A strain of Lactobacillus delbrueckii subspecies bulgaricus JF9 and its application in preparing digestion-promoting and weight-loss food and medicine

Abstract

The present invention belongs to the field of probiotics and application technology thereof, and in particular to a strain of Lactobacillus delbrueckii subsp.bulgaricus JF9 and its application in preparing digestion-promoting and weight-loss food and medicine. The present invention separates and purifies a strain of Lactobacillus delbrueckii subsp.bulgaricus JF9 strain from fermented yogurt, and the strain has excellent protease activity, can produce and secrete gamma-aminobutyric acid, can inhibit alpha-glucosidase activity, can remove DPPH free radicals and has excellent cellulase activity, can promote digestion and absorption of protein food, improve protein allergy; can resist depression and help sleep; lower blood sugar and lose weight; can resist oxidation whitening, delay aging, anti-inflammatory; promote the absorption of cellulose, improve constipation and other functions, and has important application value and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics and their application, and particularly relates to a strain of Lactobacillus delbrueckii subspecies bulgaricus JF9 and application thereof in the preparation of digestion-promoting and weight-loss food and medicine. Background Art

[0002] Lactobacillus delbrueckii subsp.bulgaricus, commonly known as Lactobacillus bulgaricus, is a Gram-positive bacillus belonging to the family Lactobacillaceae and the genus Lactobacillus. The bacterial body is short or long rod-shaped, generally about 2-9 μm × 0.5-0.8 μm in size, arranged in a single, parallel or chain form, with blunt ends, no movement, and no spores. Lactobacillus delbrueckii subsp.bulgaricus was first discovered and isolated from yogurt and named after the place (country) where it was discovered. The bacteria are facultative anaerobic bacteria, and the optimal growth temperature is generally 37℃~43℃. Different strains have different heat resistance. Some strains have good heat resistance and can maintain their activity for about 20 minutes in a high temperature environment close to 75℃. In addition, the bacteria also have strong proteolytic ability and acid resistance, and can reach the small intestine through the gastrointestinal tract in a low pH environment, where they proliferate and grow and play their probiotic role.

[0003] Lactobacillus delbrueckii subspecies bulgaricus is one of the approved food production and processing strains, and is also one of the strains that can be used for food. As a probiotic in the intestinal flora, it is also an edible lactic acid bacteria. Lactobacillus delbrueckii subspecies bulgaricus also helps intestinal peristalsis, and also has the functions of enhancing the digestive ability of the human body and improving immunity. Therefore, Lactobacillus delbrueckii subspecies bulgaricus has become a hot spot in current research as a probiotic lactobacillus with great potential. In recent years, Lactobacillus delbrueckii subspecies bulgaricus has been widely used in the production of probiotic preparations for humans and animals as a probiotic.

[0004] Studies have found that different strains of Lactobacillus delbrueckii subspecies bulgaricus have different probiotic functions: (1) Abdel-Bar NM found that Lactobacillus delbrueckii subspecies bulgaricus has good probiotic properties, can inhibit the growth of certain bacterial pathogens and spoilage microorganisms, stimulate the immune system, and thus improve the body's immune function, thereby reducing the probability of human cell cancer and lowering cholesterol levels (Abdel-Bar, N., Harris, ND and Rill, RL (1987) Purification and properties of an antimicrobial substance produced by Lactobacillus bulgaricus. Journal of Food Science 52, 411–415.). (2) Lactobacillus delbrueckii ssp. bulgaricus is a commonly used fermentation strain for dairy products. The DQHXNS8L6 strain has excellent fermentation characteristics and the potential to produce ACE inhibitory peptides, which can improve aortic fibrosis and vascular wall thickening, and ultimately achieve the effect of blood pressure regulation (Ye H, Zhang X, Jiang Y, et al. Comparative Peptidomics Analysis of Fermented Milk by Lactobacillus delbrueckii ssp. bulgaricus and Lactobacillus delbrueckii ssp. lactis. Foods. 2021 Dec 6; 10(12): 3028. doi: 10.3390 / foods10123028. PMID: 34945579; PMCID: PMC8701751.). (3) As one of the starter strains for commercial yogurt, there have been many reports on the study of its volatile flavor substances at home and abroad.Dan et al. studied the higher concentrations of aldehydes and ketones in the 1:1000 treatment combination of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus ND03 (Dan T, Wang D, Wu S, et al. Profiles of Volatile Flavor Compounds in Milk Fermentedwith Different Proportional Combinations of Lactobacillus delbrueckiisubsp.bulgaricus and Streptococcus thermophilus. Molecules. 2017Sep 29; 22(10): 1633. doi: 10.3390 / molecules22101633. PMID: 28961194; PMCID: PMC6151417.). (4) In the pharmaceutical industry, some secondary metabolites produced by Lactobacillus delbrueckii subspecies bulgaricus during the fermentation process can play many physiological functions, mainly including maintaining the balance of human intestinal flora, improving intestinal nutrient absorption and utilization, anti-inflammatory and antibacterial, and regulating the body's immune activity. These Lactobacillus delbrueckii subspecies bulgaricus with physiological functions have played an important role in reducing the colonization of Clostridium difficile cells in colon cells, treating axillary odor, and accelerating wound healing in diabetic patients.

[0005] Because Lactobacillus delbrueckii subspecies bulgaricus has source diversity, it has genetic diversity and functional diversity, and thus different Lactobacillus delbrueckii subspecies bulgaricus strains have different prebiotic functions. However, the current research on the separation and identification, prebiotic characteristics and metabolic mechanism of Lactobacillus delbrueckii subspecies bulgaricus is still less, which has also affected the development and utilization of Lactobacillus delbrueckii subspecies bulgaricus to a certain extent. Therefore, it is necessary to further develop new Lactobacillus delbrueckii subspecies bulgaricus strains according to the different sources of Lactobacillus delbrueckii subspecies bulgaricus, and determine its efficacy according to the function of the strain or the prebiotic metabolites, clarify its application prospects, and make it better play a prebiotic role. In summary, the research and application of probiotic Lactobacillus delbrueckii subspecies bulgaricus has a relatively broad development space. Summary of the invention

[0006] In order to overcome the deficiencies of the above-mentioned prior art, the present invention separates and purifies a Lactobacillus delbrueckii subsp.bulgaricus JF9 strain from fermented yogurt. The strain has excellent protease activity, can produce and secrete gamma-aminobutyric acid, can inhibit alpha-glucosidase activity, can scavenge DPPH free radicals, has excellent cellulase activity, and has important potential application value in the fields of promoting digestion and losing weight.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a Lactobacillus delbrueckii subsp. bulgaricus JF9 strain, which was deposited in the China Center for Type Culture Collection on October 25, 2023, with the accession number: CCTCC NO: M 20232015; the 16S rDNA sequence of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain is shown in SEQ ID No: 1.

[0009] The second aspect of the present invention provides use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect in producing protease.

[0010] Research has found that the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce protease, suggesting that Lactobacillus delbrueckii subspecies bulgaricus JF9 strain is expected to be used to produce protease, and through this property of producing protease, it can be used to promote the human body's digestion and absorption of protein in food, anti-allergy, and help animals digest and absorb nutrients.

[0011] The third aspect of the present invention provides use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect in producing γ-aminobutyric acid.

[0012] Research has found that the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce γ-aminobutyric acid (GABA), suggesting that Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can be used to produce GABA, and through this characteristic of producing GABA, it can be used to improve the body's sleep quality, anti-depression, anti-anxiety, lower blood pressure, improve lipid metabolism and other fields.

[0013] The fourth aspect of the present invention provides use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0014] Studies have shown that the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can effectively inhibit the activity of α-glucosidase, which is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, suggesting that Lactobacillus delbrueckii subspecies bulgaricus JF9 strain is expected to be used in areas such as lowering blood sugar and inhibiting obesity.

[0015] The fifth aspect of the present invention provides the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect for preparing a DPPH free radical scavenger.

[0016] Research has found that the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can scavenge DPPH free radicals and thus avoid the harm caused by such free radicals to the body. It can be used in anti-aging, cancer prevention, cardiovascular and cerebrovascular protection and other fields.

[0017] The sixth aspect of the present invention provides use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect in producing cellulase.

[0018] Research has found that the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce cellulase, suggesting that Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can be used to produce cellulase, and through this characteristic of producing cellulase, it can be used to promote the human body's digestion and absorption of protein in food, improve the absorption of small peptides and amino acids, and anti-allergy.

[0019] The seventh aspect of the present invention provides a bacterial agent with probiotic function, wherein the bacterial agent comprises the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain described in the first aspect.

[0020] Preferably, the bacterial agent is a fermentation product of Lactobacillus delbrueckii subsp. bulgaricus JF9 strain.

[0021] Preferably, in the field of medical applications, the bacterial agent also includes pharmaceutically acceptable excipients.

[0022] More preferably, the excipients include carriers and excipients, and the excipients refer to diluents, adhesives, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carrier is a functional pharmaceutical excipient available in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0023] Preferably, in the field of medical applications, the dosage form of the bacterial agent includes injection, tablet, granule, capsule, pill, sustained release agent, oral liquid preparation. The above dosage forms refer to the dosage forms commonly used in clinical practice. The pharmaceutical preparation can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention separates and purifies a strain of Lactobacillus delbrueckii subsp.bulgaricus JF9 from fermented yogurt, and the strain has multiple prebiotic effects, including excellent protease activity, can produce and secrete γ-aminobutyric acid, can inhibit α-glucosidase activity, can remove DPPH free radicals and has excellent cellulase activity. Therefore, the Lactobacillus delbrueckii subsp.bulgaricus JF9 strain has the functions of promoting digestion and absorption of protein food, improving protein allergy, anti-depression and sleep aid, lowering blood sugar and losing weight, anti-oxidation whitening, delaying aging, and anti-inflammatory, promoting the absorption of cellulose, improving constipation, etc. It can be seen that the Lactobacillus delbrueckii subsp.bulgaricus JF9 strain newly isolated by the present invention has multiple prebiotic effects, can be used in the fields of promoting digestion and weight loss, for example, it can be made into medicines for promoting digestion and weight loss, and has important application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the phylogenetic tree of Lactobacillus delbrueckii subsp. bulgaricus JF9 strain (all strains are derived from the Genome database of NCBI);

[0027] Figure 2 This is the degradation experiment of Lactobacillus delbrueckii subspecies bulgaricus JF9 strain on milk plate (left side, blank control group; right side, experimental group);

[0028] Figure 3 Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce and secrete γ-aminobutyric acid;

[0029] Figure 4 The fermentation liquid of Lactobacillus delbrueckii subspecies bulgaricus JF9 can secrete substances that significantly inhibit the activity of α-glucosidase;

[0030] Figure 5 Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can scavenge DPPH free radicals;

[0031] Figure 6 This is an experiment on the degradation of cellulose plates by Lactobacillus delbrueckii subspecies bulgaricus JF9 strain (left side, blank control group; right side, experimental group). DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0033] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0034] The experimental materials involved in the following examples are as follows:

[0035] (1) Lactobacillus delbrueckii subsp.bulgaricus JF9 strain was isolated from fermented yogurt by the Runze Laboratory of the Intestinal Microbiology Research Group and stored in glycerol tubes at -80°C. Generally, colonies can be obtained by inoculating the strain on the surface of an MRS solid culture medium plate and inverting it in a 37°C constant temperature anaerobic incubator for 24 hours, or by shaking it in an MRS liquid culture medium in a 37°C constant temperature anaerobic incubator for 24-48 hours to obtain a fermentation liquid.

[0036] (2) Kits: γ-aminobutyric acid (GABA) detection kit (Cloud-Clone Corp., Cat: CEA900Ge), α-glucosidase inhibitor screening kit (abcam, Cat: ab284520), DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1).

[0037] (3) MRS plate: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium hydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO2 O to 1 L, adjust the pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20 min, and prepare MRS plates.

[0038] (4) MRS liquid medium: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium hydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, ddHO 2 O to 1 L, adjust the pH to 6.2-6.6, and sterilize by high pressure at 121°C for 20 min to prepare MRS liquid culture medium.

[0039] (5) MP plate: skim milk powder 10 g, sodium chloride 1 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, dipotassium hydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO 2 DMEM: O to 1 L, adjust pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20 min, and prepare MP plates.

[0040] (6) CMC plate: sodium carboxymethyl cellulose 10 g, ammonium sulfate 1.5 g, manganese sulfate 0.3 g, calcium chloride 0.2 g, sodium chloride 5 g, urea 0.3 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, potassium dihydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO 2 O to 1L, adjust the pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20min, and prepare into CMC plates.

[0041] Example 1 Isolation and Identification of Lactobacillus delbrueckii subsp. bulgaricus JF9 Strain

[0042] Lactobacillus delbrueckii subsp.bulgaricus JF9 strain was isolated from yogurt. The details are as follows:

[0043] Use sterile water to spread the yogurt sample from the buffalo milk shop on Jinbang Street, Shunde, Foshan on the MRS plate and culture it at room temperature for 3 days. Use a marker to number the colonies to be streaked and purified in the separation experiment plate, and mark the strain number on the plate accordingly. Pick the colony and inoculate it on the MRS plate, and purify the strain by the plate streaking method. If this method cannot separate the strain, it is necessary to pick the colony from the enrichment plate, dilute it with the MRS liquid culture medium gradient, and then spread it on the culture medium. Then refer to the Bergey Bacterial Identification Manual (8th Edition) and the Fungal Classification and Identification Manual to first distinguish the strains belonging to bacteria. A purified strain was initially isolated, with the strain number JF9. After 48 hours of culture, the colony of the bacteria was observed to be milky white and small in round shape.

[0044] Then, the obtained JF9 was molecularly identified by 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and then the whole genome of the JF9 strain was sequenced by Beijing Biomark Biotechnology Co., Ltd. The measured 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology of the JF9 strain with the known 16S rDNA sequence of Lactobacillus delbrueckii subsp.bulgaricus was >99%, and evolutionary analysis was performed with homologous strains ( Figure 1 ), confirming that the JF9 strain is a different strain of the same species, Lactobacillus delbrueckii subsp. bulgaricus.

[0045] Finally, the strain JF9 was deposited, and the deposit information is as follows: deposit time: October 25, 2023; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO:M 20232015; address of the depository: Wuhan University, Wuhan, China; classification name: Lactobacillus delbrueckii subsp.bulgaricus.

[0046] Lactobacillus delbrueckii subsp. bulgaricus is a probiotic strain with a wide range of probiotic effects, but strains from different sources have different effects, indicating that the new Lactobacillus delbrueckii subsp. bulgaricus JF9 isolated from yogurt in the present invention can be used as a probiotic and may have new effects and functions.

[0047] Lactobacillus delbrueckii subsp.Bulgaricus JF9 16S rDNA sequence (1436bp, SEQ ID No: 1):

[0048]

[0049] Example 1 Function and application of Lactobacillus delbrueckii subsp. bulgaricus JF9 strain

[0050] (1) Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce protease

[0051] The ability of Lactobacillus delbrueckii subsp. bulgaricus JF9 to secrete protease and hydrolyze proteins was identified and measured using skim milk plate medium (MP plate) according to the agar well diffusion test. During the experiment, 3uL of Lactobacillus delbrueckii subsp. bulgaricus JF9 bacterial solution with a concentration of 10Abs was added to the MP plate of the experimental group, and 3uL of blank MRS medium was added to the control group, and the plates were inverted and cultured in a 37°C constant temperature anaerobic incubator for 3 days. The results showed that compared with the control with blank medium added, strain JF9 could significantly degrade proteins, forming a clear degradation circle ( Figure 2 ), indicating that Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce protease that degrades milk protein.

[0052] Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce protease, which can be used as a probiotic strain to promote the digestion and absorption of protein in food by the human body and improve the absorption of small peptides and amino acids. At the same time, it can also be used for anti-allergy, for example, to improve food allergies caused by protein indigestion or non-absorption. In addition, it can also be used for the extraction of protease and applied to the production of protease in the food industry or the washing industry; it can also be used in microbial feed to help animals digest and absorb nutrients and improve the utilization rate of feed.

[0053] (2) Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce and secrete γ-aminobutyric acid (GABA)

[0054] The Lactobacillus delbrueckii subspecies bulgaricus JF9 strain cultured to the stable phase in MRS liquid medium was expanded to a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The GABA concentration in the fermentation supernatant was then determined by a GABA-specific ELISA kit (CEA900Ge). The results showed that compared with the low and medium concentrations of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of strain JF9 increased significantly, and the accumulated amount was 17.72 pg / mL, indicating that the Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce and secrete γ-aminobutyric acid ( Figure 3 ).

[0055] GABA is an important inhibitory neurotransmitter of the central nervous system, which is widely found in animals, plants and microorganisms. It has been confirmed that GABA, a small molecular weight non-protein amino acid, is safe for consumption and can be used as a food additive. Studies have shown that taking a certain amount of GABA can improve the body's sleep quality, resist depression, antianxiety, lower blood pressure, improve lipid metabolism, enhance memory and improve brain activity, accelerate brain metabolism, strengthen the liver and kidneys, promote ethanol metabolism (detoxification), and improve menopausal syndrome.

[0056] Therefore, the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can achieve the above multiple uses by producing γ-aminobutyric acid.

[0057] (3) The fermentation broth of Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can effectively inhibit the activity of α-glucosidase

[0058] The Lactobacillus delbrueckii subspecies bulgaricus JF9 strain cultured to the stable phase in MRS liquid medium was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected when the culture reached the stable phase for 24 hours, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The effect of the fermentation supernatant on the enzymatic activity of α-glucosidase to hydrolyze glucose was then determined by the α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the blank medium MRS without inhibition, the fermentation supernatant of strain JF9 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, and the inhibition rate was about 24.64%, indicating that the fermentation broth of Lactobacillus delbrueckii subspecies bulgaricus JF9 can effectively inhibit the activity of α-glucosidase ( Figure 4 ).

[0059] α-glucosidase is an enzyme that plays a role in the breakdown of carbohydrates and is associated with type 2 diabetes. Inhibiting α-glucosidase is one of the ways to control postprandial hyperglycemia, thereby contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood sugar levels and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0060] Therefore, the probiotic Lactobacillus delbrueckii subsp. bulgaricus JF9 strain has the ability to inhibit α-glucosidase activity, which makes it a potential probiotic for lowering blood sugar and inhibiting obesity.

[0061] (4) Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can scavenge DPPH free radicals

[0062] The Lactobacillus delbrueckii subspecies JF9 strain cultured to the stable phase in MRS liquid medium was expanded to a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The DPPH scavenging ability of the fermentation supernatant was then determined by a DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1). The results showed that compared with the blank control MRS, the fermentation supernatant of strain JF9 had a significantly improved scavenging ability of DPPH free radicals (*P<0.05), which was 195.2Trolox / mL, indicating that the Lactobacillus delbrueckii subspecies JF9 strain had a good ability to scavenge DPPH free radicals and showed good antioxidant capacity ( Figure 5 ).

[0063] Free radicals, also known as "free radicals" in chemistry, refer to atoms or groups with unpaired electrons formed by homolytic cleavage of covalent bonds in the molecules of a compound under external conditions such as light and heat. Since free radicals contain unpaired electrons, they are extremely unstable (especially hydroxyl free radicals), so they will steal electrons from neighboring molecules (including fats, proteins, and DNA) to keep themselves in a stable state. In this way, the neighboring molecule becomes a new free radical, which then steals electrons. Such a chain reaction will damage the structure of the cell, causing loss of cell function, gene mutation, and even death.

[0064] Free radicals have many negative effects. For example: (1) they weaken the resistance of cells, making the body susceptible to infection by bacteria and germs; (2) they produce chemical substances that damage cells and form carcinogens; (3) they hinder the normal development of cells, interfere with their recovery function, and make the cell renewal rate lower than the withering rate; (4) they damage the genetic gene (DNA) organization in the body, disrupt the operation and regeneration function of cells, cause gene mutations, and develop into cancer; (5) they damage the mitochondria (energy storage bodies) in cells, causing oxidative fatigue; (6) they damage proteins and enzymes in the body, leading to inflammation and aging; (7) they damage fats, causing lipid peroxidation, leading to atherosclerosis and cardiovascular and cerebrovascular diseases.

[0065] In addition, scavenging DPPH free radicals has many functions, such as: ① Anti-aging: A very obvious manifestation of free radicals on the human body is aging, and scavenging free radicals can prevent free radicals from damaging cells and prevent cells from aging and dying, which leads to the aging of the body. Therefore, scavenging free radicals has an anti-aging effect. ② Cancer prevention: When free radicals damage cell membrane proteins, they promote changes in cell function and shape, and damage other surrounding cells. When free radicals damage DNA, they will cause mutations in proto-oncogenes and tumor suppressor genes, leading to the formation of cancer cells. Therefore, scavenging free radicals has the effect of preventing cancer. ③ Protecting the cardiovascular and cerebrovascular system: Free radicals deposited on the blood vessel wall will destroy the elastic fibers of the blood vessel, causing hardening of vascular cells and the occurrence of atherosclerosis. At the same time, free radicals will cause lipid peroxidation, which is easy to cause various cardiovascular and cerebrovascular diseases such as thrombosis. Scavenging free radicals can prevent free radicals from depositing on the blood vessel wall, so it has the effect of protecting the cardiovascular and cerebrovascular system.

[0066] Therefore, the probiotic Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can avoid the harm caused by the free radical to the body by removing the DPPH free radical.

[0067] (5) Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can produce cellulase

[0068] The ability of Lactobacillus delbrueckii subsp. bulgaricus JF9 to degrade cellulose was identified and determined using cellulose plate medium (CMC plate) according to the agar well diffusion method. During the experiment, 3uL of Lactobacillus delbrueckii subsp. bulgaricus JF9 bacterial solution with a concentration of 10Abs was added to the CMC plate of the experimental group, and 3uL of blank MRS medium was added to the control group. After inverted culture in a 37°C constant temperature anaerobic incubator for 3 days, Congo red staining was performed. The results showed that compared with the control group with blank culture medium added, strain JF9 could significantly degrade cellulose, forming an obvious degradation circle ( Figure 6 ).

[0069] Since Lactobacillus delbrueckii subsp. bulgaricus JF9 strain can produce cellulase, the probiotic Lactobacillus delbrueckii subsp. bulgaricus JF9 strain can play the following multiple roles through the effect of producing cellulase: (1) It is used to promote the digestion and absorption of dietary ingredients; (2) It improves constipation. Probiotics break down cellulose in the intestine to produce a certain amount of water, which has the effect of softening stool; (3) Lowering cholesterol is the most important effect of cellulose. After being absorbed by the human body, soluble fiber can inhibit the body's absorption of cholesterol, and can combine with cholesterol in the intestine to accelerate the metabolism of cholesterol in the body, preventing the body from inducing hyperlipidemia due to high cholesterol, and can reduce the incidence of arteriosclerosis and coronary heart disease; (4) Cellulose, a non-sweet "sugar", can slow down the absorption of glucose by the blood, balance blood sugar concentration, and promote the sensitivity of muscle and fat cells to insulin, thereby preventing and assisting in the treatment of diabetes.

[0070] In addition, Lactobacillus delbrueckii subspecies bulgaricus JF9 strain can also be used for the fermentation extraction of cellulase; for degrading the cell walls of pathogenic fungi and controlling diseases; for the decomposition of cellulose in compost; and for the preparation of livestock and poultry feed, such as feed for monogastric animals such as pigs and chickens, to overcome their inability to utilize cellulose.

[0071] In summary, the newly isolated Lactobacillus delbrueckii subsp. bulgaricus JF9 strain of the present invention has multiple probiotic effects: (1) has excellent protease activity; (2) can produce and secrete γ-aminobutyric acid; (3) can inhibit α-glucosidase activity; (4) can remove DPPH free radicals; (5) has excellent cellulase activity. It can be seen that the newly isolated Lactobacillus delbrueckii subsp. bulgaricus JF9 strain of the present invention has important application value and economic value in the fields of promoting digestion and losing weight.

[0072] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus delbrueckii subsp. bulgaricus JF9, characterized in that: The Lactobacillus delbrueckii subsp. bulgaricus JF9 strain was deposited in the China Center for Type Culture Collection on October 25, 2023, with the deposit number: CCTCC NO:M 20232015; the 16S rDNA sequence of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain is shown in SEQ ID No:

1.

2. Use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1 in producing a protease for degrading milk protein.

3. Use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1 in producing γ-aminobutyric acid.

4. Use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1 in the preparation of an α-glucosidase inhibitor.

5. Use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1 in the preparation of a DPPH free radical scavenger.

6. Use of the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1 in producing cellulase.

7. A bacterial agent with probiotic function, characterized in that: The bacterial agent comprises the Lactobacillus delbrueckii subsp. bulgaricus JF9 strain according to claim 1.

8. The bacterial agent with probiotic function according to claim 7, characterized in that: The bacterial agent is a product obtained by fermentation of Lactobacillus delbrueckii subsp. bulgaricus JF9 strain.

Images