KASP molecular marker for wheat scab resistance QTL Qfhb.sdau-4AL and its application

By locating a new QTL locus, Qfhb.sdau-4AL, on the wheat 4AL chromosome and developing the KASP molecular marker KASP-QFhb.sdau-4A.2, the problem of low efficiency in wheat scab resistance breeding was solved, and efficient screening and breeding of wheat scab-resistant varieties were achieved.

CN118531144BActive Publication Date: 2026-06-19SHANDONG AGRICULTURAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANDONG AGRICULTURAL UNIVERSITY
Filing Date
2024-05-08
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

The current technology has made slow progress in the discovery of wheat scab resistance genes and the study of molecular mechanisms, and existing molecular markers are difficult to efficiently assist in breeding, resulting in low efficiency in wheat scab resistance breeding.

Method used

By combining BSR-Seq with cluster separation analysis (BSA) and RNA sequencing (RNA-Seq), a novel QTL locus, Qfhb.sdau-4AL, was located in the 738-740 Mb region of wheat chromosome 4AL. The KASP molecular marker KASP-QFhb.sdau-4A.2 was developed for efficient detection of wheat scab resistance genotypes.

Benefits of technology

This method enables efficient screening and breeding of wheat varieties resistant to Fusarium head blight, provides new genetic resources, and improves the efficiency and accuracy of wheat Fusarium head blight resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118531144B_ABST
    Figure CN118531144B_ABST
Patent Text Reader

Abstract

This invention relates to the KASP molecular marker for wheat Fusarium head blight resistance QTL Qfhb.sdau-4AL and its application, belonging to the field of molecular marker technology for wheat Fusarium head blight resistance. Using BSR-Seq analysis, this invention located a novel QTL locus for wheat Fusarium head blight resistance on chromosome 4AL (738-740 Mb), named Qfhb.sdau-4AL. From this QTL interval, a KASP molecular marker was developed, named KASP-QFhb.sdau-4A.2, with a physical location of 738606950. This molecular marker shows a high correlation with Fusarium head blight resistance and can be applied to marker-assisted selection breeding. Therefore, this invention uncovers a new Fusarium head blight resistance gene, providing new gene resources for the breeding of new Fusarium head blight resistant wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to QTLs for resistance to wheat scab. Qfhb.sdau-4AL The KASP molecular marker and its application belong to the field of molecular marker technology for wheat resistance to Fusarium head blight. Background Technology

[0002] Fusarium head blight (FHB), caused by Fusarium graminearum and other fungal pathogens, is a widespread fungal disease that severely impacts wheat yield and quality. More importantly, infected grains contain fungal toxins, such as deoxynivalenol (DON), which are harmful to human and animal health, affecting their use as food and feed.

[0003] Studies have shown that wheat scab resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and the susceptibility of its phenotypic identification to environmental conditions, progress in the discovery of wheat scab resistance genes and the study of their molecular mechanisms has been slow. Currently, wheat germplasm with good scab resistance has been discovered in the United States, Japan, Brazil, and Switzerland. Based on these germplasms, scab resistance loci have been located on almost every chromosome of wheat, but most loci have relatively small effect values. The local wheat varieties Sumai 3 and Wangshuibai, originating from Jiangsu Province in my country, are recognized worldwide as having high scab resistance; the major gene locus Fhb1 located on the 3BS axis has been located in both of these materials. In 2019, Professor Ma Zhengqiang's team at Nanjing Agricultural University and Professor Bai Guihua's team at Kansas State University in the United States cloned the Fhb1 gene, which encodes the histidine-rich calcium-binding protein TaHRC.

[0004] Chinese patent document CN109207630A (application number 201811338221.4) discloses a molecular marker for detecting the Fusarium head blight resistance QTL Qfhb.hbaas-1AS and its usage method. This invention provides the application of a substance for detecting the genotype of the SNP IWB75039 locus on wheat chromosome 1AS in identifying or assisting in the identification of wheat Fusarium head blight resistance; it also provides the application of a substance for detecting the genotype of the SNP IWB75039 locus on wheat chromosome 1AS in the preparation of products for identifying or assisting in the identification of wheat Fusarium head blight resistance. This invention discovered the Fusarium head blight resistance locus Qfhb.hbaas-1AS located on the short arm of wheat chromosome 1A through genome-wide association analysis (GWAS), and further converted its associated SNP IWB75039 into the common PCR marker M-1AS-Fhb. This marker can be used to detect the genotype of the Fusarium head blight resistance QTL Qfhb.hbaas-1AS and for molecular breeding for Fusarium head blight resistance.

[0005] Chinese patent document CN109852719A (application number 201910171065.5) discloses a molecular marker for detecting the Fusarium head blight resistance QTL Qfhb.hbaas-5AL and its usage method. This invention provides the application of a substance for detecting the genotype of the SNP IWB42293 locus on wheat chromosome 5AL in identifying or assisting in the identification of wheat Fusarium head blight resistance; it also provides the application of a substance for detecting the genotype of the SNP IWB42293 locus on wheat chromosome 5AL in the preparation of products for identifying or assisting in the identification of wheat Fusarium head blight resistance. This invention discovered the Fusarium head blight resistance locus Qfhb.hbaas-5AL located on the short arm of wheat chromosome 5A through genome-wide association analysis (GWAS), and further converted its associated SNP IWB42293 into the common PCR marker M-5AL-Fhb. This marker can be used to detect the genotype of the Fusarium head blight resistance QTL Qfhb.hbaas-5AL and for molecular breeding for Fusarium head blight resistance.

[0006] Chinese patent document CN109797241A (application number 201910220614.3) discloses a molecular marker for detecting the Fusarium head blight resistance QTL Qfhb.hbaas-5AS and its usage method. This invention provides the application of a substance for detecting the genotype of the SNP IWB21456 locus on wheat chromosome 5AS in identifying or assisting in the identification of wheat Fusarium head blight resistance; it also provides the application of a substance for detecting the genotype of the SNP IWB21456 locus on wheat chromosome 5AS in the preparation of products for identifying or assisting in the identification of wheat Fusarium head blight resistance. This invention discovered the Fusarium head blight resistance locus Qfhb.hbaas-5AS located on the short arm of wheat chromosome 5A through genome-wide association analysis (GWAS), and further converted its associated SNP IWB21456 into the common PCR marker KASP-Fhb5AS. The two markers showed a genotyping concordance rate of 96.7% for 240 materials. This marker can be used to detect the genotype of Fusarium head blight resistant QTLQfhb.hbaas-5AS and for molecular breeding of Fusarium head blight resistant strains.

[0007] Breeding disease-resistant wheat varieties is an effective way to reduce the damage caused by Fusarium head blight. Therefore, further exploring Fusarium head blight resistance loci and developing their molecular markers is of great significance for breeding wheat varieties resistant to Fusarium head blight. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this invention provides a wheat scab resistance QTL. Qfhb.sdau-4AL KASP molecular markers and their applications.

[0009] The technical solution of the present invention is as follows:

[0010] A wheat scab resistance QTL Qfhb.sdau-4ALKASP molecular markers, the QTL Qfhb.sdau-4AL Located on chromosome 4AL, specifically at position 738-740 Mb; the KASP molecular marker is KASP-QFhb.sdau-4A.2 The specific location is 738606950, and the KASP molecular marker is... KASP-QFhb.sdau-4A.2 The SNP site base variation is a C / T variation, and wheat materials containing TT bases have better resistance to Fusarium head blight than wheat materials containing CC bases.

[0011] A wheat scab resistance QTL Qfhb.sdau-4AL Primers for the KASP molecular marker, comprising two forward primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and a reverse universal primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0012] According to a preferred embodiment of the present invention, different fluorescent detection sequences are added before the two forward primer sequences.

[0013] More preferably, the fluorescence detection sequences are FAM sequence and HEX sequence.

[0014] A wheat scab resistance QTL Qfhb.sdau-4AL The genotyping method involves extracting wheat genomic DNA, performing PCR amplification using primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, and determining the genotype after fluorescence detection.

[0015] A wheat scab resistance QTL Qfhb.sdau-4AL The product is a genotyping product, including detection materials based on the KASP molecular marker.

[0016] According to a preferred embodiment of the present invention, the detection substance comprises primers with the above-mentioned KASP molecular marker.

[0017] The above-mentioned wheat scab resistance QTLs Qfhb.sdau-4AL The application of KASP molecularly labeled detection substances in any of the following:

[0018] (1) To identify or assist in the identification of wheat resistance to Fusarium head blight;

[0019] (2) To prepare products for identification or to assist in the identification of wheat resistance to Fusarium head blight;

[0020] (3) Compare the resistance of wheat grains to Fusarium head blight;

[0021] (4) Select or screen wheat lines or varieties with relatively strong resistance to Fusarium head blight;

[0022] (5) Select or screen wheat lines or varieties with relatively weak resistance to Fusarium head blight;

[0023] (6) Prepare products for screening or comparing the strength of wheat resistance to Fusarium head blight.

[0024] According to a preferred embodiment of the present invention, the detection substance for the KASP molecular marker includes the primers for the aforementioned KASP molecular marker.

[0025] Beneficial effects:

[0026] Pooled transcriptome sequencing (BSR-Seq) is a highly efficient sequencing method combining cluster separation analysis (BSA) and RNA sequencing (RNA-Seq). It can effectively identify significantly differentially expressed loci and predict candidate genes. This invention utilizes BSR-Seq analysis to locate a novel QTL site for wheat resistance to Fusarium head blight on chromosome 4AL (738-740Mb), named... Qfhb.sdau- 4AL, KASP molecular markers were developed by screening the above QTL intervals and named... KASP-QFhb.sdau-4A.2 The physical location is 738606950. This molecular marker shows a high correlation with Fusarium head blight resistance and can be applied to marker-assisted selection breeding. Therefore, this invention has uncovered a new Fusarium head blight resistance gene, which can provide new gene resources for the breeding of new Fusarium head blight resistant wheat varieties. Attached Figure Description

[0027] Figure 1 A bar chart showing the chromosome distribution of SNP / Indel loci numbers.

[0028] Figure 2 The image shows a Manhattan plot of the Δ (SNP-index) chromosome distribution. In the plot, the scatter plot represents the original values, the black curve represents the fitted values, the blue curve represents the 95% confidence interval boundary, and the red curve represents the 99% confidence interval boundary.

[0029] Figure 3 ED 2 The Manhattan plot shows the chromosome distribution. In the plot, the scatter plot represents the original values, the black curve represents the fitted values, the blue curve represents the 95% confidence interval boundary, and the red curve represents the 99% confidence interval boundary.

[0030] Figure 4 The image shows a Manhattan plot of the Δ (SNP-index) distribution of chromosome 4A. In the plot, the scatter plot represents the original values, the black curve represents the fitted values, the blue curve represents the 95% confidence interval boundary, and the red curve represents the 99% confidence interval boundary.

[0031] Figure 5 ED of chromosome 4A 2The distribution is shown in the Manhattan plot. In the plot, the scatter plot represents the original values, the black curve represents the fitted values, the blue curve represents the 95% confidence interval boundary, and the red curve represents the 99% confidence interval boundary.

[0032] Figure 6 KASP molecular marker KASP-QFhb.sdau-4A.2 The genotyping results are shown in the figure. In the figure, R represents the individual genotype consistent with the parent Nankang 1 (disease resistant), S represents the individual genotype consistent with the parent Shannong 102 (disease susceptible), and NTC is the negative control.

[0033] Figure 7 KASP molecular marker KASP-QFhb.sdau-4A.2 The genotyping results are shown in the figure. In the figure, R represents the Fusarium head blight resistant strain, S represents the Fusarium head blight susceptible strain, and NTC represents the negative control. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the reagents and medicines involved in the embodiments are all commercially available products; unless otherwise specified, the experimental operations and steps involved in the embodiments are all conventional operations in the art.

[0035] Biomaterials involved in the embodiments:

[0036] The disease-resistant parent, Nankang 1, and the susceptible parent, Shannong 102, can be obtained from Shandong Agricultural University. The F4 generation population material constructed by crossing Nankang 1 with Shannong 102 consists of 426 lines.

[0037] Fusarium graminearum can be purchased from ordinary commercial channels.

[0038] Example 1 Sample Screening

[0039] Using the F4 generation population constructed from the cross between Nankang 1 and Shannong 102 as samples, wheat was planted in a greenhouse from September 2020 to January 2021 and from March to June 2021. Wheat grains were placed in seedling trays filled with a mixed substrate (nutrient soil: vermiculite: ordinary soil = 1:1:1, by mass). After germination at room temperature for 2 days, the seedlings were placed in a 4℃ light incubator for approximately 35 days of vernalization. The light incubator settings during vernalization are shown in Table 1. After vernalization, the seedlings were transplanted to pots in the greenhouse of Shandong Agricultural University and managed under standard care until maturity.

[0040] Table 1. Vernalization conditions in a light incubator

[0041]

[0042] The population material of Nankang No. 1 × Shannong No. 102 F5:6 generation, planted in greenhouse flowerpots in March 2021, was used. Normal plants at the early flowering stage of wheat were selected, and five ears of wheat of the same line were randomly chosen. Two florets in the middle of each ear were inoculated. A 20 μL suspension of Fusarium graminearum spores (1 μL containing 50 spores) was injected using a microsyringe. The mixture was sprayed with water, bagged, and kept moist for 3 days. After 3 days, the resealable bag was removed.

[0043] The disease incidence was investigated 7 days, 14 days, and 21 days after inoculation, and the number of diseased spikelets was recorded.

[0044] Diseased spikelet rate (DSR) = (Number of infected spikelets / Total number of spikelets per spikelet) × 100%

[0045] The length of the diseased spike rachis (DRL) was measured 21 days after inoculation.

[0046] Resistance gene effect = (Average diseased spikelet rate of materials carrying resistance genes - Average diseased spikelet rate of materials not carrying resistance genes) / Average diseased spikelet rate of materials not carrying resistance genes

[0047] The severity of disease in inoculated wheat materials was investigated, and the classification was based on the People's Republic of China Agricultural Industry Standard (Technical Specification for Evaluation of Wheat Disease and Pest Resistance NY / T 1443.4-2007): Grading of Severity of Wheat Resistance to Fusarium Head Blight and Evaluation Standards, as shown in Tables 2 and 3.

[0048] Table 2. Grading of Fusarium head blight severity and symptom description under single-flower drip inoculation conditions.

[0049]

[0050] Table 3 Evaluation criteria for Fusarium head blight resistance under single-flower drip inoculation conditions.

[0051]

[0052] Phenotypic identification was used to screen 20 highly resistant and 20 highly susceptible strains from the F5:6 generation population of Nankang 1 × Shannong 102. Equal amounts of ear tissue from the highly resistant and highly susceptible strains were mixed to construct two pools for RNA extraction and analysis.

[0053] Example 2 Sequencing Analysis

[0054] The entire process of BSR sequencing sample RNA extraction and quality testing, cDNA library construction and quality control, transcriptome sequencing, sequencing results and data analysis was carried out by Guangzhou Gediao Biotechnology Co., Ltd.

[0055] 1. RNA extraction and quality control

[0056] (1) Sample preparation: Take 20 highly resistant lines and 20 highly susceptible lines respectively. Take equal amounts of ear tissue from each line and mix them well. Construct two pools for RNA extraction: one for disease resistance and one for disease susceptibility. In addition, extract RNA from the ear tissue of the disease-resistant parent Nankang 1 and the disease-susceptible parent Shannong 102.

[0057] (2) Take an appropriate amount of wheat ear tissue, grind it thoroughly in liquid nitrogen environment, transfer it to a 1.5 mL centrifuge tube, add 1 mL of Trizol reagent, mix thoroughly, and place at room temperature for 10 min to allow for complete lysis;

[0058] (3) Add 200µL of chloroform, shake well to mix, centrifuge at 4℃ and 12000r / min for 10min;

[0059] (4) Take the supernatant, add an equal volume of phenol:chloroform mixture (25:24, v / v), shake well, centrifuge at 4℃, centrifuge at 12000r / min for 10min;

[0060] (5) Take the supernatant, add an equal volume of chloroform, shake well, centrifuge at 4℃, and centrifuge at 12000r / min for 10min;

[0061] (6) Take the supernatant, add an equal volume of isopropanol, let stand at -20℃ for 1 h, centrifuge at 4℃, and centrifuge at 12000 r / min for 10 min;

[0062] (7) Discard the supernatant, add 1 mL of 75% ethanol, wash the precipitate, centrifuge at 4°C, centrifuge at 8000 r / min for 5 min, discard the supernatant, and repeat twice;

[0063] (8) Dry in a fume hood for 2-4 minutes;

[0064] (9) Add 20~50μL RNase-Free Water, dissolve at room temperature for 10min, mix well and then centrifuge briefly;

[0065] (10) The RNA was quality checked by agarose gel electrophoresis, a nanodrop 2000 micro spectrophotometer, and an Agilent 2100. Store at -80℃.

[0066] 2. Construction and quality control of cDNA libraries

[0067] (1) Prepare the first-strand reaction buffer and random primer mixture (2×) (Table 4):

[0068] Table 4. First-chain reaction buffer (Buffer) and random primer mixture (2×)

[0069]

[0070] (2) Isolation of mRNA, fragmentation and addition of primers: eukaryotic mRNA was enriched with magnetic beads with Oligo (dT); 17 µL of the pre-prepared first-strand reaction buffer and random primer mixture (2×) was added to the tube, and the sample was incubated at 95 °C for 15 min to elute the mRNA from the magnetic beads.

[0071] (3) First-strand cDNA synthesis:

[0072] a. Add cDNA first-strand synthesis reagent to the mixture of fragmented and primer-added mRNA. The synthesis system is as follows:

[0073] Table 5 cDNA First-Strand Synthesis System

[0074]

[0075] b. Place the cDNA first-strand synthesis system in a preheated PCR instrument for reaction (overheating temperature: 105℃), synthesis conditions: 25℃ for 10 min, 42℃ for 15 min, 70℃ for 15 min, 4℃.

[0076] c. Immediately begin the second-chain synthesis reaction.

[0077] (4) cDNA second-strand synthesis:

[0078] Add the reagents listed in the table below to the above cDNA first-strand synthesis reaction solution (20 µL) to synthesize the cDNA second strand.

[0079] Table 6. Reagents required for cDNA second-strand synthesis

[0080]

[0081] (5) Preparation of cDNA library fragment ends:

[0082] a. Mix the following reagents in a sterile tube:

[0083] Table 7. Reagents required for cDNA library fragment end preparation

[0084]

[0085] b. Place the mixed reagents into a PCR instrument for reaction (heating temperature 75℃), reaction conditions: 20℃ for 30 min, 65℃ for 30 min, 4℃.

[0086] c. Proceed immediately with the connector connection procedure.

[0087] (6) Connect the connectors:

[0088] a. Add the reagents in the table below directly to the end-of-phase reaction solution (65 μL) from the previous step (Note: Dilute NEBNext Adaptor with Tris-HCl).

[0089] Table 8. Reagents required for connector connection

[0090]

[0091] b. Place in a PCR instrument, 20℃, for 15 min. Close the heat seal.

[0092] (7) Purify the ligation reaction solution

[0093] The reaction solution was diluted with water to 100 μL, purified using AMPure XP Beads, washed with 80% ethanol, eluted with ddH2O, and the eluent was used for the next reaction.

[0094] (8) PCR library amplification

[0095] a. The amplification system for PCR library amplification is shown in the table below:

[0096] Table 9 PCR library amplification system

[0097]

[0098] b. PCR cycling conditions: 98℃ for 30s; 98℃ for 10s, 65℃ for 75s, 12 cycles; 65℃ for 5s.

[0099] (9) Purify the PCR products using AMPure XP Beads (1.0×).

[0100] (10) Document Quality Inspection

[0101] The reagent kit used is the DNA 1000 assay kit (Agilent Technologies, 5067-1504). The DNA 1000 assay kit can detect sample fragments ranging from 25 to 1000 bp in size and 0.1 to 50 ng / µL in concentration.

[0102] The sequencing libraries were analyzed using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA), and library quantification was performed using real-time PCR.

[0103] 3. Illumina sequencing

[0104] Sequencing was performed on a Novaseq 6000 sequencer using the PE150 sequencing strategy.

[0105] 4. Data quality control

[0106] To ensure data quality and reduce interference from invalid data, the raw data was filtered. The raw sequences were processed using FASTP (version 0.18.0) (Chen... et al. (2018) Quality control was performed to filter low-quality data and obtain high-quality sequences (clean reads).

[0107] The reads filter conditions are as follows:

[0108] (1) Reads containing adapters;

[0109] (2) Reads containing ≥10% of unknown nucleotides (N);

[0110] (3) Reads that are all A bases;

[0111] (4) Low-quality reads (more than 50% of the reads have a quality value of Q≤20).

[0112] After the data is filtered, the composition and mass distribution of the bases are analyzed to visually demonstrate the data quality.

[0113] The results showed that 76,162,892, 62,759,864 and 74,168,292, 63,300,060 original sequences were generated from the resistant parent, susceptible parent, and resistant-susceptible pools, respectively. After filtering, 75,748,704, 62,419,952 and 73,748,806, 62,946,928 high-quality sequences were obtained, accounting for 99.43-99.46% of the total. Other invalid sequences accounted for a small percentage (Table 10).

[0114] Table 10 Data Filtering Statistics Table

[0115]

[0116] Note: The percentages are based on the proportion of the original sequence.

[0117] The anti-parent, susceptible, and anti-susceptible pools produced 11,424,433,800, 9,413,979,600, and 11,125,243,800, 9,495,009,000 bp of raw bases, respectively. After filtration, 11,322,396,712, 9,331,792,559, and 11,025,171,867, 9,414,154,647 bp of high-quality bases were obtained. The GC content after filtration was 51.56-52.02%, the sequencing quality ≥Q20 was 97.85-98.02%, and ≥Q30 was 94.09-94.55%, indicating good sequencing quality that met the requirements for subsequent analysis (Table 11).

[0118] Table 11 Base Information Statistics Table

[0119]

[0120] 5. Sequence alignment analysis

[0121] To eliminate the influence of residual rRNA, the short read alignment tool bowtie2 (Langmead et al., 2012) was used to align high-quality sequences (clean reads) to a wheat ribosome database. Reads that were aligned to ribosomes were removed, and the remaining unmapped reads were termed valid sequences. The alignment software HISAT2 (Daehwan) was used. et al. (2015) The effective sequences were aligned to the Chinese Spring reference genome (IWGSC_RefSeq_v2.1), the alignment rate and the chromosome distribution of the sequences were statistically analyzed, and the uniquely aligned sequences were analyzed.

[0122] Comparative analysis showed that 62,840,849, 51,567,191 and 63,774,745, 52,458,768 sequences from the resistant parent, susceptible parent, and resistant-susceptible pool were uniquely aligned to the reference genome, respectively. The proportions of these sequences varied between 82.83% and 86.71% across the four samples (Table 12).

[0123] Table 12 Comparison Reference Statistics

[0124]

[0125] Note: The number of reads after filtering ribosomes is called the effective sequence.

[0126] 6. Genomic variation detection

[0127] For uniquely mapped reads, chromosome sorting and repetitive sequence removal were performed on the alignment results using the variant detection software GATK (version 3.4-46) (DePristo). et al. SNP detection was performed using ANNOVAR (version 2) (Wang, 2011), and ANNOVAR (version 2) was used. et al. (2010) Functional annotations were added to the detected Variant.

[0128] To minimize background noise, SNP / Indel sites were filtered according to the following criteria, and sites meeting the following conditions were used for subsequent BSA analysis:

[0129] (1) When both parents exist, there must be differences between the parents and the segregation pattern must conform to the population type (the segregation pattern of the markers retained in the F1 population is nn×np, lm×ll, hk×hk, and the segregation pattern of the markers retained in other populations is aa×bb).

[0130] (2) When the parents are present, the sequencing depth of (both) parents must be greater than or equal to the given threshold. The threshold used in this analysis is 5×.

[0131] (3) Neither offspring pool is missing;

[0132] (4) The sequencing depth of each progeny pool should be greater than 10× and less than 500×;

[0133] (5) At least one offspring pool has an SNP-index greater than 0.3;

[0134] (6) At least one offspring pool has an SNP-index less than 0.7.

[0135] SNP and Indel variant detection was performed using the GATK4 software, and the data were statistically analyzed, yielding a total of 725,683 loci, including 692,717 SNP loci and 32,966 Indel loci (Table 13). To minimize background noise, SNP / Indel loci were filtered according to standards, resulting in 30,289 SNP / Indel loci, of which 30,109 were located on 21 chromosomes, accounting for 99.40% (Table 14). Figure 1 The number of SNP sites detected in the D genome is less than that in the A and B genomes. The B genome has the most SNP sites, with 15,172. The most are found in 5B and 1B, with 3,256 and 3,214 respectively. The fewest are found in 3D and 4D, with 188 and 131 respectively.

[0136] Table 13 Statistical results of SNP / Indel loci count

[0137]

[0138] Table 14 Statistics on the number of tags before and after filtering

[0139]

[0140] 7. BSA Analysis Method Based on SNP-index

[0141] Parental segregating SNPs will be screened from the population as molecular markers for subsequent QTL mapping using BSA (QTL-seq). Sliding window analysis will be used to calculate the frequency distribution of SNPs in the progeny samples, which is the progeny SNP-index. To reduce interference from windows with fewer than 10 SNPs in the sliding window analysis, the number of SNPs in each window across the entire genome will be counted first. The proportion of windows with ≥10 SNPs will be calculated, and a window size of 400kb (>95%) will be selected as the analysis parameter. Based on the SNP density distribution, with a window size of 400kb and a sliding step of 20kb, the frequency distribution of SNPs in the pooled samples will be calculated, which is the progeny SNP-index. A Manhattan plot will be used to visually represent the distribution of the pooled SNP-index on the chromosome. The mean SNP index for each window's SNP marker locus will be calculated, and a fitted curve will be plotted. The difference between the two pooled SNP-index values ​​will be calculated as Δ(SNP-index). The calculation process involved 1000 permutation tests to obtain the 95% and 99% confidence intervals (Δ(SNP index)) for each locus and window. Across the entire genome, peak regions exceeding the 95% confidence interval were selected as candidate regions, and SNPs / InDels within these candidate regions were annotated to screen for potential candidate functional mutations.

[0142] The SNP-index is calculated as follows:

[0143] The SNP-index of a specific locus is calculated as ρ(recessive) / (ρ(dominant) + ρ(recessive)).

[0144] ρ represents the depth of the locus in the mixed pool. When dominance and recessiveness can be clearly determined, Δ (SNP-index) has a clear directionality. A positive value indicates that the proportion of recessive alleles (or mutant alleles) in the recessive pool is higher than that in the dominant pool, which is usually the direction we are interested in. A negative value indicates that the proportion of recessive alleles (or mutant alleles) in the dominant pool is higher than that in the recessive pool.

[0145] 8. BSA Analysis Method Based on ED Method

[0146] The Euclidean Distance (ED) algorithm uses sequencing data to identify markers with significant differences between two pools. The calculation formula is shown below; a larger ED value indicates a greater difference in the marker between the two pools.

[0147] The formula for calculating the Euclidean distance is as follows:

[0148]

[0149] Where mut and wt represent recessive / mutant pools and dominant / wild-type pools, respectively, and A, C, G, and T represent the coverage depth of each allele. In order to widen the gap between the small and large values ​​and thus eliminate background noise, the original ED values ​​are usually exponentialized. The ED values ​​mentioned in this article refer to the results after exponentiation.

[0150] BSA analysis results based on SNP-index and ED method:

[0151] To reduce background noise, the calculated Δ(SNP-index) and ED method results were fitted using a sliding window method. The window size used in the sliding window was 2000kb, and the step size was 20kb. A window with 10 or more SNPs was considered a valid window; if the number of SNPs was insufficient, the results of that window were merged into the next window. The statistics of the number of valid sliding windows for SNP-index and ED results are shown in Table 15.

[0152] Table 15 Statistics on the number of effective sliding windows for SNP-index and ED method related indicators

[0153]

[0154] To visually represent the distribution of Δ (SNP-index) and the square of the original ED on the chromosome, a Manhattan plot is used to illustrate it. Figure 2 and Figure 3 The SNP-index (Δ) was filtered based on whether the fitted peak value within the sliding window was ≥0.55 or ≤-0.55, resulting in 32 valid windows. For ED... 2 Screening was performed using a sliding window fitting peak value ≥0.6 as a criterion, resulting in 42 valid windows. Combining two analysis methods, a new candidate QTL region was identified, located on chromosome 4AL, specifically 4AL (738-740Mb). Figure 4~Figure 5 ), named Qfhb.sdau-4AL There is one SNP site in this QTL region, with a physical location of 738606950, which shows a C / T base mutation and is named [name missing]. KASP-QFhb.sdau-4A.2Furthermore, within the candidate QTL region located on chromosome 3B, there are 395 SNP / Indel loci at a 95% confidence interval. Analysis indicates that this QTL region contains a major gene for resistance to Fusarium head blight. Fhb1 This also verified the results of the molecular markers.

[0155] Example 3: KASP primer design and genotyping detection

[0156] To further verify the relationship between the sites detected by BSR-Seq and wheat scab resistance, SNP sites on 4AL were selected, and KASP primers were designed using the sequences at both ends of these sites. These primers were then validated in parents and populations. Based on the physical location of the SNP sites, the sequences 100 bp before and after the SNP sites were obtained from the Wheat Research Consortium multi-omics data website (http: / / 202.194.139.32 / #). The locations and sequences of the SNP sites are detailed in Table 16. When the base of the SNP site is C, the nucleotide sequence of the SNP is shown in SEQ ID NO.4; when the base of the SNP site is T, the nucleotide sequence of the SNP is shown in SEQ ID NO.5.

[0157] Table 16 SNP molecular marker sequences and base variations

[0158]

[0159] KASP primers were designed for the SNP molecular marker sequences using the Polymarker website (http: / / polymarker.tgac.ac.uk / ) (Table 17). After primer design, a fluorescence detection sequence was added before the two forward primer sequences:

[0160] FAM sequence: GAAGGTGACCAAGTTCATGCT, SEQ ID NO.6,

[0161] HEX sequence: GAAGGTCGGAGTCAACGGATT, SEQ ID NO.7.

[0162] The primers were sent to Qingdao Sangon Biotech Co., Ltd. for synthesis.

[0163] Table 17 KASP Primer Sequences

[0164]

[0165] The specific experimental procedures for genotyping testing are as follows:

[0166] (1) Primer dissolution and mixing: Dilute each primer to 100 μM with ultrapure water and mix the primers according to the volume ratio of upstream primer 1: upstream primer 2: downstream primer: ultrapure water / buffer solution = 6: 6: 15: 13;

[0167] (2) Preparation of PCR system: The total volume of the amplification system is 10.0825 μL. The specific sample addition is shown in Table 18, and the PCR amplification program is shown in Table 19.

[0168] Table 18 PCR Amplification System

[0169]

[0170] Table 19 PCR Amplification Procedure

[0171]

[0172] (3) Fluorescence detection: The fluorescence signal was detected by the real-time fluorescence quantitative PCR system to determine the genotype of each strain, and the genotyping results were exported by Launch Kluster Caller software;

[0173] (4) Phenotypic test: The correlation between the genotyping data and the greenhouse phenotypic identification results in spring 2021 was analyzed using SPSS software (version 26) to determine the association between SNP sites and wheat scab resistance and to test the reliability of the localization interval.

[0174] The results showed that the QTLs for resistance to Fusarium head blight... Qfhb.sdau-4AL KASP molecular markers in the interval KASP- QFhb.sdau-4A.2 The classification results were good (Table 20). Figure 6 Correlation analysis between KASP test results and phenotypic traits revealed highly significant differences in phenotypic traits among different genotypes in the population. P< 0.01). KASP molecular marker. KASP-QFhb.sdau- 4A.2 The base variation at the SNP site was a C / T variation, and wheat materials containing the TT base showed better resistance to Fusarium head blight than wheat materials containing the CC base (Table 21). The genotyping results fully demonstrate the reliability of this KASP molecular marker and show a high correlation with Fusarium head blight resistance. This KASP molecular marker can be applied to marker-assisted selection breeding.

[0175] Table 20 Correlation Tests of KASP Primers

[0176]

[0177] Note: **At the 0.01 level (two-tailed), the correlation is significant.

[0178] Table 21 SNP base variations in disease-resistant and disease-susceptible materials: base types

[0179]

[0180] Example 4: Label Verification

[0181] Experimental materials: 31 wheat varieties from our research group. Planted in the agronomic experimental field of Shandong Agricultural University from 2022 to 2023, each variety was planted in 4 rows, with a row length of 1.2 meters and a row width of 25 cm, and 40 grains per row; 3 replicates were performed. The flowering period was closely monitored after heading; single-floret drip identification was performed on spikelets that had just begun to flower. The identification methods and resistance investigation and evaluation methods were the same as in Example 1.

[0182] Table 22 Disease Resistance Survey of Wheat Varieties

[0183]

[0184] Based on the survey of Fusarium head blight resistance after single-flower drip irrigation (Table 22), it was found that KASP-QFhb.sdau-4A.2 The molecular marker typing is consistent with the Fusarium head blight phenotype. Figure 7 Therefore, this KASP molecular marker can be used for molecular-assisted selection of wheat varieties resistant to Fusarium head blight.

Claims

1. A wheat scab resistance QTL Qfhb.sdau-4AL The KASP molecular marker, characterized by, The QTL Qfhb.sdau-4AL is located on the 4AL chromosome; the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO. 4 or SEQ ID NO. 5, the 101st nucleotide of the nucleotide sequence of the KASP molecular marker is the SNP site, the base variation of the SNP site is C / T variation, and the wheat material containing TT base is superior to the wheat material containing CC base in scab resistance.

2. A wheat scab resistance QTL as described in claim 1 Qfhb.sdau-4AL Primers for KASP molecular markers, characterized in that, The primers include two forward primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and one reverse universal primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. The primers for the KASP molecular marker as described in claim 2, characterized in that, Different fluorescent detection sequences were added to the 5' ends of the two forward primer sequences.

4. The primer for the KASP molecular marker as described in claim 3, characterized in that, The fluorescence detection sequences are the FAM sequence and the HEX sequence, respectively. The nucleotide sequence of the FAM sequence is shown in SEQ ID NO.6, and the nucleotide sequence of the HEX sequence is shown in SEQ ID NO.

7.

5. A wheat scab resistance QTL based on the KASP molecular marker described in claim 1 Qfhb.sdau-4AL The genotyping method is characterized by, Wheat genomic DNA was extracted and PCR amplified using primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.

3. Genotyping was determined after fluorescence detection. Wheat materials with TT bases at the SNP sites of the KASP molecular marker showed better resistance to Fusarium head blight than wheat materials with CC bases.

6. A wheat scab resistance QTL Qfhb.sdau-4AL The genotyping product is characterized by, The detection substance includes the KASP molecular marker as described in claim 1, wherein the detection substance includes the primers of the KASP molecular marker as described in any one of claims 2 to 4.

7. The wheat scab resistance QTL as described in claim 1 Qfhb.sdau-4AL The application of KASP molecular markers in detection substances in any of the following: (1) To identify or assist in the identification of wheat resistance to Fusarium head blight; (2) To prepare products for identification or to assist in the identification of wheat resistance to Fusarium head blight; (3) Compare the resistance of wheat grains to Fusarium head blight; (4) Select or screen wheat lines or varieties with relatively strong resistance to Fusarium head blight; (5) Prepare products for screening or comparing the resistance of wheat to Fusarium head blight; in, The detection substance for the KASP molecular marker includes the primers for the KASP molecular marker as described in any one of claims 2 to 4; The method of application is as follows: wheat genomic DNA is extracted, and PCR amplification is performed using primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.

3. After fluorescence detection, the genotype is determined. Wheat materials with TT bases at the SNP sites of the KASP molecular marker have better resistance to Fusarium head blight than wheat materials with CC bases.

Citation Information

Patent Citations

  • A molecular mark for detecting scab-resistant QTL Qfhb.hbaas-1AS and a method for use thereof

    CN109207630A

  • A molecular marker for detecting the Fusarium head blight resistance QTL Qfhb.hbaas-1AS and its application method

    CN109207630B

  • Molecular marker for detecting anti-scab QTL (quantitative trait loci) Qfhb.hbaas-5AS and application method of molecular marker

    CN109797241A

  • Molecular marker for detecting fusarium head blight (FHB)-resistant QTL Qfhb.hbaas-5AL and use method

    CN109852719A

  • A molecular marker for detecting the Fusarium head blight resistance QTL Qfhb.hbaas-5AL and its application method

    CN109852719B