Identification of a QTL for total root tip number at the seedling stage of wheat under drought stress and its linked KASP marker

Abstract

The present invention discloses a QTL for the total root tip number of wheat root system under drought stress at seedling stage QDNRT.daas‑4DS The QTL is located on chromosome 4D of wheat, and the KASP marker closely linked to it is Kasp_4DS_DNRT , which can be used to QDNRT.daas‑4DS The KASP primer sequences used for auxiliary selection and amplification of markers are detailed in the text. QDNRT.daas‑4DS The method is to use the wheat genomic DNA to be tested as a template, use the KASP primers in the sequence list to perform PCR amplification, and identify the markers in the amplified product that are closely linked to the QTL Kasp_ 4DS_DNRT The total root tip volume of the amplification reaction was 4 μl, including: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952μl Template DNA (50 ng / μl), the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer; amplification was performed using a 384-well PCR instrument.

Description

Technical Field

[0001] The invention relates to the identification of a QTL for the total root tip number of wheat root system at the seedling stage under drought stress and a linked KASP marker thereof. Background Art

[0002] Common wheat is one of the most important staple crops in the world. Wheat production is largely restricted by various abiotic stresses, so breeding high-yield and stable varieties under abiotic stress is an important goal of wheat breeding. The tolerance of the root system to environmental stress is also crucial. The root system is very important for wheat growth under conditions of water and nutrient deficiency. The morphology of the root system is very complex and includes many traits. Among them, the number of root tips is significantly correlated with nutrient and water absorption and is one of the most important root traits. Due to the complexity of the root system, it is impossible to perform high-throughput phenotypic evaluation of root system composition-related traits in the field. Most traditional breeding focuses on aboveground traits, especially harvest index, disease resistance and plant height, while ignoring the optimization of root system composition. Exploring the number of root tips of wheat seedlings under drought stress is very important for improving wheat drought resistance. The number of root tips of wheat seedlings is controlled by micro-effect genes and is significantly affected by environmental conditions.

[0003] KASP markers have been widely used to detect genetic variation in wheat and can achieve high-throughput genotyping. The genotype data of wheat SNP chips were used for QTL positioning and genome-wide association analysis, and the linked SNPs were converted into KASP markers, which can be directly applied to molecular marker-assisted selection breeding. We previously constructed a recombinant inbred line (RIL) population using Doumai and Shi 4185, containing 249 lines. Subsequently, the genotypes were detected using a 50K chip, and a high-density genetic map was constructed to locate the QTL for the root tip number at the seedling stage of the RIL population under drought stress. A QTL for the root tip number with a high effect was detected on chromosome 4D. This QTL was named QDNRT.daas-4DS , located on chromosome 4D; its closely linked SNP marker is Kukri_rep_ c68594_530 (12.7 Mb), which can explain 8.1% of the phenotypic variation. Kukri_rep_c68594_ 530 KASP Marker Developed Kasp_4DS_DNRT , which can be used for molecular marker-assisted breeding. Summary of the invention

[0004] The invention relates to a QTL gene for total root tips of wheat root system at seedling stage under drought stress and a molecular marker linked thereto, which can be used for molecular marker-assisted selection of total root tips of wheat root system at seedling stage in breeding in arid areas.

[0005] The present invention provides a tightly linked KASP marker for screening QTLs for total root tip number of root system under drought stress Kasp_4DS_DNRT , the sequence is as follows:

[0006] Primer A sequence GAAGGTGACCAAGTTCATGCTTGAACTCGGCTGATACCAGA

[0007] Primer B sequence GAAGGTCGGAGTCAACGGATTGAACTCGGCTGATACCAGG

[0008] Primer C sequence GGTGATGGCGAACCTAGAAAC

[0009] Note: GAAGGTGACCAAGTTCATGCT is the tag sequence FAM,

[0010] GAAGGTCGGAGTCAACGGATT is the tag sequence HEX.

[0011] SNP marker sequence: Kukri_rep_c68594_530 : (No. 52)

[0012] ACAATGGATGGACAGAATGCTGTGCCTGTAATGAACTCGGCTGATACCAGAYGGTTTTGGATTATGGTTCAGTGTTTCTAGGTTCGCCATCACCGGCGGACGG.

[0013] KASP consists of two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the HEX and FAM of the fluorescent group, and the other sequences are different only in the SNP at the 3' end) and a reverse common primer; the PCR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (Master Mix provided by LGC), so the forward primer can specifically bind to DNA with the same genotype as it, and the two forward primers can emit two different colors of light. If the site in the template chain is homozygous, a single fluorescence that matches it will be emitted, and if it is heterozygous, two fluorescences will be emitted at the same time. The 4 µl reaction system of PCR is as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl), the ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer, and the primers are synthesized by Shanghai Bioengineering Company. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler) with the following program: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min (0.8°C decrease per cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 32 cycles. The PCR amplification products were placed in an autofocus fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and genotyping was performed using Klustercaller v3.4 (LGC, Hoddesdon, UK).

[0014] Primer pairs (markers) were used for PCR amplification method. The total root tip area of ​​the amplification reaction was 4 µl, including: 0.048 μl PrimerMix, 2.0 μl Master Mix, 1.952 μl Template DNA. The ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer. A 384-well PCR instrument was used for amplification. The program was as follows: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min, with a decrease of 0.8°C for each cycle, for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles.

[0015] The method for detecting the amplified product is to place the amplified product in an automatic focusing fluorescence multifunctional microplate reader to read the final fluorescence data, and then import the data into the software for genotyping.

[0016] The primer pair (marker) is used in the preparation of a kit for assisting in screening QTLs for the total root tip number of wheat root system at the seedling stage under drought stress, and contains the primer pair (marker).

[0017] The application of the kit in wheat breeding. The method and the kit all belong to the protection scope of the present invention.

[0018] Beneficial effects: The present invention also protects a QTL gene for the total root tip number of wheat seedlings under drought stress and its linked molecular marker, the QTL is named QDNRT.daas-4DS , located on chromosome 4D; its closely linked SNP marker is Kukri_rep_c68594_530 (12.7 Mb), which can explain 8.1% of the phenotypic variation. Specifically, the molecular marker can be obtained by amplifying the genomic DNA of Doumai and Shi 4185 by the primer pair. The present invention provides a marker for the QTL of the total root tip number gene of wheat root system under drought stress, which can be used for molecular marker-assisted screening of root system genes.

[0019] The present invention discloses a QTL for the total root tip number of wheat root system under drought stress at seedling stage QDNRT.daas-4DS The QTL is located on chromosome 4D of wheat, and the KASP marker closely linked to it is Kasp_4DS_ DNRT , which can be used to QDNRT.daas-4DS The KASP primer sequences used for auxiliary selection and amplification of markers are given in the text. QDNRT.daas-4DS The method is to use the wheat genomic DNA to be tested as a template, use the KASP primers in the sequence list to perform PCR amplification, and identify the markers in the amplified product that are closely linked to the QTL Kasp_4DS_DNRT genotype.

[0020] The molecular marker detection is accurate and efficient, the amplification is convenient and stable, the operation is simple and easy, and the effect is fast. It can be used for molecular marker-assisted selection to improve identification efficiency.

[0021] The molecular marker can be applied to auxiliary selection of genes for total root tip number of root system at seedling stage in wheat breeding in arid areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Mark for KASP Kasp_4DS_DNRT Genotyping results of 108 wheat varieties. DETAILED DESCRIPTION

[0023] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples can be purchased from conventional biochemical reagent stores unless otherwise specified.

[0024] Example 1, discovery of a QTL for the total root tip number of wheat seedlings under drought stress in Doumai / Shi 4185 RIL population and acquisition of its KASP marker:

[0025] 1. Acquisition of phenotype

[0026] For the 249 strains of Doumai / Shi4185 RIL population, full wheat seeds were selected and placed in 10% H 2 O solution for 10 min and placed on moist filter paper for culture (25℃). At the one-leaf-one-heart stage, seedlings with consistent growth were selected and transferred to Hoagland culture medium with 20% PEG6000 for further culture (16h light / 8h dark, 22-25℃). The nutrient solution was changed every 3d. After 21d, the roots and aerial parts were cut at the nodes and temporarily stored in a refrigerator at 4℃. They were placed in a transparent root tray filled with deionized water and scanned using WinRHIZOLA6400XL (Epson) root scanner. The total root tip number of each sample was analyzed using WinRHIZOPro software. The genomic DNA of young leaves of 249 families was extracted using the CTAB method, and the DNA was adjusted to 50ng / ul using a NanoDrop2000c spectrophotometer. The DNA quality was detected using 0.8% agarose gel for SNP typing. The analysis was performed using Illumina's 90K SNP chip (Beijing Bio Bio).

[0027] 2. Construction of linkage map

[0028] The 90K SNP chip contains a total of 80,547 markers, and 11,012 markers remain after removing markers with heterozygous between parents and deletion rates greater than 10%. IciMapping 4.1 bin function was used to remove redundant markers, and clusters were formed based on the genetic distance between markers and chromosome location information. The total length of the genetic map is 2030.0 cM.

[0029] 3. QTL Analysis

[0030] The IciMapping 4.1 ICIM-ADD method was used for QTL analysis, with an LOD value of 3.0. A stable QTL was located on chromosome 4D and named QDNRT.daas-4DS ,and Kukri_rep_c68594_530 (12.7 Mb) is tightly linked and can explain 9.6% of the phenotypic variation. Kukri_rep_c68594_530 Convert to Kasp_4DS_ DNRT , and detected the genotypes of 108 wheat varieties.

[0031] 4. Use of primer pairs

[0032] The experimental materials are 108 wheat varieties, see Table 1 for details.

[0033] 1. For 108 wheat varieties, select full and uniform wheat seeds and place them in 10% H 2 O solution for 10 min, rinsed with deionized water three times, and then placed on moist filter paper for culture (25°C). At the one-leaf-one-heart stage, seedlings with consistent growth were selected and transferred to Hoagland culture solution containing 20% ​​PEG6000 (16h light / 8h dark, 22-25°C) for continued culture. The nutrient solution was changed every 3 days. After 21 days, the roots were rinsed with deionized water, and the roots and aerial parts were cut at the nodes and temporarily stored at 4°C. The roots were placed in a transparent root tray filled with deionized water, and the roots were scanned using WinRHIZOLA6400XL (Epson) root-specific large-format perspective scanner, and the total number of root tips was analyzed using WinRHIZOPro software.

[0034] 2. Utilize Kasp_4DS_DNRT All experimental materials were labeled and tested. The results are shown in Table 1 and Figure 1 .

[0035] Figure 1 The genotypes of Kasp_4DS_DNRT detected in 108 varieties. Figure 1 Kasp_4DS_DNRT Genotyping results of 108 wheat varieties; red is Shi 4185 genotype CC, blue is Doumai genotype TT, and pink is test failure. Among the 108 wheat varieties, 33 varieties showed Doumai genotype TT (blue), with a total root tip number of 82.9; 71 varieties showed Shi 4185 genotype CC (red), with a total root tip number of 97.9; statistical tests showed QDNRT.daas-4DS The gene effects reached significant differences ( P <0.05) (Table 2).

[0036] Table 1 Genotype detection results and total root tip numbers of 108 wheat varieties.

[0037] serial number Variety name genotype Total root apex number 1 Dwarf Anti-58 CC 100.2 2 Bainong3217 CC 18.6 3 Bainong64 TT 115.2 4 Bima No.4 TT 11.7 5 Gaoyou 503 CC 57.6 6 Gaocheng 8901 CC 123.5 7 Huapei No.5 CC 22.7 8 Huaimai 18 NN 69.5 9 Huaimai 20 CC 48.8 10 Huaimai 21 TT 16.7 11 Jimai 19 CC 170.8 12 Jimai 20 CC 69.8 13 Jimai 21 CC 10.8 14 Jimai 22 CC 103.9 15 Jinan 13 TT 23.0 16 Jinan 17 CC 14.4 17 Jining 16 CC 10.3 18 Hebei Normal University 02-1 CC 8.0 19 Jinmai 61 CC 44.9 20 Lankao24 TT 30.9 21 Lankao No.2 TT 162.5 22 Lankao 906 TT 58.3 23 Good Star 66 CC 234.0 24 Good Star 99 CC 18.6 25 Linhan 2 TT 49.6 26 Linkang 12 TT 62.0 27 Linmai No.2 CC 55.8 28 Linmai No.4 CC 47.8 29 Lumai 15 CC 23.7 30 Lumai 21 CC 79.4 31 Lumai 23 CC 70.1 32 Lumai No.5 TT 23.9 33 Lumai No.6 CC 61.7 34 Lumai No.7 CC 68.0 35 Lumai No.8 CC 24.8 36 Lumai No.9 CC 150.8 37 Luyuan 502 CC 129.4 38 Luohan No.2 TT 79.0 39 Lomai 21 CC 122.5 40 Neixiang 188 TT 85.0 41 No. 5 Neixiang CC 77.8 42 Shannong 20 TT 166.8 43 Shaanxi 150 TT 72.2 44 Shaanxi 229 CC 140.0 45 Shaanxi 253 CC 295.4 46 Shaanxi 354 CC 66.9 47 Shaanxi 512 CC 71.0 48 Shaanxi 715 CC 80.0 49 Shaanxi wheat 94 TT 224.4 50 Shaanxi Agricultural 78-59 TT 64.4 51 Shanyou 225 TT 90.7 52 Stone 4185 CC 54.5 53 Shijiazhuang 15 CC 31.4 54 Shi Xin 733 TT 60.5 55 Shiyou17 CC 83.2 56 Su Nong No.6 CC 199.5 57 Taishan No. 5 TT 177.3 58 Wanmai 19 CC 228.1 59 Wanmai 29 CC 235.6 60 Wanmai 38 CC 190.9 61 Wanmai 50 CC 293.3 62 Wanmai 52 CC 99.0 63 Wanmai 53 CC 140.1 64 Wennong 14 CC 156.2 65 Wennong No.5 CC 159.4 66 Wunong 148 TT 23.7 67 Northwest A&F University 291 TT 39.0 68 Xiaoyan22 CC 128.8 69 Xiaoyan54 CC 102.1 70 Xiaoyan No. 6 CC 119.9 71 Xiaoyan81 CC 91.2 72 Xinmai 19 CC 108.0 73 New wheat 9 TT 12.7 74 Tobacco Farmer 18 TT 68.1 75 Tobacco Farmer 19 CC 99.2 76 Yanzhan 4110 NN 54.6 77 Yumai 18 CC 155.8 78 Yumai 21 CC 42.7 79 Yumai No.2 CC 62.4 80 Yumai 34 TT 168.9 81 Yumai 35 TT 44.9 82 Yumai 47 CC 76.1 83 Yumai 49 TT 169.7 84 Yumai 50 CC 9.7 85 Yumai 63 CC 97.3 86 Yumai No.7 CC 80.5 87 Zheng 9023 CC 58.9 88 Zhengmai 366 CC 74.1 89 Zhengyin No. 1 TT 181.6 90 Zhengzhou No. 3 NN 140.2 91 Zhongmai 871 CC 306.2 92 Zhongmai 875 CC 93.6 93 Zhongmai 895 CC 148.6 94 Zhongyu No.5 TT 94.4 95 Zhou 8425B TT 68.7 96 Zhou Mai 16 CC 58.0 97 Zhou Mai 18 CC 13.3 98 Zhou Mai 19 CC 40.5 99 Zhou Mai 22 TT 60.9 100 Zhou Mai 23 CC 88.5 101 Zhou Mai 25 TT 74.1 102 Zhou Mai 26 NN 133.9 103 Zhou Mai 28 CC 94.6 104 Zhou Mai 30 TT 107.8 105 Zhou Mai 31 CC 36.8 106 Zhou Mai 32 CC 127.0 107 Zimai 12 TT 50.0 108 Zixuan No. 2 CC 141.5

[0038] “NN” represents missing phenotypic or genotypic data.

[0039] Table 2 QDNRT.daas-4DS Effect of total root tip number under drought stress in 108 natural populations

[0040]

[0041] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. It should be pointed out that a person skilled in the art can make several improvements and modifications without departing from the technical principles of the present invention, and these improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a KASP primer set in preparing a kit for assisting screening of QTLs for the total root tip number of wheat seedlings under drought stress, characterized in that: The KASP primer set includes primer A, primer B, and primer C, wherein the nucleotide sequence of primer A is: GAAGGTGACCAAGTTCATGCTTGAACTCGGCTGATACCAGA; The nucleotide sequence of primer B is: GAAGGTCGGAGTCAACGGATTGAACTCGGCTGATACCAGG; The nucleotide sequence of primer C is: GGTGATGGCGAACCTAGAAAC; Among them, GAAGGTGACCAAGTTATGCT is the tag sequence FAM, GAAGGTCGGAGTCAACGGATT is the tag sequence HEX.

Images