Oral cancer diagnostic marker SLC37A4-Exon7 cleavage isomer and its application
By using PCR reagents and overexpression vectors to detect the SLC37A4-Exon7 splice isoform, we have solved the diagnostic and treatment challenges of oral cancer, realized the diagnostic value and prognostic prediction of high expression of the isoform in oral cancer, promoted cell proliferation and migration, and improved the treatment effect of oral cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-20
- Publication Date
- 2026-03-10
AI Technical Summary
The etiology of oral cancer is not yet clear in the current technology, the overall survival rate has not been significantly improved, and there is a lack of effective diagnostic markers, which affects the diagnosis and treatment effect.
We discovered and verified that the SLC37A4-Exon7 splice isoform is highly expressed in oral cancer tissues. We designed and provided PCR reagents to detect this isoform, and verified its expression by semi-quantitative RT-PCR and Western blotting. We then constructed an overexpression vector to overexpress SLC37A4-Exon7 in oral cancer cells and observed its effects on cell proliferation, migration, and colony formation.
The SLC37A4-Exon7 splice isomer is highly expressed in oral cancer tissues, possessing diagnostic value and prognostic prediction potential. It can significantly promote the proliferation and migration of oral cancer cells, providing a target for early diagnosis and treatment of oral cancer, and improving the specificity and sensitivity of diagnosis.
Smart Images

Figure CN118547073B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor molecular biology, specifically relating to the application of a reagent for detecting the SLC37A4-Exon7 cleavage isomer in oral cancer tissue. Background Technology
[0002] Oral cancer is one of the most common malignant tumors of the head and neck. Currently, the main treatments for oral cancer include surgery, radiotherapy, and chemotherapy. Although scientists both domestically and internationally have conducted extensive research on oral cancer in recent years, the etiology of oral cancer remains unclear, and the overall survival rate has not significantly improved. Therefore, in-depth research into the molecular mechanisms of oral cancer development and progression, and the search for new and highly effective diagnostic markers, are of significant theoretical and practical importance for the diagnosis and treatment of oral cancer, as well as for improving patients' survival rates and quality of life.
[0003] Alternative splicing (AS) of pre-mRNA is a crucial gene regulatory process that greatly enriches the composition of the transcriptome and contributes to the diversity of both the transcriptome and proteome. Increased high-throughput sequencing of cancer genomes and transcriptomes has revealed splicing alterations in pre-mRNA across various cancers. Since isoforms generated by alternative splicing are often associated with cancer development and progression, the alternative splicing process itself is a potential target for gene therapy. These isoforms could potentially serve as novel biomarkers for early tumor diagnosis and prognostic assessment. Summary of the Invention
[0004] This invention reveals that the coding sequence (CDS) of wild-type SLC37A4 contains nine exons (SLC37A4-WT), and exon 7 can skip to form the SLC37A4-Exon7 splice isoform, which may play an important role in oral cancer. Our previous experiments showed that SLC37A4-WT is highly expressed in normal adjacent normal tissues but almost not in oral cancer tissues, while the SLC37A4-Exon7 splice isoform is the opposite, showing significant overexpression in cancer tissues and very low expression in normal adjacent normal tissues. Further research confirms that the SLC37A4-Exon7 splice isoform can promote the proliferation, invasion, and migration of oral cancer cells, thus playing an important oncogene role in the malignant progression of oral cancer.
[0005] The primary objective of this invention is to provide a 1290 bp cleavage isomer, SLC37A4-Exon7, discovered in oral cancer tissue, and to demonstrate its relationship with oral cancer, suggesting its potential as a diagnostic marker and therapeutic target for oral cancer. The sequence of this cleavage isomer is shown in SEQ ID NO. 1.
[0006] A second objective of this invention is to provide the application of a reagent for detecting the SLC37A4-Exon7 cleavage isomer in the preparation of oral cancer diagnostic agents.
[0007] Furthermore, the reagents for detecting the SLC37A4-Exon7 cleavage isomer include PCR detection reagents.
[0008] The primers in the PCR reagent are:
[0009] Upstream primer: 5'- GACTGTCCAACTACGGGAACCCT -3'
[0010] Downstream primer: 5'- GAGGGGCACTCTCGTTGGCTAT-3'.
[0011] The GAPDH internal reference primer in the PCR reagent is:
[0012] Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3'
[0013] Downstream primer: 5'- GGCTGTTGTCATACTTCTCATGG-3'.
[0014] This invention also provides the application of reagents that overexpress the SLC37A4-Exon7 cleavage isomer in the preparation of in vitro agents that promote the proliferation and migration of oral cancer cells.
[0015] This invention collected tumor tissues and adjacent normal tissues from multiple oral cancer patients and used PCR technology to detect the expression of the SLC37A4-Exon7 splice isomer. The results showed that compared with adjacent normal tissues, the SLC37A4-Exon7 splice isomer was significantly highly expressed in tumor tissues. The expression level of the SLC37A4-Exon7 splice isomer in the tumor group was approximately 10.5 times that in normal adjacent normal tissues, and the difference between the two groups was statistically significant (P<0.0001). Therefore, the SLC37A4-Exon7 splice isomer is highly expressed in oral cancer tissues, and it may play an important biological role in the occurrence and development of oral cancer, potentially serving as a molecular marker for oral cancer diagnosis. Attached Figure Description
[0016] Figure 1 The SLC37A4-Exon7 splice isomer is highly expressed in oral cancer.
[0017] A. Semi-quantitative RT-PCR detection of the expression of SLC37A4-Exon7 splice isomer in tumor tissues and adjacent normal tissues of 12 oral cancer patients. N: adjacent normal tissue; T: oral cancer tissue, GAPDH as internal control; B. Gray-scale quantitative results of Figure A, p<0.0001.
[0018] Figure 2 ROC curve analysis was used to assess the specificity and sensitivity of the SLC37A4-Exon7 cleavage isomer for the diagnosis of oral cancer.
[0019] Figure 3 The relationship between the expression level of SLC37A4-Exon7 splice isoform and the prognosis of oral cancer patients.
[0020] Figure 4 Western blot analysis was used to detect the overexpression effects of SLC37A4-WT and SLC37A4-Exon7 cleavage isoforms in oral cancer cell lines.
[0021] Figure 5 The effect of SLC37A4-Exon7 splice isoform overexpression on the clonogenic ability of oral cancer cells in vitro; A. Plate colony formation assay to detect the effect of SLC37A4-Exon7 splice isoform overexpression on the clonogenic ability of oral cancer cells CAL27 and SCC9; B. Statistical graph of clonogenic assay of oral cancer CAL27 and SCC9 cells overexpressing SLC37A4-Exon7 splice isoform, statistically analyzed using Student's t-test method, ns represents no significance. <0.05, <0.01, <0.001.
[0022] Figure 6 The effect of SLC37A4-Exon7 cleavage isomer overexpression on the proliferation of oral cancer cells in vitro; the effect of SLC37A4-Exon7 cleavage isomer overexpression on the proliferation of oral cancer cells CAL27 and SCC9 was detected by CCK8 assay. Student's t-test was used for statistical analysis. ns represents no significance. <0.05, <0.01, <0.001.
[0023] Figure 7The effect of SLC37A4-Exon7 splice isoform overexpression on the migration ability of oral cancer cells in vitro; A. Transwell assay to detect the effect of SLC37A4-Exon7 splice isoform overexpression on the migration ability of oral cancer cells CAL27 and SCC9; B. Statistical graph of the migration ability of oral cancer CAL27 and SCC9 cells overexpressing SLC37A4-Exon7 splice isoform, statistically analyzed using Student's t-test, ns represents no significance. <0.05, <0.01, <0.001.
[0024] Figure 8 Effects of in vivo overexpression of the SLC37A4-Exon7 cleavage isomer on the proliferative capacity of oral cancer cells;
[0025] A. Tumor photographs of different groups in the nude mouse subcutaneous xenograft model; B. Comparison of tumor weight among different groups in the nude mouse subcutaneous xenograft model; C. Comparison of tumor growth rate among different groups in the nude mouse subcutaneous xenograft model; D. Immunohistochemical detection results of Ki-67 in different groups of nude mouse subcutaneous xenografts; E. Ki-67 expression score in nude mouse subcutaneous xenografts. ns indicates no significance. <0.05, <0.01, <0.001. Detailed Implementation
[0026] The following specific embodiments are intended to further illustrate the present invention, but not to limit the present invention.
[0027] This invention collected tumor tissue samples and adjacent normal samples from 12 oral cancer patients at Hunan Cancer Hospital. RNA was extracted from the tissue samples and reverse transcribed for use in real-time semi-quantitative PCR (RT-PCR) to detect the expression of target molecules. Fresh oral cancer tissue was immediately stored in liquid nitrogen after collection. Relevant clinical data from all patients were then collected. All tissue sample collection was authorized by the Ethics Committee of Hunan Cancer Hospital and obtained patient consent. The diagnoses of all specimens were confirmed by histopathological examination.
[0028] The cell lines used in the cell experiments of this invention include oral cancer cell lines CAL27 and SCC9. All cell lines were cryopreserved in liquid nitrogen in our laboratory. The cell culture conditions were: DMEM liquid medium containing 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin, and adherent growth in a constant temperature incubator at 37°C, 95% humidity, and 5% CO2 concentration.
[0029] The experimental animals of this invention
[0030] Hunan Slack Jingda Laboratory Animal Co., Ltd. provided the animals required for this invention, a total of 30 Balb / c nude mice, all female, aged 3-4 weeks, and weighing 14±2g. Prior to the animal experiments, this study had been approved by the Animal Use and Welfare Committee of Hunan Cancer Hospital. The experimental animals underwent quality testing, and those meeting the experimental standards were transferred to a specific pathogen-free (SPF) barrier environment at the Animal Department of Hunan Cancer Hospital for rearing.
[0031] The primers for the SLC37A4-Exon7 cleavage isomer of this invention are designed differently from the primer sequences for the wild-type isomer SLC37A4-WT. The primers are designed based on exons 6 and 8 flanking exon 7, and are designed online on the Primer 5.0 website. The final primer synthesis was commissioned to Shanghai Sangon Biotech Co., Ltd.
[0032] (1) SLC37A4-Exon7 primers
[0033] Upstream primer: 5'- GACTGTCCAACTACGGGAACCCT-3', see SEQ ID NO. 2.
[0034] Downstream primer: 5'- GAGGGGCACTCTCGTTGGCTAT-3', see SEQ ID NO. 3.
[0035] (2) GAPDH primers
[0036] Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', see SEQ ID NO. 4.
[0037] Downstream primer: 5'- GGCTGTTGTCATACTTCTCATGG-3', see SEQ ID NO. 5.
[0038] All experimental results in this invention were analyzed using statistical methods: t-tests were used to evaluate differences between two groups. p < 0.05 was used to indicate statistical significance, and all p-values were performed using two-tailed tests. Statistical analysis was conducted using Graphpad 9.0 software.
[0039] Example 1: Expression of SLC37A4-Exon7 cleavage isomer in oral cancer tissue
[0040] 1. Following standard sample collection protocols, we collected tumor tissue samples and paired adjacent normal tissue samples from 12 oral cancer patients at Hunan Cancer Hospital. All cases were newly diagnosed patients at the Department of Head and Neck Surgery, Hunan Cancer Hospital (time period: January 2022 to May 2024).
[0041] During the collection process, complete personal and clinical data were recorded, including name, gender, age, outpatient number, inpatient number, pathological type, case stage, and HPV infection status, as detailed in the Excel spreadsheet screenshot. All samples were collected with the patient's consent, and a written agreement was signed with the patient to establish a relatively complete specimen bank.
[0042] 2. RNA extraction from oral cancer tumor tissue or normal adjacent tissue
[0043] (1) Transfer the collected tissue to a 1.5 mL enzyme-free EP tube, add 1 mL of pre-cooled Trizol lysis buffer, and then repeatedly grind the tissue in a tissue homogenizer before transferring the lysate to a 1.5 mL enzyme-free EP tube.
[0044] (2) Add 200 μL of chloroform (trichloromethane) to the EP tube, shake to mix, and let stand at room temperature for 15 min while pre-cooling the centrifuge.
[0045] (3) Once the upper layer begins to separate, place it in a centrifuge at 4 ℃ and 12000 rpm / min for 15 min;
[0046] (4) Take out the EP tube, aspirate the upper aqueous phase and add it to a new EP tube. Be careful not to aspirate the middle interface. Supernatant: RNA phase, lower layer: phenol phase, middle layer: dye.
[0047] (5) Extract again, add 100 μL of chloroform, let stand until separation begins, then place in a centrifuge. Repeat steps 3-5;
[0048] (6) Add 500 μL of pre-cooled isopropanol and mix well. Let stand at -20 ℃ for 30 min, then centrifuge at 4 ℃, 12000 rpm / min for 30 min. Discard the supernatant and let the RNA settle at the bottom of the tube.
[0049] (7) Add 1 mL of anhydrous ethanol, gently shake the centrifuge tube to resuspend the precipitate, centrifuge at 4 ℃, 10000 g / min for 5 min, discard the supernatant as much as possible, and repeat twice;
[0050] (8) Invert the precipitate and dry it at room temperature for 5-10 minutes. Do not dry it too much, otherwise it will be difficult to dissolve. Add enzyme-free water to dissolve the precipitate.
[0051] (9) Turn on the Biodrop uLITE spectrophotometer, first calibrate the instrument with 2 μL of enzyme-free water, after mixing and separating the sample to be tested, take 2 μL to detect the RNA concentration and purity and record it. Store the sample in a -80 ℃ refrigerator.
[0052] 3. cDNA preparation
[0053] (1) Perform reverse transcription reaction according to the instructions of the reverse transcription kit (Thermo Corporation). Take 0.2 mL of enzyme-free EP tube, add 2 μg of RNA volume (V) and 1 μL of primer to each well. When detecting mRNA expression level, select Oligo(dT) primer. Add water to make up to 12 μL, mix thoroughly and centrifuge briefly.
[0054] (2) Remove from water bath at 65 ℃ for 5 min and immediately place on ice;
[0055] (3) Add 4 μL of 5×Reaction Buffer, 1 μL of RiboLock RNaseInhibitor, 2 μL of dNTP Mix and 1 μL of RevertAid M-MuLV to each EP tube in sequence, for a total volume of 20 μL;
[0056] (4) After thorough mixing and flash separation, place the product into a PCR instrument and set the reverse transcription program as follows: 42 ℃ for 60 min for reverse transcription, 70 ℃ for 5 min to inactivate reverse transcriptase, and 4 ℃ to simulate an ice bath. The cDNA product can then be used directly for semi-quantitative RT-PCR reaction or stored at -20 ℃ and can be used within one week.
[0057] 4. PCR amplification
[0058]
[0059] PCR reaction program: 95℃ pre-denaturation for 5 minutes, 94℃ denaturation for 30 seconds, annealing at 65℃ for 30 seconds, extension at 72℃ for 2 minutes, for a total of 32 cycles; 72℃ for 5 minutes.
[0060] 5. DNA agarose gel electrophoresis
[0061] (1) To prepare 1% agarose gel, weigh 2g of agarose and dissolve it in 200mL of 1× TAE buffer. Place the conical flask in the microwave oven and heat it on medium heat until the liquid boils. Stop shaking the conical flask in the middle to ensure that the liquid is heated evenly. Continue heating until the liquid becomes transparent and then stop heating. Cool to 60℃ and add 0.5 μL of nucleic acid dye. Pour the 1% agarose into the gel mold, taking care to avoid the formation of air bubbles. Keep it at room temperature in the dark for about 20 minutes and wait for the gel to form.
[0062] (2) Place the gel in the electrophoresis tank. The TAE buffer should cover the gel. Add DNA loading buffer to the DNA sample. Load 10 μL of sample into each well. Add DNA marker to the first well.
[0063] (3) Connect the positive and negative electrodes correctly, set the voltage to 80 V, and the electrophoresis time is about 30 min;
[0064] (4) Gel imaging. Based on the band results captured by the gel imaging system, the bands of the SLC37A4-Exon7 splice isoform and the internal reference gene GAPDH were quantitatively analyzed by grayscale scanning using ImageJ software to determine the gene expression values. The p-value was calculated using the unpaired t-test.
[0065] 6. Results
[0066] Multiple oral cancer tissues and normal adjacent normal tissues were collected, and the expression of the SLC37A4-Exon7 splice isoform was detected using semi-quantitative RT-PCR. The results showed that SLC37A4-Exon7 was significantly highly expressed in tumor tissues compared to normal adjacent normal tissues. The expression level of SLC37A4-Exon7 in tumor tissues was approximately 10.5 times that in normal adjacent normal tissues, and the difference between the two groups was statistically significant (P<0.0001). See the attached table for further details. Figure 1 Therefore, SLC37A4-Exon7 is highly expressed in oral cancer tissues, and it may play an important biological role in the occurrence and development of oral cancer.
[0067] Further investigation was conducted on 36 pairs of cancerous and adjacent normal tissues from oral cancer patients to detect the expression of the SLC37A4-Exon7 cleavage isomer. ROC curve analysis showed that SLC37A4-Exon7 has high diagnostic value as a biomarker for oral cancer (AUC = 0.8326, sensitivity 94.44%, specificity 66.67%). Detailed results can be found in [link to results]. Figure 2 .
[0068] Example 2: The correlation between SLC37A4-Exon7 cleavage isomer and prognosis in oral cancer patients
[0069] Clinical data from 489 patients with head and neck tumors were statistically analyzed using The Cancer Genome Atlas (TCGA) database. Data included initial presentation time, treatment history, recurrence, presence of other diseases, recurrence time, and time to death. Survival time and disease status were also recorded. Survival analysis was performed on the expression of the SLC37A4-Exon7 splice isoform and its correlation with patient survival time and disease status. Significant prognostic differences were found among tumor patients with different SLC37A4-Exon7 splice isoform expression levels. Kaplan-Meier survival analysis was conducted, and the results are as follows: Figure 3 As shown, by Figure 3 It can be seen that the average survival time of tumor patients with high expression of SLC37A4-Exon7 splice isomer was significantly shorter than that of patients with low expression of SLC37A4-Exon7 splice isomer, and the difference between the two groups was statistically significant (P = 0.0495). See the results below. Figure 3 This indicates that the SLC37A4-Exon7 splice isoform is a molecular marker associated with tumor prognosis, suggesting that high expression of the SLC37A4-Exon7 splice isoform is an independent risk factor for predicting prognostic risk in cancer patients.
[0070] Example 3: Detection of the overexpression effect of SLC37A4-Exon7 cleavage isoform in oral cancer cell lines
[0071] First, we selected restriction enzyme sites and analyzed the SLC37A4-Exon7 sequence using the NEB cutter 2.0 online database. Then, we selected a suitable restriction enzyme to construct the SLC37A4-Exon7 sequence into the pcDNA3.1-Flag plasmid vector, thereby constructing the overexpression vector of SLC37A4-Exon7.
[0072] To assess the expression efficiency of the SLC37A4-Exon7 overexpression vector, we first expressed the constructed pcDNA3.1-Flag-SLC37A4-Exon7 eukaryotic overexpression vector in oral cancer cells. Healthy oral cancer cells (CAL27) were seeded into 6-well plates. When cell confluence reached 50%-70%, the endotoxin-free plasmids pcDNA3.1-Flag-SLC37A4-Exon7 eukaryotic overexpression vector and pcDNA3.1-Flag-SLC37A4-WT overexpression vector were transiently transfected into CAL27 cells using Lipofectamine 3000. Cells were then cultured for 48 hours. Cells were collected, and Western blotting was used to detect the expression levels of SLC37A4-Exon7 and SLC37A4-WT. Western blotting results showed distinct bands for both SLC37A4-Exon7 and SLC37A4-WT. (See attached image). Figure 4 This indicates that the overexpression vector of SLC37A4-Exon7 was successfully constructed.
[0073] Example 4: In vitro overexpression of SLC37A4-Exon7 promotes the clonal formation of oral cancer cells.
[0074] We first transiently transfected oral cancer cells CAL27 and SCC9 with endotoxin-free plasmids pcDNA3.1, pcDNA3.1-Flag-SLC37A4-Exon7, and pcDNA3.1-Flag-SLC37A4-WT overexpression vectors using lipofectamine 3000 for clonogenic assays to verify their effects on cell colony formation ability. The results showed that overexpression of SLC37A4-Exon7 significantly promoted the clonogenic ability of both oral cancer cell lines, while overexpression of SLC37A4-WT had no significant promoting effect. (See attached figures). Figure 5 .
[0075] Cloning experiment steps:
[0076] (1) Cell preparation: Culture the cells in cell culture medium until the logarithmic growth phase (i.e., cell density of 5 × 10⁶ cells / year). 5 -1×10 6 Wash twice with PBS ( / ml). Digest and centrifuge.
[0077] (2) Prepare cell suspension: Mix tumor cell suspension with cell culture medium and add it to a six-well or 12-well plate under clean and sterile conditions to ensure that the cells are evenly distributed and that the number of cells in each well is the same.
[0078] (3) Place the culture plate in an incubator at 37°C and incubate for about a week. Change the culture medium every 2 days during this period.
[0079] (4) Observe cell growth: After about one week, observe cell morphology under a microscope. If there are clusters of cells, it indicates clonal formation.
[0080] (5) Fixation and staining: The cells were fixed with paraformaldehyde and then stained with crystal violet solution. The number of clones was counted.
[0081] Example 5: In vitro overexpression of SLC37A4-Exon7 promotes the proliferation of oral cancer cells
[0082] We first used lipofectamine 3000 to transiently transfect oral cancer cells CAL27 and SCC9 with endotoxin-free plasmids pcDNA3.1, pcDNA3.1-Flag-SLC37A4-Exon7, and pcDNA3.1-Flag-SLC37A4-WT overexpression vectors. After culturing for 48 hours, we performed a CCK8 assay to verify its effect on cell proliferation. Based on the test results from day 1 to day 4, we found a significant difference in cell proliferation between the pcDNA3.1 empty plasmid group (NC) and the pcDNA3.1-Flag-SLC37A4-Exon7 overexpression plasmid group (SLC37A4-Exon7), while there was no significant difference in cell proliferation between the pcDNA3.1 empty plasmid group (NC) and the pcDNA3.1-Flag-SLC37A4-WT overexpression plasmid group (SLC37A4-WT). This indicates that overexpression of SLC37A4-Exon7 promotes the proliferation of oral cancer cells under in vitro culture conditions. See the results below. Figure 6 .
[0083] Example 6: In vitro overexpression of SLC37A4-Exon7 promotes the migration of oral cancer cells.
[0084] We performed Transwell migration assays on the oral cancer cell lines CAL27 and SCC9 to observe the effect of SLC37A4-Exon7 overexpression on cell migration ability. We transiently transfected CAL27 and SCC9 oral cancer cells with endotoxin-free plasmids pcDNA3.1, pcDNA3.1-Flag-SLC37A4-Exon7, and pcDNA3.1-Flag-SLC37A4-WT overexpression vectors using Lipofectamine 3000 and cultured them for 48 hours. After seeding the cells into Transwell chambers, we found that the number of cells overexpressing the SLC37A4-Exon7 plasmid was significantly higher than that in the empty vector group, while there was no significant difference between the SLC37A4-WT and NC groups. The results for both CAL27 and SCC9 cell lines showed a consistent trend. Three random images were taken and cell numbers were recorded; the data for each cell line showed significant differences, which were statistically significant. The above results indicate that overexpression of SLC37A4-Exon7 in oral cancer cell lines can promote the migration ability of oral cancer cells CAL27 and SCC9 in vitro. See the results below. Figure 7 .
[0085] Cell transwell migration assay:
[0086] (1) Cell treatment: Remove serum from the culture medium and wash with 1×PBS. Then digest and centrifuge to resuspend.
[0087] (2) Cell counting: Dilute the cells with 1×PBS to the appropriate cell density and count them using a BIO-RAD cell counter to calculate the number of cells to be placed in each chamber.
[0088] (3) Cell addition: Add cells to the Transwell chamber in the upper compartment and place the chamber into a 24-well plate containing 20% serum. Before the experiment, ensure that the number of cells in each chamber is the same. Incubation: Incubate at 37°C for 24-48 hours.
[0089] (4) Remove cells from the upper chamber: After incubation, carefully wipe away any uninvaded cells from the upper chamber with a sterile cotton swab.
[0090] (5) Fixation and staining: After removing the chamber and washing it, fix the invading cells in the upper chamber with paraformaldehyde and stain with crystal violet.
[0091] (6) Image capture and analysis: Observe the fixed and stained cells under a microscope and perform counting or image analysis to determine the extent of cell migration.
[0092] Example 7: Detection of the promoting effect of SLC37A4-Exon7 overexpression on the proliferation of oral cancer cells in a nude mouse subcutaneous xenograft model
[0093] Four-week-old nude mice were purchased from Hunan Slack Jingda Experimental Animal Co., Ltd., and divided into three groups of five mice each. CAL27 cells transfected with pcDNA3.1, pcDNA3.1-Flag-SLC37A4-Exon7, and pcDNA3.1-Flag-SLC37A4-WT in the logarithmic growth phase were collected. After trypsin digestion, the cells were centrifuged at 1000 rpm for minutes at room temperature (15–25℃), the supernatant was discarded, and the cells were washed twice with 1×PBS. The cells were then resuspended and counted. 5×10⁶ cells were collected. 6 Cells / mouse were subcutaneously inoculated into the right axilla of nude mice. The general condition and mental state of the mice were observed daily after tumor cell inoculation, and their weight was recorded. The time and size of tumor formation were recorded. The length (L), width (W), and height (H) of the tumor were measured using calipers, and the tumor volume (V) was calculated as V = 4π / 3. (L / 2 W / 2 H / 2). Growth curves of the xenografts were plotted based on tumor size. Nude mice were sacrificed after 56 days, and the xenograft tissue was removed and fixed in 10% formaldehyde. Results showed that after transfection with SLC37A4-Exon7, the growth and proliferation rate of subcutaneous xenografts in nude mice was significantly faster compared to the NC group, while there was no significant difference between the SLC37A4-WT and NC groups. (See attached figures). Figure 8 .
Claims
1. Use of a reagent for detecting expression amount of SLC37A4-Exon7 splicing isomer in preparation of a preparation for diagnosing oral cancer, wherein the SLC37A4-Exon7 splicing isomer has a sequence as shown in SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The reagent for detecting expression amount of SLC37A4-Exon7 splicing isomer comprises a PCR detection reagent.
3. Use according to claim 2, characterized in that, The PCR detection reagent comprises primers, wherein the primers are as follows: an upstream primer: 5'-GACTGTCCAACTACGGGAACCCT-3', and a downstream primer: 5'-GAGGGGCACTCTCGTTGGCTAT-3'.
4. Use according to claim 2, characterized in that, The PCR detection reagent further comprises GAPDH reference primers, wherein the GAPDH reference primers are as follows: an upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', and a downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3'.