with a band size consistent with the target gene, indicating that both expression vectors had been successfully transformed into Agrobacterium competent cells. Positive colonies were picked and cultured.

[0043] The primer sequences used are as follows:

[0044]

[0045] Select positive Agrobacterium clones and incubate them at 28℃ with shaking at 200 rpm for 16 h. Add 100 μL of the mixed Agrobacterium solution to 100 mL of (1:1000) YEP liquid medium (containing 50 μg / mL Kan and 50 μg / mL Rif), and incubate at 28℃ with shaking at 220 rpm for approximately 16 h, until the OD value is reached. 600 The bacterial colonies were collected by centrifugation at 3000 rpm for 10 min. The collected Agrobacterium was resuspended in 1 / 2 MS liquid medium containing 5% sucrose and 0.02% Silwet L-77, and the OD value was adjusted accordingly. 600 It is approximately 0.8.

[0046] Wild-type Arabidopsis thaliana (Col-0) was infected using the inflorescence immersion method, while pCAMBIA 1300 empty vector was transformed as a control material (WT). Infected Arabidopsis seeds were sown on 1 / 2 MS solid medium containing 200 μg / mL carbenicillin and 30 μg / mL hygromycin. Plants that germinated and grew into seedlings were considered positive, and T2 generation homozygotes were screened out. DNA was extracted from T2 generation Arabidopsis leaf tissue as a template for full-length PCR detection of PgABCG9.

[0047] A band of the same size as the target gene fragment was detected in multiple transgenic lines, while no band was detected in the wild type, indicating that PgABCG9 was successfully expressed at the Arabidopsis DNA level.

[0048] Example 3 Phenotypic identification of transgenic Arabidopsis

[0049] Under the same culture conditions, WT and two different PgABCG9 overexpression T3 generation homozygous lines (named OE#1 and OE#5, respectively) were sown. When the WT and OE lines were grown in the soil, the OE line grew significantly weaker than the WT line (e.g., ...). Figure 2 -A). Plant height and aboveground biomass were measured at maturity, revealing that the plant height and biomass of the two OE lines were significantly lower than those of the WT line (e.g., as shown in Figure A). Figure 2 -B and Figure 2 -C is shown).

[0050] Example 4 Observation of lignin accumulation in transgenic plants

[0051] One-month-old WT and PgABCG9 transgenic Arabidopsis thaliana stems from the same location (1 cm or more from the base) under the same culture conditions were stained using the phloroglucinol method. The steps are as follows:

[0052] (1) Dissolve phloroglucinol in 95% anhydrous ethanol and 30% hydrochloric acid (volume ratio 1:1) to achieve a final concentration of 10% for phloroglucinol.

[0053] (2) After paraffin sectioning the tissue to be stained, stain it with phloroglucinol solution for 5 min.

[0054] (3) Observe the staining results under a microscope.

[0055] The results are as follows Figure 3 As shown, the staining intensity of stem sections from PgABCG9 transgenic plants was significantly reduced compared to WT.

[0056] In addition, the stem diameter, lignin content, and xylem cell wall thickness of Arabidopsis thaliana were measured. The results showed that the stem diameter of the OE line was significantly smaller than that of the WT line (e.g., ...). Figure 4 As shown in -A), the lignin content of the OE strain was significantly lower than that of the WT strain (as shown in -A). Figure 4 As shown in -B), the cell wall thickness of the OE strain is significantly smaller than that of the WT strain (as shown in Figure B). Figure 4 -C is shown).

[0057] These results indicate that PgABCG9 expression can inhibit lignin deposition and cell wall lignification.

[0058] Example 5 Analysis of targeted metabolites in the lignin synthesis pathway and detection of expression levels of lignin synthesis-related genes

[0059] Two homozygous lines of PgABCG9 and the wild type were sown under the same culture conditions. After 6 weeks of growth, the stems were collected, frozen in liquid nitrogen, and stored at -80°C for targeted metabolomics analysis and RNA extraction.

[0060] We commissioned Wuhan Maiwei Metabolic Biotechnology Co., Ltd. to use targeted metabolomics to detect related metabolites in the lignin synthesis pathway, including L-phenylalanine, cinnamic acid, p-coumaric acid, caffeic acid, ferulic acid, sinapic acid, p-coumaraldehyde, caffeic acid, coniferaldehyde, sinigral, p-coumarol, caffeol, coniferol, and sinigral.

[0061] like Figure 5 As shown, the contents of lignin monomers coniferyl alcohol, sinigrin, and p-coumaryl alcohol, as well as the lignin monomer precursors coniferaldehyde, sinigrin, and p-coumaryl alcohol, were significantly reduced in PgABCG9 transgenic Arabidopsis thaliana. Total RNA was extracted from the stems of OE and WT plants and reverse transcribed into cDNA. Using cDNA as a template, six genes reported to be involved in lignin synthesis were selected for quantitative RT-PCR detection.

[0062] The qRT PCR primer sequences used are as follows:

[0063] F5H-QF: CCCGTGACAATATCAAAGCAATC

[0064] F5H-QR: CTCCGTAATAACTCCGTTAAGGC

[0065] LAC4-QF:TATCCAGGTCCCACAATTCTACG

[0066] LAC4-QR:GGCACTGAGTTATGTAAGCAGGC

[0067] C4H-QF:TCGTGCCTCACATGAACCTC

[0068] C4H-QR: GCTTCCACGTGCGATTCTTC

[0069] CAD5-QF: GTAATTGACACGGTGCCTGTTC

[0070] CAD5-QR:GCTCCCCGTTATCACTTTCCTC

[0071] MYB58-QF:AGATCTCTCTCCCAAAGCAAGCTG

[0072] MYB58-QR:GGTGTCTTCTTCCTCTGCACT

[0073] COMT-QF: CTTCCGTTCTTCCGATGGCT

[0074] COMT-QR: GAAAGTTTACGGTTGGAGCAGG

[0075] like Figure 6 As shown, the expression levels of genes such as cinnamic acid 4-hydroxy lyase (C4H), cinnamic acid 4-hydroxy lyase (CAD5), ferulic acid-5-hydroxylase (F5H), caffeate oxymethyltransferase (COMT), laccase (LAC4), and the transcription factor MYB58, which regulates lignin synthesis, were significantly downregulated. This indicates that overexpression of PgABCG9 reduces lignin synthesis and accumulation by inhibiting the expression levels of genes related to the lignin synthesis pathway.

[0076] Example 6 PgABCG9 transgenic Arabidopsis treated with exogenous lignin monomers

[0077] After sterilization, WT and PgABCG9 transgenic Arabidopsis seeds (OE#1 and OE#5) were sown on MS medium containing 2% sucrose, 1% agar, and 0.5 g / L MES (pH = 5.8). The MS medium for the two treatment groups was supplemented with 1.5 mmol / L coniferyl alcohol and 1.5 mmol / L sinigrin, respectively.

[0078] The plates were incubated at 4°C for 2 days, followed by incubation in an incubator under a 16-hour light (22°C) / 8-hour dark (20°C) cycle, with a light intensity of 300 μmol / (s·m). 2 The relative humidity is 60%.

[0079] Phenotypic changes and biomass and root length were observed after 10 days of growth. Figure 7 As shown, under normal growth conditions, there was no significant difference in growth between the WT and OE lines. On 1 / 2 MS medium containing 1.5 mM sinaponicoyl or coniferol, the root lengths of the two OE lines were significantly longer than those of the WT lines, and the biomass produced by the OE lines was 1.5 times that of the WT lines. Treatment with exogenous lignin monomers demonstrated that overexpression of PgABCG9 could reduce the toxic effects of sinaponicoyl and coniferol on plant growth, confirming that PgABCG9 is involved in the transport of lignin monomers.

[0080] Example 7 Subcellular localization of PgABCG9 protein

[0081] PgABCG9ORF, which lacks the stop codon, was amplified using PgABCG9AL-F and PgABCG9AL-R, and then inserted into the BamHI and Kpn I sites of the pXZP008-GFP vector.

[0082]

[0083] The obtained construct was co-transformed with the Golgi apparatus marker into Arabidopsis mesophyll protoplasts, and the fluorescence signal was observed and evaluated by confocal laser scanning microscopy (Confocal System-UltraViewVoX, Perkin Elmer).

[0084] Transient expression in Arabidopsis mesophyll protoplasts revealed that GFP signaling was detected intracellularly as numerous dispersed punctate structures. Most of the GFP signal overlapped with the trans-Golgi marker ST-mRFP, while only a very small number overlapped with the cis-Golgi marker Man1-mRFP. This indicates that PgABCG9 is localized to the Golgi apparatus.

[0085] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. PgABCG9 Genes, or containing PgABCG9 Gene recombination vectors, or those containing PgABCG9 The application of host cells in inhibiting plant lignin synthesis and accumulation; PgABCG9 The nucleic acid sequence of the gene is shown in SEQ ID No. 1, and the plant is Arabidopsis thaliana.