Hybridoma cell strain secreting anti-tilapia leucocyte interleukin-2 monoclonal antibody and its application
By constructing the hybridoma cell line 1C11F5, which contains a monoclonal antibody against tilapia IL-2, the problem of detecting IL-2 expression in tilapia has been solved, enabling the specific identification of IL-2 protein and IL-2-secreting lymphocytes, thus advancing research on fish T-cell immunity.
Patent Information
- Application Number
- CN202410279640.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-12
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2044-03-12
AI Technical Summary
Current technologies cannot detect the expression of interleukin-2 in tilapia at the protein or cellular level, nor can they specifically identify IL-2-secreting T lymphocytes, thus hindering the analysis of T cell immunity in fish.
A hybridoma cell line 1C11F5 containing a monoclonal antibody against the tilapia cytokine IL-2 was constructed. A screening system combining enzyme-linked immunosorbent assay (ELISA), flow cytometry, and Western blotting was used to prepare a monoclonal antibody that specifically identifies IL-2 protein and IL-2-secreting lymphocytes.
A monoclonal antibody that specifically identifies IL-2 protein and IL-2-secreting lymphocytes in tilapia was successfully prepared, providing an important tool for the study of adaptive immune mechanisms in bony fish and aiding in the exploration of T cell activation and proliferation.
Smart Images

Figure CN118530946B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish immunology, specifically relating to a hybridoma cell line that secretes a monoclonal antibody against interleukin-2 in tilapia T lymphocytes, the monoclonal antibody, its preparation method, and its application. Background Technology
[0002] Interleukin-2 (IL-2) is a T cell growth factor essential for T cell proliferation and the generation of effector and memory cells. It is mainly composed of CD4+. + T helper lymphocytes, activated CD8 + The production of T cells, natural killer (NK) cells, and NKT cells.
[0003] IL-2 is a T cell growth factor essential for T cell proliferation and the generation of effector and memory cells. Its binding to its receptor activates signaling pathways that affect CD4+. + T cell differentiation and CD8 + T cell function plays a crucial regulatory role. IL-2 can promote the generation of Th1 cells and also plays an important role in Th2 cell differentiation. IL-2 can induce CD8+ cell proliferation. + T cells express a series of pro-inflammatory factors and promote CD8 activation. + T cells express effector molecules that lyse target cells to enhance CD8. + T cell cytotoxic activity. Furthermore, IL-2 helps maintain Foxp3. + The generation, survival, and functional activity of regulatory T cells (Treg cells) are crucial. Currently, therapeutic strategies using IL-2, IL-2 monoclonal antibodies, and IL-2 variants have emerged in mammals to increase the number and function of Treg cells in order to treat autoimmune diseases.
[0004] Preliminary progress has been made in the study of IL-2 in various bony fish such as Perciformes and Salmonidae. However, due to the lack of tools, it is still impossible to detect the expression of IL-2 at the protein or cellular level, and it is also impossible to specifically identify T lymphocytes that secrete IL-2, which seriously hinders the analysis of T cell immunity in fish. Summary of the Invention
[0005] To address the shortcomings of the prior art, this invention provides a hybridoma cell line capable of stably secreting monoclonal antibodies against tilapia interleukin-2 and its applications. This line can specifically identify tilapia IL-2 protein and the lymphocyte population that secretes IL-2, which helps to further explore T cell activation and proliferation, and provides an important immunological tool for the study of adaptive immune mechanisms in bony fish (such as tilapia).
[0006] The technical solution provided by this invention to solve the above-mentioned technical problems is as follows:
[0007] On the one hand, a hybridoma cell line 1C11F5 containing a monoclonal antibody against the tilapia cytokine IL-2 is provided. The hybridoma cell line 1C11F5 was deposited at the China Center for Type Culture Collection (CCTCC) on March 9, 2024, with accession number CCTCC NO: C202470.
[0008] On the other hand, a method for preparing the above-mentioned hybridoma cell line 1C11F5 is also provided, which includes the following steps:
[0009] Obtain recombinant protein of tilapia cytokine IL-2;
[0010] Animals were immunized using recombinant IL-2 protein as an antigen.
[0011] After animal immunization, cell fusion, cell screening, and cloning were performed to obtain the hybridoma cell line 1C11F5.
[0012] Preferably, obtaining recombinant protein of tilapia cytokine IL-2 includes the following steps:
[0013] Cloning of the cytokine IL-2 gene; construction of the IL-2 gene expression vector; preparation of His-tagged recombinant protein; and renaturation of the IL-2 recombinant protein.
[0014] On the other hand, a monoclonal antibody against tilapia cytokine IL-2 secreted by the aforementioned hybridoma cell line 1C11F5 is also provided.
[0015] On the other hand, a method for preparing the above-mentioned monoclonal antibody is also provided, which includes the following steps:
[0016] Ascites preparation: Mice were taken and injected intraperitoneally with sterile paraffin oil;
[0017] The hybridoma cell line 1C11F5 described in claim 1 was resuspended and then injected intraperitoneally into mice.
[0018] The mice were euthanized, ascites fluid was collected, centrifuged, and aliquoted for storage.
[0019] The ascites fluid was purified to obtain the anti-tilapia cytokine IL-2 monoclonal antibody.
[0020] On the other hand, it also provides an application of the above-mentioned monoclonal antibody in the study of adaptive immune response in bony fish.
[0021] On the other hand, the application of the above-mentioned monoclonal antibody in the specific recognition of IL-2 protein in bony fish is also provided.
[0022] On the other hand, the application of the above-mentioned monoclonal antibody in identifying lymphocytes that secrete IL-2 is also provided.
[0023] On the other hand, the application of the above-mentioned monoclonal antibody in the preparation of fish disease prevention and control reagents / drugs is also provided.
[0024] Preferably, the fish disease prevention and control reagent / drug includes a fish disease prevention and control vaccine.
[0025] This invention successfully constructed a recombinant Nile tilapia IL-2 protein and used it as an antigen to immunize mice. A screening system combining enzyme-linked immunosorbent assay (ELISA), flow cytometry, and Western blotting was established, thereby successfully preparing a monoclonal antibody against Nile tilapia IL-2. The specificity of the monoclonal antibody was fully guaranteed, providing an important tool for subsequent research on the role and mechanism of T lymphocytes in the adaptive immune response of bony fish. Attached Figure Description
[0026] Figure 1 Figure showing the construction results of recombinant IL-2 protein from Nile tilapia;
[0027] Figure 2 This image shows the results of enzyme-linked immunosorbent assay (ELISA) for screening fusion cells.
[0028] Figure 3 Image showing the results of flow cytometry analysis of 1C11F5 hybridoma cell supernatant;
[0029] Figure 4 The results of Western blotting for the specific recognition of recombinant IL-2 protein in the supernatant of 1C11F5 hybridoma cells;
[0030] Figure 5 The figure shows the results of flow cytometry analysis of IL-2 protein expression in activated T cells in vitro.
[0031] Figure 6 To detect IL-2 in Nile tilapia before and after infection with Edwardsiella tarda using flow cytometry + Graph showing changes in cell population;
[0032] Figure 7 To detect the expression level of IL-2 protein after T cell activation using Western blotting;
[0033] Figure 8 To kill fish infected with Edwardsiella pneumoniae, CD3 + CD4-1 + Changes in the proportion of T cell subsets secreting IL-2 protein;
[0034] Figure 9To kill fish infected with Edwardsiella pneumoniae, CD3 + CD4-1 - Changes in the proportion of T cell subsets secreting IL-2 protein. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0036] Example 1:
[0037] This embodiment provides a hybridoma cell line 1C11F5 that secretes a monoclonal antibody against the tilapia cytokine IL-2. The hybridoma cell line 1C11F5 is characterized in that it was deposited on March 9, 2024, at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO: C202470, and the deposit address is Wuhan University, Wuhan, China. Furthermore, the tilapia mentioned is Nile tilapia (Oreochromis niloticus).
[0038] Furthermore, the preparation method of the above-mentioned hybridoma cell line 1C11F5 includes the following steps:
[0039] Step 1: Obtain the recombinant protein of tilapia cytokine IL-2, which specifically includes the following steps:
[0040] Cloning of the IL-2 gene produced by Nile tilapia T lymphocytes:
[0041] 1. Extract total RNA from Nile tilapia leukocytes, and select qualified RNA for reverse transcription to synthesize cDNA templates for later use;
[0042] 2. Design a primer pair set for PCR amplification, which includes: forward primer F1 and reverse primer R1, wherein the sequence of forward primer F1 is CGGATCCAAACCTATATCCAAACCCTTAAT (i.e., the nucleotide sequence shown in SEQ ID NO.1), and the sequence of reverse primer R1 is CAAGCTTGACTTCCGTGTTTATTTTGTGA (i.e., the nucleotide sequence shown in SEQ ID NO.2);
[0043] 3. Prepare the amplification reaction system, amplify according to the program to obtain the amplification product, and perform gel recovery on the amplification product. The recovered product is the isolated IL-2 gene (hereinafter referred to as "IL-2 gene") produced by Nile tilapia T lymphocytes. "Isolated" means that the gene has been isolated from the DNA sequences flanking it in the natural state, and that the gene has been separated from the components that accompany the nucleic acid in the natural state, and has been separated from the proteins that accompany it in the cell.
[0044] In this step, the amplification reaction system is 30-50 μL, which by volume includes 4-5% forward primer F1, 4-5% reverse primer R1, 45-50% 2×PrimerSTARDNAPolymerase, 4-5% cDNA template, and the remainder is dH2O.
[0045] Amplification program: 95-98℃, 10-12s, 55-58℃, 10-15s, 70-75℃, 8-10s, 32-40 cycles; then add 1μL rTaq and incubate at 72℃ for 20min.
[0046] The amplified IL-2 gene fragment sequence is shown in SEQ ID NO.3. By comparing the composition of introns and exons, this gene fragment is very similar to the gene structure of IL-2 in other bony fishes and has high homology.
[0047] Construction of IL-2 gene expression vector:
[0048] 1. Take 4.5 μL of the recovered product and mix it with the vector ligation system (0.5 μL LPMD19T vector, 5 μL solution Ⅰ), and place it at 16℃ for ligation for 10-15 h to obtain the first ligation system;
[0049] 2. Add 10 μL of the first ligation system to 50 μL of LDH5α competent cells, transform on ice for 30 min, then place in a 42°C water bath for 45 s and on ice for 2 min.
[0050] 3. Add 200-400 μL of LB liquid medium without resistance and incubate at 37°C in a shaking incubator for 1 hour; take 50-200 μL of the suspension and spread it on LB solid medium containing ampicillin resistance, and incubate at 37°C overnight.
[0051] 4. After selecting positive monoclonal bacteria and sequencing them, extract the PMD19T plasmid containing the IL-2 gene (i.e., IL-2-PMD19T plasmid). At the same time, take 1 μg each of the IL-2-PMD19T plasmid and the pET-28a empty plasmid and add them to the double enzyme digestion system (containing 1 μL BamHI, 1 μL HindIII, 4 μL Cutsmart buffer, and dH2O to make up to 40 μL). Digest at 37℃ for 4 h to obtain the two enzyme digestion products.
[0052] 5. Take 4.5 μL of each of the two enzyme digestion products and mix them with the DNA ligation system (containing 1 μL L4 DNALigase and 1 μL L4 DNALigase Buffer), and ligate at 15-18℃ for 10-12 h to obtain the second ligation system.
[0053] 6. Add the second ligation system to 50-100 μL of Transetta competent cells, transform on ice for 30 min, heat shock in a 42℃ water bath for 40-45 s, place on ice for 2 min, add 300-500 μL of fresh LB medium, and shake and culture for 1 h.
[0054] 7. Spread 50-200 μL of bacterial culture onto LB solid medium containing kanamycin resistance, incubate overnight, and pick positive single clones the next day;
[0055] 8. Expand the culture of positive monoclonal strains and then extract plasmids to obtain an expression vector containing the IL-2 gene (i.e., pET28a-IL-2 plasmid).
[0056] Preparation of His-tagged recombinant proteins:
[0057] 1. Inoculate the above-mentioned positive strains into 300 mL of liquid LB medium containing kanamycin resistance, and incubate in a 37°C constant temperature shaker at 200 rpm until OD. 600 =0.6, then add IPTG to induce (final concentration 0.5 mmol / L), continue culturing for 4 hours, and collect the bacterial pellet;
[0058] 2. Add 30 mL of Buffer 1 (weigh 1.482 g NaH2PO4, 5.749 g Na2HPO4, 29.3 g NaCl, 480 g urea, adjust pH to 7.4, add ddH2O to 1 L to obtain Buffer 1), resuspend the bacterial pellet, place it in an ice-water bath, and use an ultrasonic cell disruptor to disrupt the bacterial cells. After the bacterial cells are completely lysed, centrifuge at 10000 rpm and 4℃ for 10 min, and collect the supernatant of the bacterial lysate containing IL-2 recombinant protein into a new tube to complete the bacterial lysis.
[0059] 3. Purify the supernatant of the bacterial cell lysate containing recombinant IL-2 protein, specifically including the following steps:
[0060] Wash the nickel column with water to remove ethanol until the reading stabilizes; slowly add 50 mL of 0.2 M nickel sulfate to the nickel column, then wash away any loose nickel sulfate with water until the reading stabilizes; add Buffer 1, zero the column, and add the recombinant protein sample; add Buffer 1 to elute unbound recombinant protein sample; add 50 mM imidazole to fully elute impurities until the reading stabilizes; add 400 mM imidazole to elute the target protein. When the reading changes significantly, collect the protein into a centrifuge tube. The collected protein is the purified IL-2 recombinant protein; take an appropriate amount of the purified IL-2 recombinant protein and add it to 5×SDS loading buffer, heat in a boiling water bath for 5 min to denature the protein, and then detect the protein purity by SDS-PAGE.
[0061] IL-2 recombinant protein refolding:
[0062] The purified IL-2 recombinant protein was placed in a dialysis bag, which was then sequentially immersed in dialysis buffer (pH=9) with urea concentrations of 6M, 4M, 2M, 1M, and 0M, and dialyzed at 4°C for 12 hours. Next, the dialysis bag was placed in pre-cooled Tris-HCl (pH=8.5) solution and dialyzed at 4°C for 12 hours. The dialyzed IL-2 recombinant protein was centrifuged at 10000 rpm for 10 minutes at 4°C, the supernatant was collected and placed in a 10 kDa ultrafiltration tube, centrifuged at 4000 rpm for 4°C, and the resulting precipitate was the renatured IL-2 recombinant protein. Finally, the protein concentration was determined using a BCA protein quantification kit, and an appropriate amount of protein was added to 5×SDS loading buffer and heated in a boiling water bath for 5 minutes to denature the protein. The protein purity was then determined by SDS-PAGE. The protein purity results are shown below. Figure 1 As shown.
[0063] Step 2, Animal Immunization:
[0064] The refolded IL-2 recombinant protein was used as an antigen to immunize animals (including mice) at a dose of 100 μg per animal, administered in four doses. The first immunization was given intraperitoneally after emulsifying with Freund's complete adjuvant at a 1:1 ratio. Two weeks later, the second immunization was given intraperitoneally after emulsifying with Freund's incomplete adjuvant at a 1:1 ratio. The third and fourth booster immunizations were administered via tail vein injection of 100 μg per animal.
[0065] Step 3, Cell Fusion:
[0066] 1. Three days after the animals were immunized, they were euthanized by dislocating their cervical vertebrae. The thymus and spleen were removed, and tumor cell suspension and spleen cell suspension were prepared respectively.
[0067] 2. One week before fusion, resuscitate SP2 cells. One day before fusion, take SP2 cells at an appropriate density and passage them into culture flasks. Fuse the spleen cells in the spleen cell suspension obtained in step 1 above with the SP2 cells to obtain an SP2 spleen cell suspension. When performing the above fusion, use 10 mL of RPMI-1640 (-) to forcefully blow off the SP2 cells. Mix the spleen cell suspension and the SP2 spleen cell suspension at a volume ratio of 10:1 in a centrifuge tube, centrifuge at 1200 rpm for 8 min, discard the supernatant, and mix the two cell pellets thoroughly into a paste.
[0068] 3. Place the bottom of the centrifuge tube containing the two cell precipitates that have been mixed into a paste in a water beaker preheated to 37°C; take 1 mL of PEG solution preheated to 37°C and add it evenly, slowly and completely to the centrifuge tube within 90 seconds, and then let it stand in the water bath for 90 seconds.
[0069] 4. Continue to add 10-15 mL of preheated RPMI-1640(-) solution (37°C) to the centrifuge tube in 3-5 portions to dilute the PEG and render it ineffective; then add RPMI-1640(-) solution to a final volume of 30-50 mL, centrifuge at 800 rpm for 5-8 min, discard the supernatant, and obtain the cell pellet.
[0070] 5. Resuspend the cell pellet obtained in the previous step (i.e., step 4) with 3 mL of GIT cell culture medium to obtain a cell resuspension, and freeze a portion of it; add spleen cell suspension to the remaining cell resuspension, mix well to obtain a fusion cell system, and then add the fusion cell system to the wells of a cell culture plate (such as a 96-well plate) at a rate of 100 μL / well.
[0071] 6. Place the well plate in an incubator at 37°C and 5% CO2 concentration for culture. During the culture process, observe the cell growth under an inverted microscope. When the fused cells have filled 1 / 3 of the well plate, centrifuge and collect the supernatant of the fused cells (i.e., hybridoma cells) for later use.
[0072] Step 4: Fusion cell screening and cloning:
[0073] Enzyme-linked immunosorbent assay (ELISA) was used to screen fused cells, and the specific steps included:
[0074] 1. Dissolve 5 μg of recombinant IL-2 protein in 50 mM sodium carbonate-sodium bicarbonate buffer (pH = 9.8), coat each well with 100 μL of the solution into an ELISA plate, and incubate overnight at 4°C.
[0075] 2. Wash 3 times with PBST for 5 min each time, add 200 μL of 1% BSA to each well, and block at 37°C for 1 h;
[0076] 3. Wash 3 times with PBST for 5 min each time, add 100 μL of hybridoma cell supernatant to each well, and incubate at 37°C for 1 h;
[0077] 4. Wash 3 times with PBST for 5 min each time, add 100 μL of alkaline phosphatase-labeled (AP) goat anti-mouse IgG to each well, and incubate at 37°C for 1 h;
[0078] 5. Wash three times with PBST, 5 min each time. Add 100 μL of 50 mM sodium carbonate-sodium bicarbonate buffer (pH = 9.8) containing 0.1% (w / v) p-nitrophenylphosphate (pNPP, Sigma) and 0.5 mM MgCl2 to each well. Incubate in the dark for 30 min. Add 50 μL of 2 M NaOH to each well to stop the color development. Detect OD using a microplate reader. 405 The absorbance value at that location.
[0079] like Figure 2 As shown, the hybridoma cell supernatant in 18 wells (i.e., the hybridoma cell supernatant in the positive wells) can recognize the IL-2 recombinant protein, with hybridoma cell 1C11F5 being the most effective.
[0080] The supernatant of cells cultured in positive wells was analyzed by flow cytometry, and the specific steps included the following:
[0081] 1. Take the spleen of healthy Nile tilapia, wash, grind, and pass through a 200-mesh sieve. Centrifuge at 2000 rpm for 5 min, discard the supernatant, and obtain cell pellet. Resuspend the cell pellet in L15 medium and add it to Percoll separation solution (4 mL 52% Percoll + 4 mL 34% Percoll). Centrifuge at 500 g and 23°C for 35 min. Take the white ring layer of cells in the middle, wash with L15 medium, and obtain white blood cells.
[0082] 2. Leukocytes were resuspended in FACS Buffer to obtain a leukocyte suspension, which was then evenly distributed into 24-well cell culture plates at a ratio of 100 μL / well, serving as both the control and experimental groups. Both groups of cells were simultaneously treated with GolgiPlug at a ratio of 1:1000 (v / v). In the experimental group, each well was stimulated with PMA and Ionomycin (P+I) for 4 h. Afterward, 100 μL of the leukocyte suspension was added to each well of a 96V plate, centrifuged at 2500 rpm for 3 min, and the supernatant was discarded.
[0083] 3. Add the supernatant of hybridoma cells from the positive wells to the leukocyte pellet as the primary antibody, and use the supernatant of SP2 cell culture in the control wells. Incubate at room temperature for 30 min. Centrifuge the incubated primary antibody system at 2500 rpm for 3 min, discard the supernatant, and obtain the primary antibody cell pellet. Wash the obtained primary antibody cell pellet twice with 200 μL LACS Buffer.
[0084] 4. Add Alexa Fluor 647 fluorescent secondary antibody to the wells of the cell culture plate at a rate of 50 μL / well and incubate on ice in the dark for 30 min.
[0085] 5. Centrifuge the secondary antibody system incubated in step 4 at 2500 rpm for 3 min and discard the supernatant; resuspend the primary antibody cell pellet washed again in step 3 with 200 μL LFACS Buffer, centrifuge again, and wash the cell pellet once more; resuspend the cell pellet with 200 μL LFACS Buffer per well and screen for positive wells by flow cytometry.
[0086] The results are as follows Figure 3 As shown, a positive population (i.e., IL-2) was detected in hybridoma cell line 1C11F5. + The proportion of the total white blood cells increased from 9.81% before P+I stimulation to 27.8%, indicating that the monoclonal antibody secreted by the hybridoma cell line 1C11F5 can specifically recognize and bind to the T lymphocyte population of Nile tilapia.
[0087] The following steps were performed to detect hybridoma cell line 1C11F5 by Western blotting:
[0088] 1. Obtain recombinant IL-2 protein as described above, add 10 μL of 5×SDS loading buffer, mix well, and boil in a boiling water bath for 5 min to obtain the sample;
[0089] 2. Add 10 μL of sample to each well for SDS-PAGE electrophoresis. During electrophoresis, first maintain a constant current of 40 mA. When the sample reaches the boundary between the stacking gel and the separating gel, increase the current to 80 mA. Stop the sample when it reaches the appropriate position, referring to the position of the pre-stained marker.
[0090] 3. Fix the membrane with clamps in the following order: negative electrode - sponge - filter paper - SDS adhesive - NC membrane - filter paper - sponge - positive electrode. Transfer the membrane for 120 minutes at a constant voltage of 100V. During the transfer, the membrane transfer device should be placed on ice.
[0091] 4. Block the NC membrane in 10 mL of PBST containing 4% skim milk powder at room temperature for 1 h; after washing with PBST, cut the membrane according to the size of the target protein, add the supernatant of hybridoma cell line 1C11F5, and incubate overnight at 4°C.
[0092] 5. Wash with PBST three times, 10 minutes each time;
[0093] 6. Add 10 mL of PBST (containing 4% skim milk powder) to Alexa Fluor 680-conjugated goat anti-mouse IgG H&L (Abcam) at a ratio of 1:10000 (volume ratio) and incubate at room temperature for 1 h; wash with PBST 3 times, 10 min each time; scan the NC membrane using the Odyssey CLX imaging system.
[0094] The results are as follows Figure 4 As shown, the supernatant of hybridoma cell line 1C11F5 can specifically recognize Nile tilapia IL-2 recombinant protein.
[0095] Cloning of fused cells from positive wells specifically includes the following steps:
[0096] 1. Mice were euthanized by cervical dislocation, and the thymus was removed under aseptic conditions. The thymus cells were ground on a 200-mesh sieve and then pipetted with RPMI-1640 solution to form a thymus cell suspension.
[0097] 2. Centrifuge the above thymocyte suspension at 1000 rpm for 5 min, remove the supernatant, and resuspend in preheated GIT culture medium;
[0098] 3. Count the cells in the positive wells using a hemocytometer, then dilute the cells 10-fold with culture medium, take out 100 confluent cells, put them into thymocyte suspension, mix them evenly with a pipette, and then add 100 μL / well to the wells of a 96-well plate or other cell culture plate; then incubate in a CO2 incubator at 37°C.
[0099] 4. Once the cloned fusion cells have grown to 1 / 3 full in the wells, collect the supernatant and freeze them for later use.
[0100] In this embodiment, the cloned Nile tilapia IL-2 gene fragment was ligated to the pET-28a plasmid and transformed into the Transetta cell line to induce the expression of recombinant protein. This recombinant protein was then used as an antigen to infect mice. This protein maximally restored the activity of the Nile tilapia IL-2 protein in its natural state, thereby ensuring the effectiveness and specificity of the prepared monoclonal antibody.
[0101] Example 2:
[0102] This embodiment provides a monoclonal antibody against tilapia T lymphocyte cytokine IL-2 secreted by the hybridoma cell line 1C11F5 obtained in Example 1, and the preparation process of the monoclonal antibody includes the following steps:
[0103] Ascites preparation: 10-week-old BALB / c mice were intraperitoneally injected with 500 μL of sterile paraffin oil. Ten days later, the hybridoma cell line 1C11F5 in good growth condition was collected, the culture medium was washed off with PBS, and the cells were resuspended in 300 μL of sterile PBS. 2 × 10⁶ cells were then injected intraperitoneally into each mouse. 5 Cells; observe the immunized mice daily, and when the mice's abdomens swell and they become unable to move easily, euthanize them by dislocating their cervical vertebrae and collect ascites; centrifuge the ascites at 2000 rpm for 5 min, take the light yellow ascites in the middle, aliquot it and store it at -80℃.
[0104] Antibody purification: Take 200 μL of rProtein G Agarose into a 15 mL centrifuge tube, wash three times with PBS, then add 500 μL of aliquoted ascites fluid and dilute with PBS to 8 mL, incubate overnight at 4 °C; wash the beads 6 times with PBS, then elute with 500 μL of 0.1 M Glycine-HCl (pH = 2.8) to obtain the monoclonal antibody against tilapia T lymphocyte cytokine IL-2, neutralize the pH with 1 / 10 volume of 1 M Tris-HCl (pH = 8.5), aliquot and store at -80 °C.
[0105] Example 3:
[0106] This embodiment provides an application of the monoclonal antibody described in Example 2 in the study of adaptive immune response in bony fish.
[0107] Example 4:
[0108] This embodiment provides an application of the monoclonal antibody described in Example 2 in the specific recognition of IL-2 protein in bony fish.
[0109] Example 5:
[0110] This embodiment provides the application of the monoclonal antibody described in Embodiment 2 in the preparation of fish disease prevention and control reagents / drugs, and the fish disease prevention and control reagents / drugs include fish disease prevention and control vaccines.
[0111] The expression of IL-2 protein in T lymphocytes after combined stimulation with anti-Nile tilapia CD3ε and anti-CD28 monoclonal antibodies was detected, which included the following steps:
[0112] As described above, after isolating spleen leukocytes, 1 mL of 2 μg / mL anti-Nile tilapia CD3ε monoclonal antibody was used to coat a 24-well cell culture plate. The plate was then incubated overnight at 4°C. The supernatant was removed, and the plate was washed twice with PBS. Cells were then added, followed by the addition of 2 μg / mL anti-Nile tilapia CD28 monoclonal antibody. The plate was incubated for 4 hours.
[0113] Then, add 100 μL of leukocyte suspension to a 96V plate, centrifuge at 2500 rpm for 3 min, and discard the supernatant. Add IL-2 monoclonal antibody prepared with FACS Buffer to the leukocyte pellet and incubate at room temperature for 30 min. Centrifuge the incubated primary antibody system at 2500 rpm for 3 min, discard the supernatant, and obtain the primary antibody cell pellet. Wash the obtained primary antibody cell pellet twice with 200 μL of FACS Buffer. Add Alexa Fluor 647 fluorescent secondary antibody to the wells of the cell culture plate at 50 μL / well and incubate on ice in the dark for 30 min. Centrifuge the incubated secondary antibody system at 2500 rpm for 3 min and discard the supernatant. Resuspend the cell pellet with 200 μL of FACS Buffer / well and analyze using flow cytometry.
[0114] The results are as follows Figure 5 As shown, the proportion of T cells expressing IL-2 protein changed from 9.77% to 27.0% after activation, indicating that activated T cells highly express IL-2.
[0115] The experiment on changes in T lymphocyte population after infection with Edwardsiella piscicida included the following steps:
[0116] Healthy Nile tilapia were injected intraperitoneally with 2.4 × 10⁻⁶ ppm. 8 CFU / mL Edwardsiella faecium was used as the infection group, while Nile tilapia of uniform health were injected with the same dose of PBS as the control group. On day 5 after infection, leukocytes were isolated from the spleens of both the infection and control groups. 2 mL of FACS Buffer was used to resuspend the leukocytes in each well to obtain leukocyte suspensions. 100 μL of each leukocyte suspension was added to the wells of a plate, and the plates were centrifuged at 2500 rpm for 3 min. The supernatant was discarded, and 100 μL of IL-2 monoclonal antibody (1:400) prepared with FACS Buffer was added to each well. The plates were incubated at room temperature for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in 200 μL of FACS Buffer. The cells were centrifuged again, and the resulting cell pellet was washed once more. 50 μL of anti-mouse IgG Alexa Fluor 647 secondary antibody was added, and the plates were incubated on ice in the dark for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and 200 μL of FACS Buffer was added to each well. Resuspend the cells in buffer, centrifuge again, and wash the resulting precipitate once more; resuspend the cells in 200 μL FACS Buffer per well for flow cytometry analysis.
[0117] like Figure 6As shown, flow cytometry analysis revealed that IL-2 levels were elevated 5 days after infection with Edwardsiella tarda. + The proportion of T cells in total lymphocytes increased from 12.9% before infection to 63.8% after infection, indicating that T lymphocytes express large amounts of IL-2 in response to pathogen infection and play a potential role in antibacterial immunity.
[0118] The monoclonal antibody used in Example 2 to detect the expression of IL-2 protein after in vitro activation of T cells specifically includes the following steps:
[0119] Healthy Nile tilapia were injected intraperitoneally with 2.4 × 10⁻⁶ ppm. 8 CFU / mL Edwardsiella harzianum was used as the infection group, while Nile tilapia of the same health status were injected with the same dose of PBS as the control group. Leukocytes from the spleens of the infection group and the control group were isolated on days 3, 5, and 8 after infection. 40 μL of NP-40 lysis buffer was added to each tube to resuspend the cells, and the cells were lysed on ice for 30 min. The cells were centrifuged at 12,000 rpm and 4 °C for 10 min. The supernatant was collected, and 10 μL of 5×SDS loading buffer was added. After mixing, the cells were boiled in a water bath for 5 min to obtain the protein samples of each group.
[0120] As described above, the samples were subjected to SDS-PAGE electrophoresis, membrane transfer, blocking, and PBST washing three times for 10 min each time; IL-2 monoclonal antibody was added and incubated overnight at 4°C, followed by PBST washing three times for 10 min each time; Alexa Fluor 680-conjugated goat anti-mouse IgG H&L (Abcam) was added at a ratio of 1:10000 and incubated at room temperature for 1 h, followed by PBST washing three times for 10 min each time; the NC membrane was scanned using the Odyssey CLX imaging system.
[0121] The results are as follows Figure 7 As shown, compared with the uninfected group, IL-2 protein expression was significantly upregulated at 3, 5, and 8 days post-infection, with the highest level of accumulation in splenic lymphocytes at 5 days post-infection. These observations suggest that IL-2 is involved in the adaptive immune response in Nile tilapia.
[0122] CD3 + CD4-1 + T cell subsets and CD3 + CD4-1 - Detection of IL-2 expression in T cell subsets after Edwardsiella faecium infection
[0123] Healthy Nile tilapia were injected intraperitoneally with 2.4 × 10⁻⁶ ppm. 8A group of Nile tilapia was infected with CFU / mL Edwardsiella tarda, while a control group was formed by injecting the same dose of PBS into Nile tilapia of similar health status. The Nile tilapia were intraperitoneally injected with BFA one day before sampling. On day 5 after infection, leukocytes were isolated from the spleens of both the infected and control groups. CD3+ cells were sorted using anti-Nile tilapia CD3ε and CD4-1 monoclonal antibodies. + CD4-1 + T cell subsets and CD3 + CD4-1 - T cell subsets. Add 100 μL of cell suspension to each well of the plate and centrifuge at 2500 rpm for 3 min. Discard the supernatant, add 100 μL of IL-2 monoclonal antibody (1:400) prepared with FACS Buffer to each well, and incubate at room temperature for 30 min. Centrifuge at 2500 rpm for 3 min, discard the supernatant, resuspend the cells in 200 μL of FACS Buffer, centrifuge again, and wash the resulting cell pellet once more. Add 50 μL of anti-mouse IgG Alexa Fluor 647 secondary antibody and incubate on ice in the dark for 30 min. Centrifuge at 2500 rpm for 3 min, discard the supernatant, resuspend the cells in 200 μL of FACS Buffer, centrifuge again, and wash the resulting pellet once more. Resuspend the cells in 200 μL of FACS Buffer per well and perform flow cytometry analysis.
[0124] The results showed that approximately 25% of CD3 + CD4-1 + T cell subsets or CD3 + CD4-1 - Both T cell subsets can produce IL-2, indicating that both subsets of tilapia T cells have a fairly strong ability to secrete IL-2. Furthermore, as... Figure 8 As shown, after infection with Edwardsiella tarda, CD3... + CD4-1 + The proportion of T cell subsets secreting IL-2 increased from 23.7% before infection to 38.8%, such as Figure 9 As shown, CD3 + CD4-1 - The proportion of T cell subsets secreting IL-2 increased from 26.9% before infection to 43.2%. These results indicate that IL-2 can activate not only all T cells in Nile tilapia but also CD3+ cells. + CD4-1 - T cell subsets and CD3 + CD4-1 - T cell subsets.
[0125] In summary, this invention successfully constructed a recombinant protein of Nile tilapia IL-2, used it as an antigen to immunize mice, and established a screening system combining enzyme-linked immunosorbent assay (ELISA), flow cytometry, and Western blotting. This enabled the successful preparation of a monoclonal antibody against Nile tilapia IL-2, while ensuring the specificity of the monoclonal antibody. This provides an important tool for subsequent research on the role and mechanism of lymphocytes in the adaptive immune response of bony fish.
[0126] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A hybridoma cell line 1C11F5 that secretes a monoclonal antibody against the tilapia cytokine IL-2, characterized in that, The hybridoma cell line 1C11F5 was deposited at the China Center for Type Culture Collection (CCTCC) on March 9, 2024, with accession number CCTCC NO: C202470.
2. A monoclonal antibody against tilapia cytokine IL-2 secreted by the hybridoma cell line 1C11F5 as described in claim 1.
3. A method for preparing a monoclonal antibody as described in claim 2, characterized in that, Includes the following steps: Ascites preparation: Mice were taken and injected intraperitoneally with sterile paraffin oil; The hybridoma cell line 1C11F5 described in claim 1 was resuspended and then injected intraperitoneally into mice. The mice were euthanized, ascites fluid was collected, centrifuged, and aliquoted for storage. The ascites fluid was purified to obtain the anti-tilapia cytokine IL-2 monoclonal antibody.
4. The use of the monoclonal antibody as described in claim 2 in the specific recognition of IL-2 protein in bony fish, wherein the bony fish is Nile tilapia.
5. The use of the monoclonal antibody as described in claim 2 in identifying lymphocytes that secrete Nile tilapia IL-2.
Citation Information
Cited By
Host-derived cetyl soxhlet capable of targeted enhancement of fish T cell immunity and application of host-derived cetyl soxhlet
CN122060630A