An InDel marker for identifying corn aphid resistance and its method and application

Abstract

The present invention relates to an InDel marker for identifying corn aphid resistance, a method and an application thereof, and relates to the technical field of molecular biology. The InDel marker is located at the 1511th and 1581th positions of the promoter region of the RTA1 gene. The primer sequence for verifying the InDel marker is shown in SEQ ID NO.3-4, wherein: the InDel marker at the 1511th position is an insertion or deletion of a 14bp base; the InDel marker at the 1581st position is an insertion or deletion of a 12bp base. The present invention finds that there are different Indel differences in the promoter region of the RTA1 gene of different corn ecotypes, and based on this, an InDel marker for identifying corn aphid resistance is developed. The InDel marker has a clearly distinguishable band after electrophoresis detection, and the band type difference is obvious between aphid-resistant / susceptible corn varieties. The detection method is simple, which is conducive to breeding aphid-resistant corn varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to aphid resistance traits of corn and an application thereof. Background Art

[0002] Maize (Zea mays) is a major food crop that plays a vital role in ensuring world food security. Frequent biotic stresses occur throughout the life cycle of maize, from development to reproductive stages, severely limiting the seed yield and quality of this crop. Among them, pests have long been considered one of the major adverse factors limiting maize growth. Maize leaf aphid (Rhopalosiphum maidis) is one of the most destructive phloem-feeding pests of maize. It has strong reproductive capacity and causes serious damage throughout the maize life cycle. In the early stages of plant growth, aphids are highly concentrated on maize leaves and sheaths, sucking nutrient solution from the plant while affecting its photosynthetic rate, resulting in poor plant growth and even death. In the middle and late stages, aphids reproduce on tassels and leaves, producing large amounts of honeydew, a sticky substance that prevents pollen from falling off, thereby severely reducing pollination efficiency and ultimately leading to yield losses. Aphids are also the most effective vectors of many plant viruses, including maize yellow dwarf virus and barley yellow dwarf virus, which can be transmitted with the transfer of aphids, causing serious defects in plant development.

[0003] Currently, aphid control relies heavily on the application of chemical insecticides, which seriously pollute the environment and lead to increased insect resistance. Therefore, identification of insect-resistant genes and germplasm resources is essential for the development of aphid-resistant maize varieties. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to the aphid resistance trait of corn and its application in order to solve the above problems.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] An InDel marker for identifying corn aphid resistance, the InDel marker is located at position -1511 and -1581 of the promoter region of the RTA1 gene, and the primer sequence for verifying the InDel marker is shown in SEQ ID NO.3-4; wherein:

[0007] The InDel at position -1511 is marked as GGGGGGGGGGGGGGG, which represents an insertion or deletion of 14 bp in total;

[0008] The InDel marker at position -1581 is GTGCATGCACGC, which is an insertion or deletion of 12 bp in total;

[0009] The RTA1 gene is an allele of LG1, with the gene number: Zm00001d002005, and is a member of the SPL family.

[0010] An InDel marker is used in identifying corn aphid resistance. When the 14bp base is inserted at position -1511 and the 12bp base is deleted at position -1581, the corn variety to be tested is an aphid-resistant corn variety; when the 14bp base is deleted at position -1511 and the 12bp base is inserted at position -1581, the corn variety to be tested is an aphid-susceptible corn variety.

[0011] As a further optimization scheme of the present invention, the InDel marker sequence for resistance to aphids is shown as SEQ ID NO.1, and the InDel marker sequence for sensitivity to aphids is shown as SEQ ID NO.2.

[0012] A method for identifying corn aphid resistance using InDel markers comprises the following steps:

[0013] S1, extracting the corn DNA to be tested;

[0014] S2, using the sequence containing the site where the InDel marker is located and the upstream and downstream bases thereof as an amplification template, designing InDel primers, and performing PCR amplification to obtain an amplification product containing the site where the InDel marker is located;

[0015] S3, performing genotyping detection on the amplified product to obtain the InDel marker type of the corn variety to be tested;

[0016] If the InDel marker types of the tested corn are RTA1--1511-ins, RTA1--1581-del, then the tested corn is aphid-resistant corn variety;

[0017] If the InDel marker types of the corn to be tested are RTA1--1511-del, RTA1--1581-ins, the corn to be tested is a corn variety susceptible to aphids.

[0018] The beneficial effects of the present invention are:

[0019] 1) The present invention found that there were different Indel differences in the promoter region of the RTA1 gene of different corn ecotypes, and after an aphid reproduction rate experiment, it was concluded that InDel 2 (RTA1--1581-ins / del) and InDel 3 (RTA1--1511-ins / del) were significantly correlated with aphid resistance. Based on this, an InDel marker for identifying corn aphid resistance was developed. The band of the InDel marker was clearly distinguishable after electrophoresis detection. The band type was significantly different between aphid-resistant / susceptible corn varieties. The detection method was simple, which was helpful to improve the targeting and pertinence of molecular marker selection and was beneficial to the breeding of aphid-resistant corn varieties.

[0020] 2) The InDel marker developed by the present invention provides new materials for biological control of aphids and provides a theoretical basis and gene resources for developing aphid-resistant crop lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the analysis diagram of six RTA1 haplotypes (Hap1-6);

[0022] Figure 2 The statistical graph of aphid reproduction rate on six RTA1 haplotype maize materials;

[0023] Figure 3 Statistical graph of the transcriptional activation experiment results of connecting LUC reporter genes to different promoter segments;

[0024] Figure 4 Agarose gel electrophoresis phenotyping diagram. DETAILED DESCRIPTION

[0025] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0026] 1. Materials

[0027] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0028] 2. Methods

[0029] 2.1 Sequence analysis of candidate genes

[0030] The promoter region (1700 bp) of the maize RTA1 gene of different maize ecotypes was sequenced and analyzed, and 9 insertion / deletion variants larger than 8 bp were identified, and 6 major RTA1 haplotypes were obtained, as follows: Figure 1 shown.

[0031] 2.2 RTA1 haplotype analysis

[0032] The same number of aphids were inoculated on the above six RTA1 haplotype corn materials. Ten days later, the aphid reproduction rate was statistically analyzed. The statistical results are as follows: Figure 2 As shown, it can be found that the aphid reproduction rate of corn materials carrying RTA1 haplotype 1 or 2 is low, while the aphid reproduction rate of corn materials carrying RTA1 haplotype 3, 4, 5, and 6 is high;

[0033] Combining the insertion / deletion variations of InDel 1-9 of RTA1 haplotypes 1-6 with the aphid resistance of corn materials of six RTA1 haplotypes, it was found that the insertion / deletion variations of InDel 2 and InDel 3 were significantly correlated with aphid resistance.

[0034] like Figure 3 As shown in the figure, a construct of a 1700bp RTA1 promoter fragment (upstream of ATG) connected to a LUC reporter gene was constructed. The promoter fragment was cloned from an aphid-resistant corn variety GEMS33 (haplotype 2: InDel 2 deletion; InDel3 insertion) and an aphid-susceptible corn variety CML122 (haplotype 3: InDel2 insertion; InDel3 deletion), respectively. These constructs were then transferred into corn protoplasts separately, and the results showed that the relative LUC reporter gene activity of the haplotype 2 promoter was significantly lower than that of the haplotype 3 promoter.

[0035] The sequences of InDel 2 and InDel 3 between the haplotype 2 and haplotype 3 promoters were replaced, and detection revealed that the transcriptional activity of the replaced fragments changed (after replacing the original haplotype 2 promoter on the aphid-resistant corn variety GEMS33 with the haplotype 3 promoter, the relative LUC reporter gene activity was significantly increased; after replacing the original haplotype 3 promoter on the aphid-susceptible corn variety CML122 with the haplotype 2 promoter, the relative LUC reporter gene activity was significantly decreased). This proves that the insertion / deletion variations of InDel 2 and InDel 3 affect the resistance of corn materials to aphids.

[0036] 2.3. Development of molecular markers

[0037] Based on the conclusions obtained in step 2.2 above, specific primers were designed for the sequence differences between InDel 2 (RTA1--1581-ins / del) and InDel 3 (RTA1--1511-ins / del) to develop InDel markers. The specific primer sequences are:

[0038] SEQ ID NO.3:RTA1-F:5'>CGTTTCCAGCAGTGCGAGGAG<3';

[0039] SEQ ID NO.4:RTA1-R:5'>TACTCGTCACCTTCTTCAACCTA<3'.

[0040] The aphid-resistant corn variety GEMS33 and the aphid-susceptible corn variety CML122 were used as materials (Lu Chen et al. Genomesequencing reveals evidence of adaptive variation in the genus Zea, Nature Genetics (2022), Published: 20 October 2022), DNA was extracted (SEQ ID NO.1: aphid-resistant corn variety GEMS33; SEQ ID NO.2: aphid-susceptible corn variety CML122), and used as a template for PCR amplification. The designed specific primers were used for amplification to obtain different gene fragments. The amplified fragments were molecular markers for aphids, and the fragments that could not be amplified were molecular markers for aphids resistance. The electrophoresis results were as follows: Figure 4 As shown, Figure 4 The band (110bp) of the aphid-susceptible corn variety CML122 was clearly discernible, while the aphid-resistant corn variety GEMS33 showed no band, with obvious differences and easy identification.

[0041] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An application of an InDel marker in identifying corn aphid resistance, characterized in that: The nucleotide sequence of the InDel marker is shown in SEQ ID NO.1-2; When the nucleotide sequence of the InDel marker is as shown in SEQ ID NO.1, the corn variety to be tested is an aphid-resistant corn variety; When the nucleotide sequence of the InDel marker is as shown in SEQ ID NO.2, the corn variety to be tested is an aphid-susceptible corn variety.

2. A method for identifying corn aphid resistance using InDel markers, characterized in that: The following steps are involved: S1, extracting the corn DNA to be tested; S2, using the sequence containing the site where the InDel marker is located and the sequence of the upstream and downstream bases as the amplification template, designing primers for the InDel marker, and performing PCR amplification to obtain an amplification product containing the site where the InDel marker is located; The nucleotide sequence of the InDel marker is shown in SEQ ID NO.1-2; The nucleotide sequence of the InDel-labeled primer is shown in SEQ ID NO.3-4: SEQ ID NO.3: Upstream primer: 5'-CGTTTCCAGCAGTGCGAGGAG-3'; SEQ ID NO.4: Downstream primer: 5'-TACTCGTCACCTTCTTCAACCTA-3'; S3, performing genotyping detection on the amplified product to obtain the InDel marker type of the corn variety to be tested; If the InDel marker type of the corn to be tested is as shown in SEQ ID NO.1, the corn to be tested is an aphid-resistant corn variety; If the InDel marker type of the corn to be tested is as shown in SEQ ID NO.2, the corn to be tested is a corn variety susceptible to aphids.

Images