A culture dish-based Agrobacterium infection alfalfa root system and its establishment method

Abstract

The invention discloses an Agrobacterium-infected alfalfa root system based on a culture dish and an establishment method thereof, and belongs to the technical field of alfalfa bacterial infection system. The Agrobacterium-infected alfalfa root system based on a culture dish provided by the invention fills the gap that there is no Agrobacterium-efficient alfalfa root system currently, and can be used to study the mechanism of bacterial infection of alfalfa; the Agrobacterium-infected alfalfa root system based on a culture dish provided has the advantages of controllable culture conditions, can effectively avoid contamination by other bacteria, the root system is clean and free of impurities, is clearly visible, is easy to observe and sample, and can also greatly save experimental time.

Description

Technical Field

[0001] The invention relates to the technical field of alfalfa bacterial infection system, in particular to an Agrobacterium infection alfalfa root system based on a culture dish and an establishment method thereof. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial leguminous forage grass with a long history of cultivation, wide distribution and high utilization value. It is known as the "king of forage grass". China is the world's second largest alfalfa grower, accounting for 15.1% of the global alfalfa planting area. In recent years, with the increase in domestic demand for animal products, the demand for alfalfa has also been increasing. Therefore, driven by the adjustment of the industrial structure and the supply-side structural reform, the scale of alfalfa cultivation has expanded significantly.

[0003] Since alfalfa is a perennial forage grass, the difficulty of crop rotation has led to an increasingly serious occurrence of alfalfa diseases. This has had a serious impact on the yield and quality of alfalfa. It is reported that there are more than 40 common diseases of alfalfa in my country, including leaf diseases, stem diseases and root diseases. For example, Fan Qin's research shows that after alfalfa develops stem spot mildew, the chlorophyll content, sucrose content, total protein content, etc. are significantly reduced, seriously affecting its yield and quality. Xu Shan measured the dry weight and conventional nutritional components of branches and healthy branches of alfalfa with anthracnose in three regions: Jiuquan, Gansu, Yinchuan, Ningxia, and Chifeng, Inner Mongolia. It was found that after anthracnose occurred in alfalfa, the dry weight loss of branches reached 17.05% to 22.35%, the crude protein loss reached 18.20% to 30.03%, and the total amino acid loss reached 24.85% to 30.26%.

[0004] Agrobacterium is a prokaryotic organism, a Gram-negative bacterium belonging to the phylum Thin-walled Fungi, and a pathogenic bacterium that can infect plant roots. Cherry blossom root cancer caused by Agrobacterium is common in cherry blossom nurseries across my country, seriously restricting the development of the cherry blossom industry. Agrobacterium tumefaciens causes plant crown gall disease, which is mainly distributed in Gansu, Ningxia, Inner Mongolia, Shanxi and Shaanxi in my country. The pathogen has a wide host range and is pathogenic to a variety of woody and herbaceous plants. During the transplanting, pruning and grafting of woody plants (shrubs), wounds will be produced on the stems and roots, and the pathogens will enter the plant body through the wounds and colonize, causing the plant to become ill. The main disease that harms the roots of alfalfa is alfalfa root crown gall caused by Agrobacterium tumefaciens, which occurs frequently in alfalfa growing areas across my country. Summary of the invention

[0005] The purpose of the present invention is to provide a culture dish-based system for efficiently infecting alfalfa roots with Agrobacterium, so as to fill the gap of the current lack of a system for efficiently infecting alfalfa roots with Agrobacterium, and to lay a foundation for further research on the infection mechanism of bacteria on alfalfa.

[0006] To achieve the above object, the present invention provides a method for establishing an alfalfa root system infected with Agrobacterium based on a culture dish, comprising the following steps:

[0007] S1. Germinate the plump seeds of WL319HQ alfalfa, and then plant the germinated alfalfa seeds into a seedling tray without a substrate;

[0008] S2. When the roots of the alfalfa seedlings in the seedling tray grow to 1-2 cm, take them out from the seedling tray without substrate, place them in a dish covered with a layer of absorbent cotton and a layer of sterile filter paper on the absorbent cotton, cover the dish with a lid, wrap the dish with tin foil and place it vertically in a light incubator;

[0009] S3, cut off the young roots of the alfalfa seedlings cultured in step S2 until the root length is 5-6 cm, leaving 1-2 cm, and use OD 600 Soak in 0.6-0.8% Agrobacterium solution at room temperature for 1-20 minutes.

[0010] Preferably, in step S1, sterile water is added to the lower part of the substrate-free seedling tray, a layer of sterile gauze is spread on the upper part, and the germinated alfalfa seeds are placed on the sterile gauze, and the culture condition is 25°C.

[0011] Preferably, in step S2, the plant is pressed with moistened absorbent cotton to fix the root system, and the layer of absorbent cotton is soaked with sterile water so that no water drips when the culture dish is placed vertically.

[0012] Preferably, the culture conditions in step S2 are a temperature of 25-28° C., a relative air humidity of 40%-60%, and a light duration / / dark duration=16h / / 8h.

[0013] Preferably, in step S3, the Agrobacterium infection solution is adjusted to OD 600 value.

[0014] A culture dish-based Agrobacterium infection system of alfalfa root system established as described above.

[0015] The invention relates to an application of the alfalfa root system infected with Agrobacterium based on a petri dish as described above in the study of the mechanism of bacterial infection of alfalfa.

[0016] Therefore, the present invention provides a culture dish-based Agrobacterium infection of alfalfa root system and its establishment method, and its specific technical effects are as follows:

[0017] (1) The culture dish-based Agrobacterium infection alfalfa root system provided by the present invention fills the gap that there is currently no Agrobacterium efficient infection alfalfa root system, and can be used to study the mechanism of bacterial infection of alfalfa;

[0018] (2) The culture dish-based Agrobacterium infection of alfalfa root system provided by the present invention has the advantages of controllable culture conditions, can effectively avoid contamination by other bacteria, and the root system is clean and free of impurities, clearly visible, easy to observe and sample, and can also greatly save experimental time.

[0019] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0021] Figure 1 This is an operation flow chart of constructing a culture dish filter paper system for growing alfalfa in Example 2 of the present invention;

[0022] Figure 2 It is the detection result of the root colonization quantity of 10 different alfalfa varieties in the test 1 of the present invention, among which 1 is Kangsai, 2 is Gannong No. 5, 3 is WL343HQ, 4 is Zhongmu No. 1, 5 is WL319HQ, 6 is WL354HQ, 7 is Caoyuan No. 2, 8 is WL168HQ, 9 is Gannong No. 4, and 10 is Gannong No. 1;

[0023] Figure 3 It is the root tissue coating test result of direct inoculation and root injury and root dipping inoculation method in the test 1 of the present invention;

[0024] Figure 4 It is the detection result of the number of bacteria in different tissues using different sampling methods in the test 1 of the present invention, wherein A is the statistical result of the number of tissue colonies at the base of the stem and the bottom leaves, B is the quantitative detection result of the number of bacteria in different tissues of alfalfa, and C is the GFP fluorescence microscopic observation result of the alfalfa root;

[0025] Figure 5 In the first test of the present invention, the surface of the root system is first disinfected, then plated (A), and then fluorescence quantitative PCR (B) and fluorescence microscopy (C) are used to observe and compare the amount of bacteria colonized in different tissues. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0027] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0028] The instruments, equipment and reagents used in the examples were obtained from commercial sources.

[0029] LB solid medium: peptone 10 g, yeast extract 5 g, NaCl 10 g, agar powder 15 g, water 1000 mL, 121 ° C, high pressure sterilization for 20 min.

[0030] LB liquid medium: peptone 10 g, yeast extract 5 g, NaCl 10 g, water 1000 mL, 121 ° C, high pressure sterilization for 20 min.

[0031] The Agrobacterium used in the examples is the strain LBA4404 (pB066-GFP) marked with green fluorescent protein (GFP), which is deposited in the Plant Pathology Laboratory of Inner Mongolia Agricultural University.

[0032] Embodiment 1

[0033] To obtain alfalfa seedlings, the method is as follows:

[0034] Select 10 full seeds of different alfalfa varieties, soak them in sterile water for 24 hours, wrap them with sterile gauze, and place them in a 25℃ constant temperature incubator for germination. Keep the gauze moist with about 25℃ water every morning and evening. Add sterile water to the bottom of a 4.5×24.5×32.5cm seedling tray, lay a layer of sterile gauze on the top, and then transfer the alfalfa seeds that have been germinated in a 25℃ constant temperature incubator to the sterile gauze in the seedling tray. Place the seedling tray in a 25℃ constant temperature incubator and continue to cultivate until the root system grows to 5-6cm.

[0035] Embodiment 2

[0036] The method for constructing a culture dish filter paper system for alfalfa growth is as follows:

[0037] Evenly spread a layer of cotton wool on the bottom of a 12×12 cm plastic square dish, and soak it with sterile water so that no water drips when the dish is placed vertically. Then, spread a layer of sterile filter paper on the cotton wool. Transfer the 2-3 cm tall alfalfa seedlings obtained in Example 1 to a square plastic dish (8 plants / dish), and use moistened cotton wool to press the seedlings and fix the alfalfa roots. After covering the dish, wrap the plastic dish with tin foil and place it vertically in a light incubator (temperature 25-28°C, relative air humidity 40-60%, light duration / / dark duration = 16h / / 8h). Water once every 3 days. The amount of watering depends on the growth conditions of the alfalfa to meet the growth of the alfalfa. See the operation flow chart. Figure 1 .

[0038] Embodiment 3

[0039] Cultivate Agrobacterium for infection as follows:

[0040] Streak the purchased Agrobacterium LBA4404 on LB solid medium containing 30μg / 100μL erythromycin and culture at 28℃. After the colonies appear, pick a single colony into 3mL liquid LB medium (containing 30μg / 100μL erythromycin) and culture overnight at 28℃ and 200r.pm. Take 200μL of bacterial solution the next day and add it to 15mL LB liquid medium (containing 30μg / 100μL erythromycin) and culture for 6 to 8 hours at 28℃ and 200r.pm (OD 600 =0.6~0.8), used as the infective bacterial solution for subsequent inoculation of alfalfa roots.

[0041] Embodiment 4

[0042] The alfalfa root system was inoculated with the Agrobacterium prepared in Example 3 in the following manner:

[0043] The 5-6 cm alfalfa seedling roots obtained in Example 2 were cut with sterile scissors to perform root injury treatment, and then the root system was immersed in the infection solution prepared in Example 3. After standing and soaking at room temperature for 15 minutes, the seedlings were spread in a culture dish filter paper system for culture. The construction method and culture conditions of the culture dish filter paper system were the same as those in Example 2. A total of 10 dishes were inoculated, 8 plants were spread in each dish, and 3 repetitions were set for each treatment.

[0044] Comparative Example 1

[0045] The alfalfa root system was inoculated with the Agrobacterium prepared in Example 3. The infection method and the culture method after infection were exactly the same as those in Example 4, except that the young roots of the alfalfa seedlings obtained in Example 2 were not cut with sterile scissors. A total of 10 dishes were inoculated, 8 strains were placed in each dish, and 3 replicates were set for each treatment.

[0046] Experimental Test 1

[0047] The number of Agrobacterium in the alfalfa seedlings infected with Agrobacterium in Example 4 and Comparative Example 1 was detected as follows:

[0048] (1) Detection of the number of Agrobacterium in the root system

[0049] At different time points after inoculation (1dpi, 3dpi, 5dpi, 7dpi), the roots of alfalfa were first surface disinfected and then sampled. The specific operation method of surface disinfection is as follows: soak the inoculated alfalfa roots with 3% sodium hypochlorite disinfectant for 5 minutes, rinse them with sterile water for 3 times, and then sample the roots. 8 alfalfa samples were taken at each time point, and 3 replicates were set for each sample.

[0050] The sampling was carried out in the same manner as above, except that the root surface was not disinfected. Eight alfalfa samples were taken at each time point, and each sample was repeated three times.

[0051] The root samples obtained were cut into sections using a sterile scalpel, and then the green fluorescence signal was observed under a laser confocal microscope (450 nm) and photographed for preservation.

[0052] LB plate test: Use LB plates to detect the number of bacteria in alfalfa samples. The specific operation method is as follows: Take 1g of the obtained alfalfa root sample and put it into an Eppendorf centrifuge tube, grind it on a grinder, then add 1mL of sterile ddH2O, centrifuge at 2000rpm for 5min, remove the supernatant, and dilute the precipitate at 1:100. Take 100μL of the dilution and plate it on LB solid culture medium. Use a handheld fluorescence observer to observe and record the number of colonies with GFP fluorescence. Calculate the number of bacteria colonized in the alfalfa root system using the following formula.

[0053] The number of bacteria (cfu / g) = the number of colonies after plating × 1000 × 100

[0054] q-PCR relative quantitative detection: Weigh 0.05 g of the above-mentioned samples at different time points of inoculation and place them in a centrifuge tube, and extract DNA using the CTAB method. Using the extracted DNA as a template, q-PCR amplification was performed using GFP primers GFP-F (sequence shown in SEQ ID NO.1) and GFP-R (sequence shown in SEQ ID NO.2), the PCR reaction system shown in Table 1, and the reaction procedure shown in Table 2. -ΔΔCT The relative expression level of each gene was calculated.

[0055] The primer sequences are as follows:

[0056] SEQ ID NO.1:AAGCTTAGCTTTATTTGTATAGTTCATCC

[0057] SEQ ID NO.2:TCTAGACTCATTTTAATAAACCTCCTTTCT

[0058] Table 1

[0059] Components Volume (μL) SYBR Green premix Ex Taq II (2x) 10 Upstream primer 1 Downstream primer 1 cDNA 5 <![CDATA[ddH2O]]> 3 Total volume 20

[0060] Table 2

[0061] stage temperature time Number of cycles Phase 1 95℃ 30s 1 Phase 2 95℃ 5s 40 60℃ 30s 40 72℃ 15s 40 Phase 3 95℃ 15s 1 60℃ 30s 1 95℃ 15s 1 40℃ 30s 1

[0062] (2) Detection of Agrobacterium in aerial tissues

[0063] The method is the same as that for detecting the number of Agrobacterium in the root system.

[0064] Results Analysis

[0065] (1) The results of the detection of the number of Agrobacterium pB066-GFP colonized in the roots of 10 different alfalfa varieties are as follows Figure 2 As shown. The same bands as the positive control were detected in WL319HQ and Caoyuan No. 2 after inoculation at 1dpi, 7dpi and 10dpi; while WL343HQ only detected the presence of Agrobacterium at 1dpi and 7dpi after inoculation; WL353HQ only detected the target band at 7dpi. Almost no target bands were detected in the roots of the other varieties. However, the results of the bacterial count after root surface disinfection showed that the target bands were detected in WL319HQ at 1dpi, 7dpi and 10dpi, while WL343HQ only detected a strong target band in the root system inoculated at 1dpi, and Kangsai and Gannong No. 5 only detected the GFP band at 7dpi. Based on the fact that Agrobacterium was able to efficiently colonize in the root system of WL319HQ after inoculation, regardless of whether the root system was surface disinfected, WL319HQ was subsequently selected to optimize the system of Agrobacterium infecting alfalfa roots.

[0066] (2) The effects of direct inoculation and root dipping inoculation on the number of Agrobacterium colonized in the roots of WL319HQ were analyzed. The results of the root tissue plating test were as follows: Figure 3 shown.

[0067] At 1 dpi, no bacteria were detected in the roots of alfalfa directly inoculated, while the number of bacteria detected in the roots after wound inoculation was 2×10 5 cfu / g;

[0068] At 3 dpi, the number of colonies detected in the directly inoculated root system was 1.7 × 106 cfu / g, while the number of colonies in the root system after root injury inoculation was 2.4×10 6 cfu / g, the amount of bacteria colonizing the root system increased by 29.2% compared with the direct inoculation method;

[0069] At 5 and 7 dpi, the number of colonies in the root system was 1.5×10 6 cfu / g and 1.9×10 6 cfu / g, while the number of colonizing bacteria in the root system at the same time point after root injury inoculation was 1.7×10 6 cfu / g and 2.0×10 6 cfu / g, there was no significant difference between the two.

[0070] The results of fluorescence confocal microscopy (see Figure 4 and Figure 5 ) also confirmed the results of the above plate test, that is, at 3 dpi, the fluorescence intensity observed on the alfalfa roots after root injury inoculation was higher than the fluorescence signal on the root surface directly inoculated, while in the later stage of inoculation, there was no significant difference in the fluorescence intensity of the root surface between the injured and uninjured root treatments.

[0071] (3) After Agrobacterium infects alfalfa roots, the results of the detection of bacterial counts in different tissues using different sampling methods are as follows Figure 4 shown.

[0072] Direct root sampling: Take the root system, stem base and bottom leaf tissues of WL319HQ at different time points after direct inoculation, grind them, dilute and plate them, and the obtained colony count results are as follows: Figure 4 As shown in A:

[0073] 0dpi: After the roots were injured and dipped, the root samples were taken and directly plated. The number of bacteria detected was 6.0×10 5 cfu / g. At this time, no bacteria were detected in the root base and leaves.

[0074] 7dpi: The number of bacteria detected in the root system was 3.5×10 6 cfu / g, compared with the number of bacteria measured by direct root sampling (0 dpi) after inoculation (6.0×10 5 cfu / g) decreased by 41.6%; at this time, the presence of bacteria was also detected in the stem base and bottom leaves, with the number of 1.4×10 6 cfu / g and 2×10 5 cfu / g, the least amount of bacteria was detected in leaves compared with roots and stem base.

[0075] 14dpi: At this time, the number of bacteria colonizing the root system is 4.1×10 6cfu / g, which was slightly higher than that in the root system at 7 dpi; at this time, the bacterial count measured in the stem base was 1.9×10 6 cfu / g, which was 26.3% higher than that at 7 dpi. At this time, no inoculated Agrobacterium was detected in the bottom leaves.

[0076] 21dpi: At this time, the number of bacteria colonizing the root system is 4.3×10 6 cfu / g, the colony count at the stem base was 2.0×10 6 cfu / g, and there was no significant difference in the amount of bacteria detected at the base of the stem after inoculation 7dpi. At this time, the number of colonies detected in the leaves was 2×10 5 cfu / g, which is basically the same as the bacterial count in the leaves inoculated at 7dpi.

[0077] The specific primers for GFP were used to quantitatively detect the bacterial count in different tissues of alfalfa. The results are as follows: Figure 4 As shown in B.

[0078] 0dpi: The relative value of bacterial count was the highest after the roots were taken out of the bacterial solution, and no GFP signal was detected in the stem base and leaves at this time.

[0079] 7dpi: The amount of bacteria in the root system decreased significantly compared to 0dpi, with a decrease of 41%; at this time, the amount of bacteria that can be detected at the base of the stem is about 41% of the amount of bacteria in the root at the same period.

[0080] 14dpi: The bacterial count in the root system began to gradually increase, with an increase of 27.4% compared to 7dpi. At the same time, the bacterial count at the base of the stem also increased by 42.5% compared to 7dpi, which was approximately 45.8% of the bacterial count in the root during the same period.

[0081] 21dpi: The amount of bacteria in the root system was roughly the same as that at 14dpi, while the amount of bacteria at the base of the stem increased slightly, by 10.1%; at the same time, there were also a small amount of bacteria in the leaves, accounting for 12.9% of the roots and 25.2% of the base of the stem at the same period.

[0082] At the same time, the results of microscopic observation of GFP fluorescence signals in the roots of alfalfa after inoculation at these four time points are as follows: Figure 4 As shown in C. At 0 dpi, GFP-labeled Agrobacterium could only colonize on the surface of alfalfa roots; at 7 dpi, GFP fluorescence signals could be observed in the vascular bundles of alfalfa, indicating that the inoculated strain had entered the root vascular bundles; at 14 dpi, the GFP fluorescence signal in the vascular bundles increased, indicating that the amount of colonized bacteria increased; at 21 dpi, green fluorescence signals were only observed in the root vascular bundles, but the fluorescence signal intensity was much weaker than that at 14 dpi.

[0083] The above fluorescence microscopic observation results show that after infecting alfalfa, Agrobacterium can enter the vascular bundle of the root system, and the number of colonization also changes over time. This microscopic observation result is basically consistent with the results of plate coating and fluorescence quantitative detection.

[0084] (4) After the roots were treated in the bacterial solution, the root surface was disinfected before sampling at different time points. Then, the amount of bacteria colonized in different tissues was compared by plating, fluorescence quantitative PCR, and fluorescence microscopy. The results were as follows: Figure 5 shown.

[0085] The root system, stem base and bottom leaf tissues of WL319HQ at different time points after surface disinfection were ground and diluted and plated. The results are as follows Figure 5 As shown in A.

[0086] 0dpi: No bacteria were detected in any tissue of alfalfa, indicating that the root surface was disinfected thoroughly.

[0087] 7dpi: The number of bacteria colonizing the root system was 1.3×10 6 cfu / g. At this time, the presence of bacteria was also detected in the stem base, with a number of only 3.0×10 5 cfu / g; compared with roots and stem base, no bacteria were detected in leaves.

[0088] 14dpi: The number of bacteria colonized in the root system increased to 1.8×10 6 cfu / g, which was 16.6% higher than that in the root system after 7 dpi inoculation; at this time, the bacterial count measured in the stem base was 6×10 5 cfu / g, which was 2 times higher than that in the same part after inoculation at 7 dpi; at this time, no bacteria were detected in the leaves.

[0089] 21dpi: The number of bacteria colonizing the root system is 2.0×10 6 cfu / g, which was slightly higher than that at 14 dpi, but 35.0% higher than that at 7 dpi. At this time, the number of Agrobacterium colonies at the stem base was 8×10 5 cfu / g, the bacterial count at the stem base increased by 62.5% and 25.0% compared with 7dpi and 14dpi, respectively. The number of colonies detected in the leaf tissue at this time point was 3×10 5 cfu / g, slightly lower than the amount of bacteria colonizing the base of rhizomes at the same time point.

[0090] The results of relative quantitative detection of fluorescence in different parts of alfalfa tissues at different time points are as follows: Figure 5 As shown in B.

[0091] 0dpi: Since the root surface was disinfected directly after inoculation, no bacteria were detected in the root system at this time point, indicating that the root surface disinfection was relatively thorough.

[0092] 7dpi: At this time, a certain number of Agrobacterium were detected in the root system, and the same number of bacteria were also detected at the base of the stem as in the root system; at this time, no inoculated Agrobacterium was detected in the leaves.

[0093] 14dpi: The amount of bacteria colonized in the root system began to increase, with an increase of 76.9% compared to 7dpi, but the amount of bacteria in the stem base showed a downward trend compared to 7dpi, with a decrease of 43.3%. At this time, the amount of bacteria in the stem base was only 30.7% of the amount of bacteria in the root at the same period.

[0094] 21dpi: The amount of bacteria in the root system continued to increase, with an increase of 25% compared to 14dpi, while the amount of bacteria at the base of the stem showed an increasing trend, with an increase of 89.6% compared to 14dpi, reaching 45.8% of the amount of bacteria in the roots at the same time. At this time, the amount of bacteria detected in the leaves was 10.1% of the amount detected in the roots at the same time point, and 21.9% of the amount detected in the base of the stem.

[0095] After the root surface was disinfected after inoculation, the GFP-labeled Agrobacterium colonization in the alfalfa roots was observed microscopically at the above four time points. Figure 5 As shown in C. At 0 dpi, no GFP fluorescence signal was observed because the root surface was disinfected; at 7 dpi, a small amount of fluorescence signal was observed in the vascular bundle of alfalfa; at 14 dpi, a very strong green fluorescence signal was observed in the vascular bundle of the root; at 21 dpi, fluorescence signals were observed in the root vascular bundle and the intercellular spaces around the vascular bundle.

[0096] The detection of fluorescent signals in the roots after root surface disinfection indicates that Agrobacterium can enter the root vascular bundle through the wound and expand and spread to the aboveground part.

[0097] Therefore, the culture dish-based Agrobacterium infection alfalfa root system provided by the present invention fills the gap that there is currently no Agrobacterium efficient infection alfalfa root system, and can be used to study the mechanism of bacterial infection of alfalfa; the culture dish-based Agrobacterium infection alfalfa root system provided has the advantages of controllable culture conditions, can effectively avoid contamination by other bacteria, the root system is clean and free of impurities, clearly visible, easy to observe and sample, and can also greatly save experimental time.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A method for establishing a culture dish-based Agrobacterium infection of alfalfa root system, characterized in that: The steps include: S1. Germinate the plump seeds of WL319HQ alfalfa, and then plant the germinated alfalfa seeds into a seedling tray without a substrate; S2. When the roots of the alfalfa seedlings in the seedling tray grow to 1-2 cm, take them out from the seedling tray without substrate, place them in a dish covered with a layer of absorbent cotton and a layer of sterile filter paper on the absorbent cotton, cover the dish with a lid, wrap the dish with tin foil and place it vertically in a light incubator; S3, cut off the young roots of alfalfa seedlings cultured in step S2 until the root length is 5-6 cm, leaving 1-2 cm, and use OD 600 Soak in 0.6~0.8 Agrobacterium solution at room temperature for 1~20 minutes; In the step S1, sterile water is added to the bottom of the substrate-free seedling tray, a layer of sterile gauze is spread on the top, and the germinated alfalfa seeds are placed on the sterile gauze, and the culture condition is 25°C; In step S2, the plant is pressed with moistened absorbent cotton to fix the root system, and the layer of absorbent cotton is soaked with sterile water so that no water drips when the culture dish is placed vertically; The culture conditions in step S2 are as follows: temperature 25-28° C., relative air humidity 40%-60%, light duration / / dark duration = 16 h / / 8 h; In step S3, the Agrobacterium infection solution was adjusted to OD with LB liquid medium containing 30 μg / 100 μL erythromycin. 600 value.

2. An Agrobacterium-infected alfalfa root system based on a petri dish established according to the method of claim 1.

3. An application of the culture dish-based Agrobacterium-infected alfalfa root system as claimed in claim 2 in the study of the mechanism of bacterial infection of alfalfa.

Images