Gmmbrl1 protein, gene and application thereof
By using gene editing technology on the GmMBRL1 protein and its encoding gene, the problem of unclear regulation of soybean plant architecture was solved, resulting in increased soybean yield and optimized plant architecture, and providing a systematic evaluation method under production conditions.
Patent Information
- Application Number
- CN202410793584.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-19
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2044-06-19
AI Technical Summary
The existing technologies lack a clear understanding of the soybean plant architecture regulation mechanism and key genes, making it difficult to increase soybean yield. Furthermore, there is a lack of systematic evaluation and optimization methods for ideal plant architecture under production conditions.
Provide the GmMBRL1 protein and its encoding gene, and regulate plant architecture and yield through gene editing technology, including constructing recombinant vectors and introducing them into plants, using the CRISPR/Cas9 system for gene editing, specifically knocking out or silencing the MBRL1 gene, and cultivating plants with altered architecture and increased yield.
This study enables effective regulation of plant architecture and increased yield in soybeans, providing a systematic evaluation and optimization method for ideal soybean plant architecture under production conditions, thereby improving soybean yield per unit area.
Smart Images

Figure BDA0004900804870000091 
Figure BDA0004900804870000101 
Figure HDA0004900804880000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant breeding, specifically involving the GmMBRL1 protein and its encoding gene and its applications. Background Technology
[0002] Soybeans, as an important crop used for both grain and oilseed production, play a crucial role in ensuring my country's food security and agricultural trade. With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically, making my country's insufficient soybean production capacity increasingly prominent. Compared with major soybean-producing countries such as the United States, Brazil, and Argentina, my country's soybean production is low and cannot meet daily production and living needs, leading to a year-on-year increase in soybean imports. Given the limited soybean planting area in my country, how to rapidly and effectively improve soybean varieties and increase soybean yield through modern bio-breeding technologies is a critical production problem that urgently needs to be solved and a breeding technology bottleneck that urgently needs to be overcome.
[0003] Crop plant architecture plays a decisive role in the morphogenesis of individual plants and the crop population, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and spike type (pod-setting habit). Crop plant architecture domestication or improvement plays a vital role in achieving significant breakthroughs in crop yield. However, current research on the regulatory mechanisms of soybean plant architecture and key genes involved in this regulation is still in the exploratory stage, with few related research reports. The molecular mechanisms, key genes, and functional networks affecting soybean plant architecture regulation remain unclear. In particular, due to limitations in research materials, there is a lack of research on which plant architecture is more conducive to increasing soybean yield under field production conditions. Therefore, further exploration of more plant architecture regulatory genes is not only of significant theoretical value for discovering superior soybean plant architecture regulatory genes and cultivating high-yielding ideal plant architectures; but also, through the creation of specific materials, allows for the systematic evaluation and selection of ideal soybean plant architectures under production conditions, which has significant practical application value for ultimately realizing breeding applications and improving soybean yield. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to regulate plant shape and increase yield.
[0005] To address the problems existing in the prior art, the present invention provides a protein.
[0006] The protein provided by this invention may be any of the following:
[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 1;
[0008] A2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) have more than 75% identity with the protein shown in A1) and have the function of regulating plant architecture and increasing yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 1 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 1 by substituting, deleting and / or adding one or more amino acids without affecting its activity.
[0009] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0010] The protein described in A1 above is called MBRL1.
[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.
[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.
[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein MBRL1 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein MBRL1 isolated in this invention, as long as they encode and function as protein MBRL1, are derived from and equivalent to the nucleotide sequence of this invention.
[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.
[0017] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0018] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0019] The protein mentioned above is derived from soybean (Glycine max (L.) Merr.).
[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:
[0021] B1) Nucleic acid molecules that encode the proteins described above;
[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);
[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);
[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);
[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);
[0028] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;
[0029] C2) expresses the gene encoding the nucleic acid molecule described in C1);
[0030] C3) contains an expression cassette encoding the gene described in C2);
[0031] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);
[0032] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);
[0033] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);
[0034] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);
[0035] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).
[0036] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:
[0037] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 2;
[0038] The nucleotides encoding the E2) chain are the cDNA or DNA molecules of SEQ ID No. 3.
[0039] The DNA molecule shown in SEQ ID No. 2 (the MBRL1 gene that regulates plant architecture and yield traits) encodes the protein MBRL1 of SEQ ID No. 1.
[0040] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the gene encoding the protein MBRL1 (CDS).
[0041] The MBRL1 gene described in this invention can be any nucleotide sequence capable of encoding the protein MBRL1. Considering codon degeneracy and codon preferences among different species, those skilled in the art can use codons suitable for expression in specific species as needed.
[0042] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 2.
[0043] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originate from the same species.
[0044] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0045] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.
[0046] Recombinant expression vectors containing the MBRL1 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).
[0047] When constructing a recombinant plant expression vector using the MBRL1 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0048] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0049] In one specific embodiment, the recombinant vector is GmMBRL1-sgRNA, and the structure of the recombinant vector GmMBRL1-sgRNA is described as follows: a DNA molecule with a target sequence of 5'-TCTATCCTGGCCGTCACAAG-3' is inserted into a linear cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain a recombinant expression vector.
[0050] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA105 is an example.
[0051] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / GmMBRL1-sgRNA.
[0052] The recombinant Agrobacterium EHA105 / GmMBRL1-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmMBRL1-sgRNA into Agrobacterium tumefaciens EHA105.
[0053] The present invention also provides a method for cultivating plants with altered plant structure and increased yield, comprising: 1) inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the coding gene of the protein described above, to obtain plants with altered plant structure and increased yield.
[0054] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and reduced yield.
[0055] In one specific embodiment, a method for cultivating plants with improved plant type and yield includes the following steps: inhibiting the expression of nucleic acid molecules encoding the MBRL1 protein in the target plant to obtain transgenic plants with improved plant type and yield. Specifically, the inhibition of nucleic acid molecule expression encoding the MBRL1 protein in the target plant can be achieved by introducing an interference vector targeting the nucleic acid molecule encoding the MBRL1 protein into the target plant.
[0056] The interference vector may be a gene editing vector.
[0057] As one embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield includes the following steps:
[0058] (1) Construct a gene editing vector containing the inhibition of MBRL1 gene expression as shown in SEQ ID No. 4;
[0059] (2) Introduce the gene editing vector constructed in step (1) into plants;
[0060] (3) Plants with altered plant type and increased yield obtained through screening and identification.
[0061] Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets a nucleic acid molecule encoding the MBRL1 protein. Specifically, the target of the sgRNA is: 5'-TCTATCCTGGCCGTCACAAG-3'.
[0062] In the above method, the target site for gene editing by the CRISPR / Cas9 system is positions 243-262 of SEQ ID No. 3, which corresponds to positions 29-48 of SEQ ID No. 2 (coding sequence).
[0063] In the above method, the CRISPR / Cas9 system gene editing can be performed by making the following mutation on the gene encoding the protein shown in SEQ ID No. 3 in the soybean genome: replacing “5'-TCTATCCTGGCCGTCACAAG-3' (positions 243-262 of SEQ ID No. 3, corresponding to positions 29-48 of SEQ ID No. 2 (coding sequence CDS))” with 5'-TCTATCCTGGCCGTCACCAAG-3', that is, adding a base “C” between positions 259 and 260 of SEQ ID No. 3, thereby knocking out the gene encoding the GmMBRL1 protein.
[0064] In this invention, the purpose of plant breeding includes cultivating plants with altered plant type and / or increased / decreased yield.
[0065] The present invention also provides the use of the protein MBRL1 described above, or an expression substance regulating the gene, or a substance regulating the activity or content of said protein, in any of the following:
[0066] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating plant architecture and yield.
[0067] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant architecture and yield.
[0068] The application of the protein or gene-regulating substance described in U3) or the substance regulating the activity or content of the protein in cultivating plants with altered plant structure and increased yield.
[0069] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of products that cultivate plants with altered plant type and increased yield.
[0070] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.
[0071] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein MBRL1.
[0072] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein can be a biological material related to the protein, and the biological material can be the biological material described above.
[0073] In the above text, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:
[0074] 1) Regulation occurring at the transcriptional level of the aforementioned gene;
[0075] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);
[0076] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);
[0077] 4) Regulation of the translation of the aforementioned genes;
[0078] 5) Regulation of mRNA degradation of the aforementioned gene;
[0079] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0080] The present invention also provides a method for regulating plant architecture and increasing yield, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate plant architecture and increase yield.
[0081] In the above method, regulating the activity and / or content of the protein MBRL1 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding MBRL1 that inhibits, reduces, or silences the protein into the recipient plant to obtain the target plant with altered plant architecture and increased yield; the MBRL1 encoding gene encodes the protein MBRL1.
[0082] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.
[0083] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.
[0084] In the above applications and methods, the regulation can be suppression, reduction, or silencing.
[0085] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.
[0086] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0087] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0088] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.
[0089] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.
[0090] In this article, plant type traits may include plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant.
[0091] In the above applications or methods, the plant is any one of the following:
[0092] N1) Dicotyledons:
[0093] N2) Leguminosae;
[0094] N3) Leguminosae (family legumes);
[0095] N4) Plants of the genus *Glycine*;
[0096] N5) soybeans. Attached Figure Description
[0097] Figure 1 This is the mutation type of the GmMBRL1 mutant.
[0098] Figure 2 Plant architecture of GmMBRL1 homozygous mutant (mutant) and soybean variety Jack (control). Detailed Implementation
[0099] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0100] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0101] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.
[0102] The cultivated soybean Jack in the following examples is described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.
[0103] The Cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15. This vector contains a Cas9 protein expression unit.
[0104] The Agrobacterium tumefaciens EHA105 used in the following examples is described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutagenesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J 16, 176-185. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.
[0105] MS Salt: PhytoTech, Catalog No.: M524.
[0106] MS Organic: PhytoTech, Catalog No.: M533.
[0107] B5 Organic: Phytotech, catalog number: G219.
[0108] B5 Salt: Phytotech, Catalog No.: G768.
[0109] YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are as follows: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, and agar 15 g / L; the solvent is water. The pH of YEP solid medium is 7.0.
[0110] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.
[0111] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.
[0112] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.
[0113] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0114] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0115] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0116] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.
[0117] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.
[0118] Example 1: Obtaining the GmMBRL1 protein and its encoding gene
[0119] The gene encoding GmMBRL1, located on soybean chromosome 10, was isolated and cloned from the soybean variety Jack. This gene was named GmMBRL1 (and the protein it encodes is also named GmMBRL1). The GmMBRL1 gene in the genomic DNA of the soybean variety Jack is shown in SEQ ID No. 3 of the sequence listing. The coding sequence of the GmMBRL1 gene is shown in SEQ ID No. 2 of the sequence listing, and the protein encoding GmMBRL1 has the amino acid sequence shown in SEQ ID No. 1 of the sequence listing.
[0120] Example 2: Obtaining GmMBRL1 gene-edited plants
[0121] 1. Obtaining sgRNA
[0122] The target sequence for GmMBRL1 sgRNA was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the first exon region of GmMBRL1, and the target sequence is 5'-TCTATCCTGGCCGTCACAAG-3' (situations 243-262 of SEQ ID No. 3, corresponding to positions 29-48 of SEQ ID No. 2 (coding sequence)).
[0123] After the target is designed, it needs to be integrated into the vector. First, synthesize the target primers for the sgRNA. The primer sequences are as follows:
[0124] GmMBRL1-F:5'-TTG TCTATCCTGGCCGTCACAAG -3';
[0125] GmMBRL1-R:5'-AAC CTTGTGACGGCCAGGATAGA -3';
[0126] (The underlined sequence is a 20bp sgRNA)
[0127] Add 5 μL of GmMBRL1-F and GmMBRL1-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain gRNA annealed products with sticky ends.
[0128] 2. Preparation of GmMBRL1 gene editing expression vector GmMBRL1-sgRNA
[0129] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 1 above and perform homologous recombination with the cas9 / gRNA vector to obtain the recombinant vector Cas9-sgRNA. This vector expresses sgRNA, and the coding sequence of the target sequence binding region in sgRNA is position 243-262 of sequence 3.
[0130] 3. Preparation of recombinant bacteria
[0131] The recombinant vector Cas9-sgRNA prepared in step 2 was transformed into E. coli DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sent for sequencing.
[0132] Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3', the plasmid with the correctly inserted fragment was named the recombinant vector GmMBRL1-sgRNA.
[0133] The structure of the recombinant vector GmMBRL1-sgRNA is described as follows: A linear cas9 / gRNA vector was inserted into a DNA molecule with the target sequence 5'-AATAGGGAAACTTCACAGTT-3' via homologous recombination, while maintaining the other sequences of the cas9 / gRNA vector unchanged. The nucleotide sequence of the recombinant vector GmMBRL1-sgRNA is sequence 4 in the sequence listing.
[0134] The recombinant vector GmMBRL1-sgRNA contains an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 constitute the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 constitute the terminator for terminating sgRNA gene transcription. Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, and can express the Cas9 protein.
[0135] 4. Obtaining and phenotypic identifying the GmMBRL1 mutant
[0136] The recombinant vector GmMBRL1-sgRNA was transformed into Agrobacterium tumefaciens EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmMBRL1-sgRNA.
[0137] 5. Agrobacterium-mediated transformation
[0138] The EHA / GmMBRL1-sgRNA constructed in step 4 was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using Agrobacterium-mediated transformation. The specific method is as follows:
[0139] A. Seed sterilization
[0140] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.
[0141] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.
[0142] B. Preparation of infecting bacterial solution
[0143] 1) Incubate the EHA-GmMBRL1-sgRNA bacterial culture obtained in step 4 above at 28℃, resuspend it in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.
[0144] 2) Place the seeds treated in step A into a clean bench. Under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make scratches at the junction of the hypocotyl and cotyledon, usually 3-5 scratches per cotyledon. Then, immerse the seeds in a 28℃ incubator for 2 hours.
[0145] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.
[0146] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.
[0147] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.
[0148] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.
[0149] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.
[0150] 6. Molecular detection of GmMBRL1 gene-edited plants
[0151] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 5 and used as a template for PCR molecular detection, with wild-type soybean as a control.
[0152] PCR primers were designed near the target site of the GmMBRL1 gene for PCR amplification and sequencing. Primers MBRL1-F (5'-GGTGACCGCAATGGAAGACA-3') and MBRL1-R (5'-TGTCGTGGTGAAGAAAAACGA-3') amplified the GmMBRL1 gene. The PCR reaction system (total volume 25 μL) consisted of: 12.5 μL of 2×PhantaMax Buffer, 0.5 μL of dNTP Mix (10 mM), 1 μL of DNA (200 ng / μL), 1 μL of F (10 pmol / μL), 1 μL of R (10 pmol / μL), 0.5 μL of Super-Fidelity DNA Polymerase, and 8.5 μL of ddH2O. Amplification conditions were: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. The PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification.
[0153] The plants exhibiting overlapping peaks near the target site were identified as heterozygous edited plants, named T0 generation GmMBRL1 gene-edited soybeans.
[0154] After sowing T0 generation GmMBRL1-transferred soybeans, seeds of T1 generation GmMBRL1 gene-edited soybeans were harvested and cultured to obtain T1 generation GmMBRL1 gene-edited soybeans.
[0155] PCR was used to detect the GmMBRL1 gene-edited soybeans of generation T1. Sequencing results of the amplified products showed that, compared with the genomic DNA of the soybean variety Jack (wild type), the gene encoding the GmMBRL1 protein in the mutant plant (gmmbrl1) on both homologous chromosomes underwent the following mutation: "5'-TCTATCCTGGCCGTCACAAG-3' (SEQ ID No. 3, positions 243-262, corresponding to positions 29-48 of SEQ ID No. 2 (coding sequence CDS))" was replaced with 5'-TCTATCCTGGCCGTCACCAAG-3', that is, an addition of a base "C" between positions 259 and 260 of sequence 3, resulting in a frameshift mutation that knocked out the gene encoding the GmMBRL1 protein. The sequencing results of this mutation site and its surrounding nucleotides are shown in [Figure 1]. Figure 1 .
[0156] The T1 generation GmMBRL1 gene-edited soybean mutants with the above-mentioned GmMBRL1 gene mutation type were further cultured and screened to obtain T2 generation homozygous soybean mutants without transgenic elements, and phenotypic identification was performed.
[0157] Example 2: Phenotypic Identification of GmMBRL1 Gene-Edited Soybean Mutants
[0158] Soybean varieties were grown under natural light conditions in a netted greenhouse during the summer in Beijing. Planting conditions were: plant spacing 10cm, row spacing 50cm. Plant type traits (plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant) of the wild-type soybean variety Jack (control plant) and the homozygous mutant 1gmmbrl1 (mutant) were statistically analyzed. At least six individual plant data points were collected for each material.
[0159] The research results show (Table 1 and...) Figure 2 Regarding plant type, compared to the control plant (148.3 cm height), the mutant plant averaged 119.4 cm height, a significant decrease. In terms of branching phenotype, the control plant had 1.5 branches per branch, while the mutant plant averaged 2.9 branches per branch, a significant increase. Regarding the number of nodes per node, the control plant had 25.0 nodes per node, while the mutant plant averaged 23.8 nodes per node, a significant decrease. In terms of yield per plant, the control plant averaged 106.5 pods and 257.8 seeds per plant, while the mutant plant averaged 141.0 pods and 356.9 seeds per plant, showing a significant increase in both pod and seed count. The mutant plant yield was significantly increased.
[0160] Table 1. Statistics on soybean plant type data
[0161]
[0162]
[0163] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Methods for cultivating plants with altered plant shapes, including: Knock out the protein-coding gene in the target plant, or / and reduce the content of the protein-coding gene, to obtain a plant with altered plant type; the altered plant type is a decrease in plant height and number of nodes, or / and an increase in the number of branches, number of pods per plant, and number of grains per plant. The amino acid sequence of the protein is shown in SEQ ID No. 1; The plant in question is soybean.
2. The application of substances that knock out protein-coding genes in any of the following: Application of U1 in regulating plant architecture; Application of U2 in the preparation of products that regulate plant architecture; U3) Application in cultivating plants with altered plant structure; U4) Application in the preparation of products that cultivate plants with altered plant structure; Application of U5 in plant breeding; The amino acid sequence of the protein is shown in SEQ ID No. 1; The regulation of plant plant type is to reduce plant height and number of plant nodes, and / or increase the number of plant branches, number of pods per plant and number of grains per plant; The plant type change is a decrease in plant height and number of plant nodes, and / or an increase in the number of plant branches, number of pods per plant, and number of grains per plant; The purpose of the breeding is to select plant varieties with reduced plant height and number of plant nodes, and / or increased number of plant branches, number of pods per plant and number of grains per plant. The plant in question is soybean; The substance that knocks out the protein-coding gene is any one of the following C1) to C8): C1) Knock out the nucleic acid molecule encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).
3. The application according to claim 2, characterized in that, The gene encoding the protein described in C1) is the gene shown in E1) or E2) below: E1) The coding sequence is the cDNA molecule of SEQ ID No. 2; E2) Nucleotide is the DNA molecule of SEQ ID No.
3.
4. A method for regulating plant architecture, characterized in that, This includes regulating plant architecture by reducing the protein content in the target plant and / or the expression level of the gene encoding the protein. The regulation of plant plant type is to reduce plant height and number of plant nodes, and / or increase the number of plant branches, number of pods per plant and number of grains per plant; The amino acid sequence of the protein is shown in SEQ ID No. 1; The plant in question is soybean.
5. The method according to claim 4, characterized in that, The reduction of protein content in the target plant, and / or the expression level of the protein-coding gene, includes introducing a substance that knocks out the protein-coding gene into the recipient plant, resulting in a target plant with a lower plant height and number of nodes than the recipient plant, and / or a higher number of branches, pods per plant, and seeds per plant than the recipient plant; the coding gene encodes the protein. The substance that knocks out the gene encoding the protein is any one of the following C1) to C5): C1) Knock out the nucleic acid molecule encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).