Bacillus Velez and its application

Abstract

The invention relates to a Bacillus velezensis and an application thereof, and belongs to the field of microbial technology. The invention solves one of the problems that the Bacillus velezensis in the prior art has poor broad-spectrum against fungi and bacteria, low antibacterial activity, and limited antibacterial range. The Bacillus velezensis QMHF-G5 has good antibacterial activity against both pathogenic fungi and bacteria, can inhibit a variety of pathogenic fungi and bacteria, has good broad-spectrum, has high antibacterial activity against a variety of detected pathogenic fungi and antibacterial, and has a high antibacterial rate.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to Bacillus Velezii and application thereof. Background Art

[0002] Bacillus, as a class of aerobic or facultative anaerobic bacteria, can not only form endospores to resist adverse conditions in adversity, but also secrete a variety of beneficial substances, providing powerful biological control. These bacteria are widely distributed in different habitats and are known for producing a variety of antagonistic compounds. 5% to 8% of their genome is dedicated to the biosynthesis of secondary metabolites.

[0003] In the prevention and control of animal and plant diseases, the main representative species of Bacillus bacteria include Bacillus subtilis, Bacillus licheniformis and Bacillus amyloliquefaciens. These bacteria can effectively fight against a variety of pathogens and play an important role in the development of biopesticides. Studies have found that Bacillus velezensis also shows a wide range of disease prevention potential. It can produce a variety of compounds including iturin, feninteractin and surfactin, which have significant inhibitory effects on a variety of pathogenic bacteria and fungi, such as Listeria monocytogenes, Aspergillus and Fusarium. Application on corn shows that Bacillus velezensis can not only inhibit the growth of these pathogenic fungi, but also reduce the production of harmful substances such as aflatoxins and ochratoxins. Bacillus subtilis MBI600, as a plant growth promoting rhizobacterium (PGPR), has been commercialized to promote tomato growth and fight soil-borne pathogens. B. subtilis C3 was used to control lily bulb rot, demonstrating the application of biological control in high-value plant crop protection. These examples illustrate the dual role of Bacillus in disease management, both in direct inhibition of pathogens and in activating plant defense mechanisms.

[0004] Bacillus is considered an environmentally friendly biocontrol agent. It regulates the plant's response to stress through a variety of hormone and enzyme mechanisms, helps soil remediation and serves as a denitrification agent in agriculture. Studies have shown that combining Bacillus with nanoparticles, such as those coated with gold, aluminum, and silver, can promote plant growth and prevent the growth of harmful fungi in the rhizosphere, further confirming its potential as a nano-biocontrol agent. These properties of Bacillus are not only used in traditional agricultural production, but also have a place in modern environmentally friendly disease management strategies.

[0005] However, the currently disclosed Bacillus has problems such as limited inhibition of fungi and bacteria species, low antibacterial activity, poor broad-spectrum, and limited antibacterial range. Summary of the invention

[0006] In view of the above analysis, the present invention aims to provide a Bacillus Velezii and its application, which is used to solve one of the problems of the prior art Bacillus, such as poor broad-spectrum against fungi and bacteria, low antibacterial activity, and limited antibacterial range.

[0007] In a first aspect, the present invention provides a Bacillus velezensis QMHF-G5 with a deposit number of CGMCC No.27713.

[0008] Furthermore, the Bacillus Velezii QMHF-G5 contains the 16S rDNA shown in SEQ ID NO:1.

[0009] Furthermore, the Bacillus Velezii contains the QMHF-G5gyrB gene sequence shown in SED ID NO:2.

[0010] Furthermore, the Bacillus Velezii QMHF-G5 was isolated from the intestine of Hufeng.

[0011] Furthermore, the inhibition zone width of the Bacillus Velezii QMHF-G5 against Aspergillus tubingensis is ≥16.74mm, the inhibition zone width of Cochliobolus graminearum is ≥14.27mm, the inhibition zone width of Fusarium graminearum is ≥14.12mm, the inhibition zone width of Botrytis cinerea is ≥13.93mm, and the inhibition zone width of Pseudomonas aeruginosa is ≥12.97mm.

[0012] Furthermore, the diameter of the inhibition zone of the Bacillus Velezii QMHF-G5 against Micrococcus luteus is ≥38.51 mm, and the diameter of the inhibition zone of Bacillus larvae is ≥34.62 mm.

[0013] In a second aspect, the present invention provides a biological preparation or antibacterial agent for inhibiting fungi and bacteria, comprising the Bacillus Velezii QMHF-G5.

[0014] Further, the fungi include Botrytis cinerea, Fusarium graminearum, Colletotrichum cucurbitae, Phomopsis asparagus, Rhizoctonia graminearum, Corythuja graminearum, Black rot shell fungus of apple, Macrospora macrospora, Gibberella zeae, Macrospora hornularia, Fusarium odorifera, Fusarium solani, Fusarium oxysporum, Macrospora grisea, Alternaria ginseng, Green sclerotium of rice, Aspergillus tubingensis, Glomerella apis, Fusarium pseudobranchii and Mucor irregularis. Further, the bacteria include Xanthomonas oryzae, Pseudomonas solanacearum, Xanthomonas cotton angular spot, Bacillus larvae and Micrococcus luteus.

[0015] In a third aspect, the present invention provides a use of the Bacillus Velez QMHF-G5 in the preparation of drugs for preventing and treating animal and plant diseases.

[0016] Compared with the prior art, the present invention can achieve at least one of the following beneficial effects:

[0017] (1) The present invention discloses a Bacillus velezensis QMHF-G5, which has good antibacterial activity against pathogenic fungi and bacteria, can inhibit a variety of pathogenic fungi and bacteria, has a good broad spectrum, has high antibacterial activity against a variety of detected pathogenic fungi and bacteria, and has a high antibacterial rate;

[0018] (2) The Bacillus Velezii described in the present invention has antibacterial effects on 25 plant (or bee) pathogenic fungi and bacteria, especially the antibacterial zone width for Aspergillus tubingensis is ≥16.74mm, the antibacterial zone width for Cochliobolus graminearum is ≥14.27mm, the antibacterial zone width for Fusarium graminearum is ≥14.12mm, the antibacterial zone width for Botrytis cinerea is ≥13.93mm, and the antibacterial zone width for Pseudomonas aeruginosa is ≥12.97mm. The antibacterial zone diameter of the Bacillus Velezii QMHF-G5 for Micrococcus luteus is ≥38.51mm, and the antibacterial zone diameter of Bacillus larvae is ≥34.62mm.

[0019] (3) The Bacillus velezensis QMHF-G5 of the present invention has great application potential in controlling and preventing a variety of diseases caused by fungi and bacteria. With the in-depth study of its mechanism of action, safety and application effect, Bacillus velezensis QMHF-G5 is expected to become an important microorganism against a variety of pathogens and make important contributions to human health and environmental protection.

[0020] In the present invention, the above-mentioned technical solutions can also be combined with each other to achieve more preferred combination solutions. Other features and advantages of the present invention will be described in the subsequent description, and some advantages can become obvious from the description, or can be understood by practicing the present invention. The purpose and other advantages of the present invention can be realized and obtained through the contents particularly pointed out in the description and the drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The drawings are only for the purpose of illustrating particular embodiments and are not to be considered limiting of the present invention. Like reference symbols denote like components throughout the drawings.

[0022] Figure 1 The colony morphology of the strains QMHF-G5 and MS-E23 of the present invention after cultivation;

[0023] Figure 2 The starch hydrolysis diagrams of strains QMHF-G5 and MS-E23 of the present invention;

[0024] Figure 3 It is a test diagram of oil hydrolysis of strains QMHF-G5 and MS-E23 of the present invention;

[0025] Figure 4 It is a gelatin hydrolysis test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0026] Figure 5 It is a casein hydrolysis detection diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0027] Figure 6 It is a D-glucose fermentation test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0028] Figure 7 It is a D-fructose fermentation test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0029] Figure 8 It is a sucrose fermentation test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0030] Fig. 9 It is a D-mannitol fermentation test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0031] Fig.10 It is a hydrogen sulfide test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0032] Fig.11 The indole test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0033] Fig.12 It is the methyl red test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0034] Fig.13 It is the VP test diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0035] Fig.14 It is a graph of catalase assay of strains QMHF-G5 and MS-E23 of the present invention;

[0036] Fig.15The Gram staining results of the strains QMHF-G5 and MS-E23 of the present invention are shown;

[0037] Fig.16 The spore staining diagram of the strains QMHF-G5 and MS-E23 of the present invention;

[0038] Fig.17 The shape diagram of the strains QMHF-G5 and MS-E23 of the present invention after being punctured and inoculated into LB medium and cultured for 48 hours;

[0039] Fig.18 It is the PCR gel image of 16S rDNA of QMHF-G5 and MS-E23 in the present invention;

[0040] Fig.19 This is the PCR gel image of the gyrB gene of QMHF-G5 and MS-E23 in the present invention. DETAILED DESCRIPTION

[0041] The preferred embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings, wherein the accompanying drawings constitute a part of the present invention and are used together with the embodiments of the present invention to illustrate the principles of the present invention, but are not used to limit the scope of the present invention.

[0042] A specific embodiment of the present invention discloses a Bacillus velezensis QMHF-G5 with a deposit number of CGMCC No. 27713, the strain of which is deposited in the General Microbiological Center of China Culture Collection Administration (referred to as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with a deposit number of CGMCC No. 27713 and a deposit date of June 27, 2023.

[0043] Compared with the prior art, the Bacillus velezensis QMHF-G5 extracted by the present invention has good antibacterial activity against pathogenic fungi and bacteria, can inhibit a variety of pathogenic fungi and bacteria, has good broad-spectrum, has high antibacterial activity against a variety of detected pathogenic fungi and bacteria, and has a high antibacterial rate; with in-depth research on its mechanism of action, safety and application effect, Bacillus velezensis QMHF-G5 is expected to become an important microorganism against a variety of antigenic pathogens, and make important contributions to human health and environmental protection.

[0044] In a specific embodiment, the Bacillus Velez subtilis QMHF-G5 comprises the 16S rDNA shown in SEQ ID NO:1.

[0045] In a specific embodiment, the Bacillus Velez subtilis contains the QMHF-G5gyrB gene sequence shown in SED ID NO:2.

[0046] In a specific embodiment, the Bacillus Velezii QMHF-G5 is isolated from the intestine of Hufeng QMHF.

[0047] In a specific embodiment, the inhibition zone width of the Bacillus Velezii QMHF-G5 against Aspergillus tubingensis is ≥16.74mm, the inhibition zone width of Cochliobolus graminearum is ≥14.27mm, the inhibition zone width of Fusarium graminearum is ≥14.12mm, the inhibition zone width of Botrytis cinerea is ≥13.93mm, and the inhibition zone width of Pseudomonas aeruginosa is ≥12.97mm.

[0048] In a specific embodiment, the diameter of the inhibition zone of the Bacillus velezensis QMHF-G5 against Micrococcus luteus is ≥38.51 mm, and the diameter of the inhibition zone of Bacillus larvae is ≥34.62 mm.

[0049] Another specific embodiment of the present invention discloses a biological preparation or antibacterial agent for inhibiting fungi and bacteria, comprising the above-mentioned Bacillus Velez QMHF-G5.

[0050] In a specific embodiment, the fungi include Botrytis cinerea, Fusarium graminearum, Colletotrichum orbiculare (Berk. & Mont.) Arx, Phomopsis asparagi, Rhizoctonia cerealis Vander Hoeven, Cochliobolus sativus (Ito & Kurib.) Drechsler, Valsa mali Miyabe et Yamada, Exserohilum turcicum, Gibperella zeae (Schw.) Petch., Macrohoma kawatsukai Hara, Fusarium redolens, Fusarium solani, solani), Fusarium Oxysporum, Magnaporthe grisea Barr, Alternaria panax, Ustilaginoidea oryzae (Patou.) Bref = U. virens (Cooke) Tak., Aspergillus tubingensis, Ascosphaera apis, Fusariumpseudo circinatum, and Mucor irregularis.

[0051] In a specific embodiment, the bacteria include Xanthomonas oryzae, Pseudomonas solanacearum, Xanthomonas angularis, Bacillus larvae and Micrococcus luteus.

[0052] Another specific embodiment of the present invention discloses a use of the Bacillus Velezii QMHF-G5 in the preparation of drugs for preventing and treating animal and plant diseases.

[0053] The technical solution of the present invention is further explained below in conjunction with specific embodiments.

[0054] The green rice Hufeng described in the present invention was collected from Shijingshan District, Beijing on September 15, 2022; alfalfa was collected from Zhuozhou City, Hebei Province on August 10, 2022.

[0055] Example 1 Isolation and initial screening of strains QMHF-G5 and MS-E23

[0056] 1. Isolation and purification of strains

[0057] (1) Isolation of strain QMHF-G5: Place 2-3 green rice humus in a sterile 1.5 mL centrifuge tube, add 600 μL sterile saline, grind with a grinding rod until homogenized, and then vortex to mix. Let it stand for a while, absorb the turbid liquid, and use sterile saline to dilute it 10 times to 10 -5 . Take 10 -1 Up to 10 -5 100 μL of the diluted sample was spread on LB medium plates, and each dilution was repeated 3 times. The plates were incubated at 37°C for 24-48 hours.

[0058] (2) Isolation of strain MS-E23: Place 20.0 g of alfalfa leaves in a 250 mL sterile conical flask, add 180 mL of sterile saline, and place in an oscillator at 4°C and oscillate at 240 rpm for 2 hours. Soak in 75% ethanol for 90 seconds, 3.25% sodium hypochlorite solution for 120 seconds, and 75% ethanol for 30 seconds to disinfect the surface, and then rinse three times in sterile distilled water to sterilize the surface. Transfer the surface-sterilized alfalfa to a sterile mortar and grind, add 45 mL of saline and mix thoroughly to collect the suspension of microorganisms in the leaves. Dilute the suspension 10 times with sterile saline to 10 -5 . Take 10 -1 Up to 10 -5 100 μL of the diluted sample was spread on LB medium plates, and each dilution was repeated 3 times. The plates were incubated at 37°C for 24-48 hours.

[0059] According to parameters such as colony size, shape, edge, gloss, texture, color and transparency, the colonies from the above two different sources were streaked and purified on LB medium plates to obtain pure cultures of bacteria. Different strains were numbered and then stored in 20% glycerol at -80°C.

[0060] Table 1 Sample collection information

[0061]

[0062] 2. Initial screening of strains QMHF-G5 and MS-E23

[0063] Select the colonies with round or irregular shapes, smooth or wavy edges, milky white or light yellow in the LB medium plate for streak purification, and culture them on LB solid medium at 37℃ for 48h. Figure 1As shown, the colony was light yellow, compact in texture, with irregular edges, a ring-shaped protrusion in the middle, and wrinkles inside the ring, and was recorded as strain QMHF-G5.

[0064] The strain MS-E23 was cultured on LB solid medium at 37°C for 48 h. The colony morphology was as follows Figure 1 As shown, the colonies are milky white, with irregular edges, moist texture, and a ring-shaped protrusion in the middle.

[0065] 3. Identification of strains

[0066] (I) Physiological and biochemical identification of strains

[0067] (1) Starch hydrolysis test

[0068] The fresh solid culture of the strain to be identified was streaked into starch medium and incubated at 37°C for 48 hours. After obvious colonies were formed, iodine solution was added to the plate. The plate turned blue-black. If there were transparent circles around the colonies, it indicated that starch hydrolysis was positive. If the colonies were still blue-black, starch hydrolysis was negative.

[0069] Starch medium (100 mL): (LB medium + 1.0% soluble starch) 1.0 g of tryptone, 0.5 g of yeast extract, 1.0 g of NaCl, 1.0 g of soluble starch, 1.5 g of agar, and 100 mL of distilled water. After dissolving in a water bath, sterilize at 121°C for 20 min and pour into a plate for later use.

[0070] Results: Starch hydrolysis of strains QMHF-G5 and MS-E23 was as follows: Figure 2 As shown, after strain QMHF-G5 was cultured on starch medium for 48 hours, iodine solution was added around the colony, and a transparent circle was formed around it, indicating that amylase can be secreted to hydrolyze starch, so strain QMHF-G5 is positive for starch hydrolysis. The formation of a transparent circle around strain MS-E23 indicates that amylase can be secreted to hydrolyze starch, so strain MS-E23 is positive for starch hydrolysis.

[0071] (2) Oil hydrolysis test

[0072] Cool the melted solid oil culture medium to about 50℃, shake it thoroughly to evenly distribute the oil, and pour it into a plate. Inoculate the strain to be identified with a streak on the oil culture medium. Invert and culture at 37℃ for 24h. Observe the color of the bacterial moss. If red spots appear, it means that the fat is hydrolyzed, which is a positive reaction.

[0073] Fat culture medium (100 ml): 1.0 g of peptone, 0.5 g of beef extract, 0.5 g of NaCl, 1.0 g of peanut oil or sesame oil, 0.1 mL of 1.6% neutral red aqueous solution, 1.5 g of agar, 100 mL of distilled water, pH 7.2, autoclave at 121°C for 20 min, pour into a plate for later use.

[0074] Note: Do not use spoiled oil. Heat the oil, agar and water first, adjust the pH and then add neutral red. 1.6% neutral red aqueous solution: 1.6g neutral red, 28mL 95% ethanol, 72mL distilled water.

[0075] Results: The lipid hydrolysis test of strains QMHF-G5 and MS-E23 was as follows: Figure 3 As shown, there are no red spots around the colonies of strain QMHF-G5, indicating that it cannot produce lipase and the lipase hydrolysis is negative. There are no red spots around the colonies of strain MS-E23, indicating that it cannot produce lipase and the lipase hydrolysis is negative.

[0076] (3) Gelatin hydrolysis test:

[0077] Take the gelatin culture medium test tubes and use the inoculation needle to puncture and inoculate the strains to be identified. Place the inoculated test tubes at 20℃ for 2-5 days and observe the liquefaction of the gelatin.

[0078] Gelatin culture medium (100 mL): LB culture medium, 12-18 g of gelatin, pH 7.2-7.4. Dissolve the above ingredients in a water bath and adjust the pH to 7.2-7.4, dispense into test tubes, and sterilize at 121°C for 20 min.

[0079] Results: The gelatin hydrolysis test of strains QMHF-G5 and MS-E23 was as follows Figure 4 As shown, after strains QMHF-G5 and MS-E23 were inoculated on gelatin medium, liquefaction of the gelatin medium was observed after culturing at 20°C for 3-4 days. Therefore, strains QMHF-G5 and MS-E23 can both produce gelatinase to hydrolyze gelatin, and the gelatin hydrolysis test is positive.

[0080] (4) Casein hydrolysis test (litmus milk test)

[0081] Inoculate the strains to be identified into milk litmus medium test tubes and culture at 37℃ for 24-48h. If the milk turns clear, it is positive.

[0082] Milk litmus medium: 100 mL skim milk, 4 mL 2.5% litmus solution (filtered overnight before use). The color after mixing should be moderately lilac or purple. Divide into test tubes with a milk height of 4 cm and sterilize at 121°C under high pressure for 15 min.

[0083] Results: Casein hydrolysis test of strains QMHF-G5 and MS-E23 was as follows: Figure 5As shown. The blank control is a milk litmus medium without inoculation of strains. After culturing at 37°C for 48 hours, the results showed that the milk in the culture medium inoculated with strains QMHF-G5 and MS-E23 became clear, while the control had no obvious change (the milk did not become clear). The above results show that the casein hydrolysis test of strains QMHF-G5 and MS-E23 is positive and can hydrolyze casein.

[0084] (5) Sugar alcohol fermentation test

[0085] Use the strain to be identified that has been cultured for 18 hours, inoculate it into the sugar fermentation medium, set up a negative control, and culture it at 37℃ for 24-48 hours, and check the results. Observe the color changes of each test tube and whether there are bubbles in the Dulbecco's tubule. If the indicator changes from purple to yellow, it means that the sugar fermentation produces acid, which is positive.

[0086] Sugar fermentation medium (100 mL): 1 g tryptone, 0.5 g NaCl, 0.05 mL 1.6% bromocresol violet ethanol solution, pH 7.6, dilute to 100 mL, divide into test tubes (10 mL / tube), put a Dulbecco tube in each tube to fill it with culture medium, and sterilize it at 121°C for 20 min.

[0087] 20% sugar solution (D-glucose, D-fructose, sucrose, D-mannitol) was sterilized by autoclaving at 112°C for 30 min. After sterilization, 0.5 ml of 20% sugar solution was aseptically added to each tube.

[0088] Results: D-glucose fermentation test of strains QMHF-G5 and MS-E23 was as follows: Figure 6 As shown, the color of the glucose fermentation medium of strains QMHF-G5 and MS-E23 did not change, and D-glucose could not be decomposed; bubbles were produced in the dulbecco tubes of QMHF-G5 and MS-E23, indicating that QMHF-G5 and MS-E23 produced gas but not acid when fermenting D-glucose.

[0089] D-fructose fermentation test of strains QMHF-G5 and MS-E23 Figure 7 As shown in the figure, it can be seen that the color of the D-fructose fermentation medium of the inoculated strain QMHF-G5 did not change, indicating that D-fructose could not be decomposed; no bubbles were produced in the Duroc tube of QMHF-G5, indicating that the strain QMHF-G5 did not produce acid or gas when fermenting D-fructose. The color of the D-fructose fermentation medium of the strain MS-E23 did not change, indicating that D-fructose could not be decomposed; bubbles were produced in the Duroc tube of MS-E23, indicating that the strain QMHF-G5 did not produce acid but produced gas when fermenting D-fructose.

[0090] Sucrose fermentation test of strains QMHF-G5 and MS-E23 Figure 8As shown in the figure, it can be seen that the color of the sucrose fermentation medium inoculated with strain QMHF-G5 is purple, does not change color, and cannot decompose fructose. And no bubbles are generated in the Duroc tube. This shows that strain QMHF-G5 does not produce acid or gas when fermenting sucrose. The color of the sucrose fermentation medium inoculated with strain MS-E23 turns yellow, and can decompose fructose. And bubbles are generated in the Duroc tube, indicating that strain MS-E23 produces acid and gas when fermenting sucrose.

[0091] D-mannitol fermentation test of strains QMHF-G5 and MS-E23 Fig. 9 As shown in the figure, it can be seen that the color of the D-mannitol fermentation medium of the inoculated strain QMHF-G5 did not change and remained purple, and no bubbles were generated in the Duroc tube, indicating that the strain QMHF-G5 did not produce acid or gas when fermenting D-mannitol. The color of the D-mannitol fermentation medium of the strain MS-E23 did not change and remained purple, and bubbles were generated in the Duroc tube, indicating that the strain MS-E23 did not produce acid but gas when fermenting D-mannitol.

[0092] (6) Hydrogen sulfide test

[0093] Use an inoculation needle to pierce the strain to be identified into lead acetate culture medium and culture it at 37℃ for 48h. If the culture medium turns black, it is positive. If it is negative, continue to culture for up to 6 days.

[0094] Lead acetate medium (100mL): 0.3g beef extract, 1.0g peptone, 0.5g NaCl, 1.5g agar, dilute to 100mL and heat to dissolve, add 0.25g sodium thiosulfate when cooled to 60℃, adjust pH to 7.2, dispense into Erlenmeyer flasks, sterilize at 115℃ for 15min. Take out and cool to 55-60℃, add 1mL of 10% lead acetate aqueous solution (sterile), mix well and pour into sterile test tubes.

[0095] Results: The hydrogen sulfide test of strains QMHF-G5 and MS-E23 was as follows: Fig.10 As shown, the strains QMHF-G5 and MS-E23 were inoculated by puncture on the lead acetate medium and cultured at 37°C for 48 hours. The test tube did not turn black. When the culture was continued to the 6th day, there was still no blackening near the puncture line, indicating that the strains QMHF-G5 and MS-E23 did not produce hydrogen sulfide and the hydrogen sulfide test was negative.

[0096] (7) Indole test

[0097] Inoculate the strain to be identified into the indole culture medium and culture it at 37℃ for 48h. Slowly add 2 drops of indole reagent to the surface along the tube wall. If red appears on the liquid interface, it is a positive reaction. If it is not obvious, add 4-5 drops of ether to the culture medium and let it stand for 1min. After the ether rises, add indole reagent and observe the color reaction. A red ring appears between the ether and the culture medium, which is a positive reaction.

[0098] Indole medium (100 mL): 1.0 g of trypticase peptone, 0.5 g of NaCl, 0.05 g of L-tryptophan, pH 7.6, autoclave at 121°C for 15 min for use.

[0099] Indole reagent: p-dimethylaminobenzaldehyde 2 g, 95% ethanol 190 mL, concentrated HCl 40 mL.

[0100] Results: After the strains QMHF-G5 and MS-E23 were inoculated with indole medium and cultured at 37℃ for 48h, 2 drops of indole reagent were slowly added along the tube wall. No red color was produced on the liquid interface of the strains. Fig.11 As shown, it was shown that the indole reaction of strains QMHF-G5 and MS-E23 was negative.

[0101] (8) Methyl red test

[0102] Pick the strain to be identified and inoculate it in a glucose-peptone water culture medium, culture at 37°C, and take 1 mL of culture medium every day from the second day, add 1-2 drops of methyl red indicator, positive is bright red, weak positive is light red, and negative is yellow. If positive is found or it is still negative on the 5th day, the result can be determined.

[0103] Glucose peptone water culture medium (100mL): 0.5g peptone, 0.5g glucose, 0.2g K2HPO4, dissolve the above ingredients in 100mL water, adjust the pH to 7.0-7.2, divide into test tubes of 10mL, and sterilize at 112℃ for 30min.

[0104] Methyl red reagent: 0.04g methyl red, 60mL 95% ethanol, 40mL distilled water. Dissolve in ethanol first, then add distilled water.

[0105] Results: QMHF-G5 and MS-E23 were inoculated into glucose peptone water medium, respectively, and cultured at 37°C. Samples were taken on the 5th day after culture, and methyl red indicator was added. The color of the bacterial solution was the same as that of the blank control (uninoculated culture medium), which was yellow. Fig.12 The above results show that the methyl red reaction of strains QMHF-G5 and MS-E23 is negative.

[0106] (9) VP test

[0107] Inoculate the strain to be identified into glucose peptone water culture medium (VP determination medium), culture at 37°C for 48 hours, add 1mL 40% NaOH and 1mL 5% α-naphthol to the test tube, shake vigorously, and keep it at 37°C for 15-30 minutes to speed up the reaction. If the culture turns red, it is a positive VP reaction.

[0108] VP assay medium (100 mL): 0.5 g peptone, 0.5 g glucose, 0.2 g NaCl, dissolve the above ingredients in 100 mL water, adjust the pH to 7.0-7.2, dispense into test tubes of 4-5 mL, and sterilize at 112°C for 30 min.

[0109] 5% α-naphthol: 5g α-naphthol, 100mL anhydrous ethanol

[0110] Results: The strains QMHF-G5 and MS-E23 were inoculated into glucose peptone water medium and cultured at 37℃ for 48h. Then, 1mL 40% NaOH and 1mL 5% α-naphthol were added. The results showed that the fermentation broth of QMHF-G5 and MS-E23 turned red. Fig.13 As shown, the VP reaction of strains QMHF-G5 and MS-E23 were both positive.

[0111] (10) Determination of catalase

[0112] Pick a small amount of Bacillus culture from the LB slant, smear it on a clean glass slide, add 10% hydrogen peroxide, and the one with bubbles generated is positive.

[0113] Results: A small amount of culture was picked from the plates of the strains QMHF-G5 and MS-E23 respectively, smeared on a clean slide, and 10% hydrogen peroxide was added. Bubbles were generated, such as Fig.14 Therefore, the catalase reaction (catalase reaction) of QMHF-G5 and MS-E23 were both positive.

[0114] (ii) Gram staining (Gram staining kit)

[0115] Gram staining was performed using the Solebro Gram staining kit (Cat. No. G1060). The specific steps are as follows:

[0116] (1) The strains QMHF-G5 and MS-E23 cultured on the plates were selected and inoculated into LB test tubes respectively, and cultured at 37°C with shaking for 24 h.

[0117] (2) Smear fixation: Pipette 10 μL of bacterial solution onto a glass slide and pass it through a flame 1-2 times during fixation. Do not overheat.

[0118] (3) Staining: After adding crystal violet, stain for 1 minute and wash with water. After adding iodine solution, stain for 1 minute and wash with water. Add decolorizing solution, shake the slide, decolorize for about 20-60 seconds depending on the thickness of the smear, wash with water, and absorb water. After adding safranin, stain for 1 minute and wash with water. After blotting or air drying, examine with an oil microscope. Gram-negative bacteria appear red, and Gram-positive bacteria appear purple.

[0119] Results: Gram staining results are as follows Fig.15 As shown, the bacterial body of strain QMHF-G5 is short rod-shaped, and the cells are purple after Gram staining, indicating that QMHF-G5 is a Gram-positive bacterium. The bacterial body of strain MS-E23 is rod-shaped, and the cells are purple after Gram staining, indicating that MS-E23 is a Gram-positive bacterium.

[0120] (III) Spore staining (Spore staining kit)

[0121] Spore staining was performed using the Scharffer-Fulton method (malachite green staining method) produced by Yuanye Biotechnology Co., Ltd. The specific steps are as follows:

[0122] (1) The strains QMHF-G5 and MS-E23 cultured on the plates were selected and inoculated into LB test tubes respectively, and cultured at 37°C with shaking for 48 h.

[0123] (2) Pipette 10 μL of bacterial solution onto a clean, grease-free glass slide to make a smear and allow to dry naturally.

[0124] (3) Add malachite green dye to the coating to ensure even distribution of bacteria.

[0125] (4) Heat intermittently with low heat for 10 minutes.

[0126] (5) Rinse gently with water.

[0127] (6) Stain with spore counterstain for 1 min and rinse with water.

[0128] Microscopic examination: After drying, examine with an oil microscope; spores are stained green and bacteria are stained red.

[0129] Results: Spore staining results are as follows Fig.16 As shown, the spores in QMHF-G5 cells were stained green, short, and blunt, indicating that they can produce spores. The spores in MS-E23 cells were stained green, short, and blunt, indicating that they can also produce spores.

[0130] (IV) Mobility

[0131] Use an inoculation needle to puncture and inoculate strains QMHF-G5 and MS-E23 into LB medium, respectively, and culture at 37℃ for 48h. Observe the growth every 24h after inoculation. If the growth spreads from the puncture line to the surrounding area in a cloud-like manner, it means that the test strain is motile and is positive.

[0132] LB medium (100 mL): 1.0 g of tryptone, 0.5 g of yeast extract, 1.0 g of NaCl, 1.5 g of agar, 100 mL of distilled water, pH = 7.2, divided into test tubes, and sterilized by high pressure at 121°C for 20 min.

[0133] Results: After 48 hours of puncture inoculation of the two Bacillus strains into LB medium, the strains grew along the puncture line and were all motile. Among them, strain QMHF-G5 showed significant cloud-like growth and had the strongest motility, followed by strain MS-E23.

[0134] In summary, the basic biological characteristics of strains QMHF-G5 and MS-E23 are shown in Table 2:

[0135] Table 2 Basic biological characteristics of strains QMHF-G5 and MS-E23

[0136]

[0137] (V) Molecular identification of strains

[0138] 1. Extraction of genomic DNA

[0139] A single colony was picked from the streaked activated LB plate and inoculated into fresh LB liquid medium, and cultured at 37°C with shaking at 200 rpm. When the bacterial liquid OD600 grew to 0.8-1.0, 5 mL of bacterial liquid was taken and centrifuged to collect the bacteria. Genomic DNA was extracted using a bacterial genomic DNA extraction kit (DC112-01, Novozymes, China).

[0140] 2. PCR amplification of 16S rDNA

[0141] Using genomic DNA as template, primers were designed and synthesized (Sangon Biotechnology Co., Ltd., China) to amplify 16S rDNA:

[0142] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3';

[0143] 1492R: 5'-GGTTACCTTGTTACGACTT-3';

[0144] Then, the 16S rDNA fragment was amplified using Q5 high-fidelity polymerase (BDTP1180, NEB, USA). The amplified fragment was detected as a single band by 1% agarose gel electrophoresis (the fragment length was about 1500 bp, the result is shown in the figure), and then sent to a sequencing company for sequencing (Sangon Biotechnology Co., Ltd., China). After sequencing to obtain the sequence of the 16S rDNA fragment, the sequence was compared and analyzed by BLAST (http: / / www.ncbi.nlm.nih.gov) in GenBank, and the names of the identified strains similar to the two strains QMHF-G5 and MS-E23 were obtained, and the strains were identified. PCR gel electrophoresis of 16S rDNA of the two strains Fig.18 shown.

[0145] PCR system:

[0146]

[0147] DNA Amplification Procedure:

[0148]

[0149] 3. PCR amplification of gyrB gene

[0150] Using genomic DNA as a template, degenerate primers were designed and synthesized (Sangon Biotechnology (Shanghai) Co., Ltd., China) to amplify the gyrB gene (DNAgyrase subunit B gene, partial sequence, about 1200 bp in length). The underlined parts are sequencing primers, namely UP-1S and UP-2Sr.

[0151] gyrB-F:

[0152] 5'- GAAGTCATCATGACCGTTCTGCA YGCNGGNGGNAARTTYGA-3′;

[0153] gyrB-R:

[0154] 5'- AGCACGGTACGGATGTGCGAGCC RTCNACRTCNGCRTCNGCRTCNGTCAT-3';

[0155] Then, the gyrB gene fragment was amplified using Q5 high-fidelity polymerase (BDTP1180, NEB, USA). The amplified fragment was detected as a single band by 1% agarose gel electrophoresis (the fragment length was about 1200 bp, the result is shown in the figure), and then sent to a sequencing company for sequencing using sequencing primers UP-1S and UP-2Sr (Shanghai Biotechnology Co., Ltd., China). The PCR gel images of the gyrB gene of the two strains are shown in Fig.19 shown.

[0156] PCR system:

[0157]

[0158] DNA Amplification Procedure:

[0159]

[0160] 4. 16S rDNA and gyrB gene sequence analysis

[0161] The 16S rDNA (shown in SEQ ID NO: 1) and gyrB gene (shown in SEQ ID NO: 2) of strain QMHF-G5, and the 16S rDNA (shown in SEQ ID NO: 3) and gyrB gene (shown in SEQ ID NO: 4) of strain MS-E23;

[0162] The sequences obtained after sequencing were compared with the NCBI database by BLAST. The comparison results are shown in Table 3.

[0163] Table 3 Molecular identification of strains QMHF-G5 and MS-E23

[0164]

[0165]

[0166] As shown in Table 3, the 16S rDNA sequence of strain QMHF-G5 has a sequence similarity of 99.93% with B. velezensis and B. methylotrophicus, a sequence similarity of 99.86% with B. subtilis, and a sequence similarity of 99.72% with B. amyloliquefaciens. The gyrB gene sequence of strain QMHF-G5 has a sequence similarity of 99.91% with B. velezensis and B. amyloliquefaciens. Combined with the above physiological and biochemical experimental results, the QMHF-G5 strain was identified as B. velezensis.

[0167] The gyrB gene sequence of strain MS-E23 has a similarity of 98.93% with that of B. subtilis subsp. subtilis, and strain MS-E23 is identified as B. subtilis subsp. subtilis.

[0168] 4. Determination of antibacterial activity of strains QMHF-G5 and MS-E23

[0169] The dual culture method was used to detect the antibacterial activity of Bacillus against pathogenic fungi and bacteria in vitro. 18 plant pathogenic fungi, 3 plant pathogenic bacteria, 2 bee pathogenic fungi, 1 bee pathogenic bacteria and 1 commonly used indicator bacteria (the 25 pathogens are shown in Table 4, provided by the Plant Disease and Insect Pest Laboratory, Institute of Plant Protection, Chinese Academy of Agricultural Sciences and the Bee Disease and Insect Pest Laboratory, Bee Research Institute, Chinese Academy of Agricultural Sciences, and the above strains were isolated and identified from nature according to conventional methods known in the art) were used as target bacteria to determine the antibacterial activity of QMHF-G5 and MS-E23 strains.

[0170] Table 4 25 plant (or bee) pathogenic fungi and bacteria

[0171]

[0172]

[0173] (1) Activation of pathogens

[0174] Fungal activation: Use a sterilized inoculation loop to pick up the mycelium of pathogenic fungi stored at 4°C and place them on a new PDA medium plate. Culture them in a constant temperature incubator at 28°C for 4-5 days and set aside.

[0175] Bacterial activation: Take out the bacterial strain, inoculate it into fresh LB solid medium with a sterilized inoculation loop, and culture it in a 37℃ constant temperature incubator for 24-48 hours. When a single colony grows, keep it for later use. For liquid culture, pick a single colony and place it in 3mL liquid LB medium, and culture it at 37℃, 200r / min, with shaking for 12 hours.

[0176] (2) Determination of antibacterial effect on pathogenic fungi

[0177] The activated pathogenic fungi were punched out with a sterile cork borer to obtain a 6 mm diameter fungus block, and bacteria were inoculated at equal distances around it (about 3 cm). The culture without any bacteria was used as the control (CK). Each treatment was repeated 3 times. After constant temperature culture at 28°C for 5-7 days, the width of the inhibition zone (the distance between the antagonistic bacteria and the edge of the pathogenic fungi) was measured.

[0178] (3) Determination of antibacterial effect on pathogenic bacteria

[0179] Prepare pathogenic bacteria liquid. When the bacteria grow to the logarithmic phase, take 100 μL of the liquid and spread it on LB solid culture medium. Make holes evenly around the culture medium (6 mm in diameter). Then add 50 μL of filtered and sterilized antagonistic bacteria liquid into the holes. Repeat 3 times for each dish. Culture at 37°C and measure the diameter of the inhibition zone after 1-2 days.

[0180] (4) Results and analysis

[0181] The antibacterial activity of strains QMHF-G5 and MS-E23 against plant pathogenic fungi was determined, and the results are shown in Table 5.

[0182] Table 5 Test results of antibacterial activity against plant (or bee) pathogenic fungi

[0183]

[0184]

[0185] It can be seen from Table 5 that strain QMHF-G5 showed obvious antibacterial effects on 20 pathogenic fungi, among which the antibacterial effect on Aspergillus tubingensis was the best, with an inhibition zone width of 16.74 mm and an inhibition zone width of 14.27 mm for Cochliobolus graminearum. It also showed high antibacterial activity when co-cultured with Fusarium graminearum, with an inhibition zone width of 14.12 mm for Fusarium graminearum, 13.93 mm for Botrytis cinerea, and 12.97 mm for Psoralea corylifolia. The inhibition zone width for more than half of the target bacteria in this experiment was greater than 10 mm, and it also showed obvious antibacterial ability against other tested fungi.

[0186] MS-E23 showed a slightly weaker antibacterial effect against 20 pathogenic fungi, among which the inhibitory effect against Botrytis cinerea was the most obvious, with the width of the inhibition zone reaching 9.03 mm. The width of the inhibition zone when co-cultured with Cochliobolus graminearum was 8.70 mm, and the width of the inhibition zone against Pseudomonas aeruginosa reached 8.06 mm. It showed weaker antibacterial ability against the remaining 17 strains.

[0187] The results of the determination of the antibacterial activity of strains QMHF-G5 and MS-E23 against pathogenic bacteria are shown in Table 6.

[0188] Table 6 Determination results of antibacterial activity against pathogenic bacteria

[0189]

[0190] As can be seen from Table 6, strain QMHF-G5 exhibits different antibacterial activities against different pathogenic bacteria. The diameter of the inhibition zone against Micrococcus luteus can reach 38.51 mm, and the diameter of the inhibition zone against Bacillus larvae can reach 34.62 mm. It also exhibits strong antibacterial activity against other tested strains.

[0191] The strain MS-E23 had no inhibitory effect on Xanthomonas oryzae and Pseudomonas solanacearum. The diameter of the inhibition zone against Micrococcus luteus was 19.48 mm, the diameter of the inhibition zone against Bacillus larvae was 18.41 mm, and the diameter of the inhibition zone against Xanthomonas angularis of cotton was 9.11 mm.

[0192] The strain QMHF-G5 not only showed significant inhibitory effects on a wide range of fungal species, but also showed effective antibacterial activity against all pathogenic bacteria tested. In recent years, finding effective biocontrol strains in the field of biological control has become the key to sustainable agricultural development. The results of the present invention mean that QMHF-G5 has great application potential in controlling and preventing a variety of diseases caused by fungi and bacteria. With in-depth research on its mechanism of action, safety and application effect, QMHF-G5 is expected to become an important microorganism against a variety of pathogens and make important contributions to human health and environmental protection.

[0193] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A Bacillus velezensis QMHF-G5 with a deposit number of CGMCC No. 27713.

2. The Bacillus Velez QMHF-G5 according to claim 1, characterized in that The Bacillus Velez subtilis QMHF-G5 comprises the 16S rDNA shown in SEQ ID NO:

1.

3. The Bacillus Velez QMHF-G5 according to claim 1, characterized in that The Bacillus Velezii contains the QMHF-G5gyrB gene sequence shown in SED ID NO:

2.

4. The Bacillus Velez QMHF-G5 according to any one of claims 1 to 3, characterized in that The Velez subsp. QMHF-G5 is isolated from the intestine of Hufeng.

5. The Bacillus Velez QMHF-G5 according to any one of claims 1 to 3, characterized in that The bacteriostatic zone width of the Velez subsp. QMHF-G5 against Aspergillus tubingensis is ≥16.74 mm, the bacteriostatic zone width of Cochliobolus graminearum is ≥14.27 mm, the bacteriostatic zone width of Fusarium graminearum is ≥14.12 mm, the bacteriostatic zone width of Botrytis cinerea is ≥13.93 mm, and the bacteriostatic zone width of Pseudomonas aeruginosa is ≥12.97 mm.

6. The Bacillus Velez QMHF-G5 according to any one of claims 1 to 3, characterized in that The diameter of the inhibition zone of the Velez subsp. QMHF-G5 against Micrococcus luteus is ≥38.51 mm, and the diameter of the inhibition zone of the larval Bacillus subsp. is ≥34.62 mm.

7. A biological agent or antibacterial agent for inhibiting fungi and bacteria, characterized in that: The method comprises the Bacillus Velez QMHF-G5 according to any one of claims 1 to 6; The fungi are gray mold, graminearum Fusarium, cucurbit spiny colleorhiza, asparagus asparagus, graminearum Rhizoctonia, graminearum spiral spore, apple black rot shell fungus, macrospotted umbilical spore, maize gibberellosis, ring pattern macrospore, fragrant fusarium, solani fusarium, oxysporum fusarium, gray big angle shell, ginseng alternator, rice green sclerotium, tubing Aspergillus, bee spherical fungus, pseudo-branch fusarium and irregular mold; The bacteria are Xanthomonas oryzae, Pseudomonas solanacearum, Xanthomonas angularis, Bacillus larvae and Micrococcus luteus.

8. Use of the Bacillus Velez QMHF-G5 according to any one of claims 1 to 6 in the preparation of drugs for preventing and treating animal and plant diseases, characterized in that: The plant and animal diseases are caused by fungi or bacteria, and the fungi are gray mold, graminearum Fusarium, cucurbit spiny colleorhiza, asparagus asparagus, graminearum Rhizoctonia, graminearum Corythuja, apple black rot shell fungus, macrospotted umbilical spore, maize gibberellosis, ring pattern macrospore, fragrant fusarium, solani fusarium, oxysporum fusarium, gray big angle shell fungus, ginseng alternaria, rice green sclerotium, tubing Aspergillus, bee spherical fungus, pseudo-branch fusarium and irregular mold; The bacteria are Xanthomonas oryzae, Pseudomonas solanacearum, Xanthomonas angularis, Bacillus larvae and Micrococcus luteus.

Images