Application of serum tRFs as HBV (Hepatitis B Virus) related liver injury diagnostic marker

Abstract

The invention relates to the technical field of biological molecular diagnosis of hepatitis B related diseases, and particularly discloses a group of HBV related liver injury diagnostic markers and application thereof. According to the serum exosomes tRF-Val-TAC, tRF-Lys-CTT and tRF-Lys-TTT provided by the invention, the tRFs marker is tRFs combined detection of any one or combination of the sequences, and has the index advantages of high AUC value, high sensitivity and strong specificity; the method can solve the problem of difficulty in early and accurate diagnosis of hepatitis B-related chronic plus acute liver failure (HBV-ACLF) caused by pure dependence on traditional biochemical and blood coagulation indexes, and can meet various diagnosis requirements of ACLF, chronic hepatitis B and cirrhosis.

Description

Technical Field

[0001] This invention relates to the field of diagnosis of hepatitis B-related diseases, and more specifically, to a group of serum tRFs as diagnostic biomarkers for HBV-related liver injury and their applications. Background Technology

[0002] Hepatitis B virus-associated acute-on-chronic liver failure (HBV-ACLF) is an end-stage liver disease in patients with chronic hepatitis B (CHB), characterized by high mortality and severe life-threatening complications. HBV-ACLF has a rapid onset and complex course, and its early diagnosis faces significant challenges due to the lack of specific clinical symptoms and reliable biomarkers. Current diagnosis primarily relies on liver function tests, including elevated serum bilirubin, prolonged prothrombin time (PT), elevated international normalized ratio (INR), and decreased albumin levels. However, these traditional indicators lack sensitivity for early ACLF, often leading to diagnosis only at a later stage of disease progression.

[0003] tRNA-derived small RNAs (tsRNAs) are generated by cleavage at specific sites on transfer RNA (tRNA) or its precursor (pre-tRNA), and can be further divided into various subtypes such as tRNA-derived fragments (tRFs) and tRNA half-molecules. Notably, the expression levels of tsRNAs are not correlated with their source tRNA, indicating that they are not random degradation products of tRNA, but rather small non-coding RNAs generated under precise regulation. Furthermore, studies have confirmed that tRFs participate in regulating multiple stages of gene expression, including transcription, translation, and RNA processing and maturation, and are also closely related to key functions such as cellular self-renewal, differentiation, and proliferation.

[0004] In the field of disease diagnosis, one of the main advantages of tRFs as biomarkers lies in their extremely high stability in bodily fluids, making them an ideal choice for non-invasive diagnosis of liver diseases. Currently, research on tRFs mainly focuses on tumorigenesis and the genetic metabolism of sperm. However, the role of tRFs in HBV-related liver injury, especially in HBV-ACLF, remains largely unexplored. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of at least one of the above-mentioned prior art and provide a set of serum tRFs as diagnostic biomarkers for HBV-related liver injury. This tRFs combination can serve as a novel diagnostic biomarker, solving the problem of difficulty in early and accurate diagnosis of ACLF caused by relying solely on traditional biochemical and coagulation indicators, and meeting various diagnostic needs including ACLF, chronic hepatitis B, and cirrhosis.

[0006] The technical solution adopted in this invention is to provide reagents for quantitative detection of biomarkers tRFs in the preparation of diagnostic products for HBV-related liver injury. The biomarkers tRFs include tRF-Val-TAC, tRF-Lys-CTT, and / or tRF-Lys-TTT, with the following sequences: tRF-Val-TAC:CTTAACTTGACCGCTCTGACCA; tRF-Lys-CTT:AGTCGGTAGAGCATG; tRF-Lys-TTT:AGTCGGTAGAGCATGAGA.

[0007] Furthermore, the HBV-related liver injury includes hepatitis B-related acute-on-chronic liver failure, chronic hepatitis B, and / or cirrhosis.

[0008] In one or more embodiments of the present invention, tRFs associated with HBV-ACLF were identified using tRF sequencing technology, differentially expressed tRFs were validated in independent cohorts, and three tRFs (tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT) were screened using a LASSO model. The application value of these biomarkers for the diagnosis of ACLF was evaluated by the area under the curve (AUC) of receiver operating characteristic (ROC) curve analysis. The results showed that the three tRFs, tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT, were specifically upregulated in the serum of patients with acute-on-chronic liver failure (ACLF). Each of these three tRFs had excellent diagnostic performance for the three types of HBV-related liver injury (chronic hepatitis B, cirrhosis, and ACLF), and the combined application of these three tRFs showed even higher diagnostic efficacy for the three types of HBV-related liver injury.

[0009] Furthermore, the biomarkers tRFs are located in serum, and a single peripheral blood sample does not exceed 5 mL.

[0010] Further, the reagents for quantitatively detecting the biomarker tRFs include at least one of the following primers: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, the sequences of which are shown in Seq NO. 4~12. Of the above primers, the first six primers are the forward and reverse primers for three tRFs, cel-miR-39-3p-RT and cel-miR-39-3p-qFw are the forward and reverse primers for the tRFs expression level reference cel-miR-39, and universal-tRF-qRe is a universal reverse primer.

[0011] Furthermore, the expression level of tRFs is calculated using the ΔΔCt relative quantification method. The ΔΔCt relative quantification method is a relative quantification method based on quantitative real-time PCR (qPCR). It does not require standards, only internal reference genes, simplifying the experimental procedure and making it easy to operate.

[0012] Furthermore, the expression levels of the biomarkers tRFs were upregulated. The expression levels of tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT were all upregulated. In one or more embodiments of the present invention, it was demonstrated that the combination of biomarkers tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT was upregulated in patients with hepatitis B-related acute-on-chronic liver failure, chronic hepatitis B, and cirrhosis.

[0013] Another object of the present invention is to provide a diagnostic product comprising at least one of the following primers: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, wherein the sequences of the primers are shown in Seq NO. 4~12.

[0014] Another object of the present invention is to provide a kit comprising at least one of the following primers: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, wherein the sequences of the primers are shown in Seq NO. 4~12.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention, through high-throughput tRF sequencing combined with qRT-PCR validation, identifies for the first time a group of differentially expressed tRFs in the serum of ACLF patients, and for the first time demonstrates that serum tRFs can serve as biomarkers for the early diagnosis of ACLF. The combined detection of tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT shows excellent diagnostic value for hepatitis B-related liver injury, especially ACLF, with high AUC values ​​and excellent sensitivity and specificity, fully demonstrating the clinical application value of this tRF characteristic combination as a diagnostic tool. The identified tRF characteristic spectrum can provide support for early diagnosis and triage of patients, thereby enabling the development of more personalized and timely treatment plans. Attached Figure Description

[0016] Figure 1 This is a diagram illustrating the admission process and workflow for test subjects.

[0017] Figure 2 To discover the profiling of serum tRFs in the cohort: A. The sample included 3 healthy controls (labeled N), 6 patients with chronic hepatitis B virus infection (labeled H), and 7 patients with HBV-ACLF (labeled L), used for serum tRF-seq detection, referred to as the discovery cohort. B. The procedure for collecting serum RNA from the patients' blood. C. Association analysis of 16 tRF-seq results among individuals. D. A heatmap showing differentially expressed tRFs among the N, H, and L groups. E. Association heatmaps and Venn diagrams showing significantly differentially expressed tRFs between the H and N groups, and between the L and N groups.

[0018] Figure 3To validate differentially expressed tsRNAs based on a validation cohort. A. The sample included 25 healthy controls (labeled N), 29 patients with chronic hepatitis B infection without cirrhosis (labeled H), 25 patients with chronic hepatitis B infection with cirrhosis (labeled C), and 30 patients with hepatitis B virus-associated acute-on-chronic liver failure (labeled L), for a total validation cohort (n=109). B. tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT were detected and analyzed in the four groups of samples by RT-qPCR (group B: tRF-Val-TAC; group C: tRF-Lys-CTT; group D: tRF-Lys-TTT). Data are expressed as mean ± standard error. *P<0.05, **P<0.01, ***P<0.001, ****P<0.001, ns indicates no statistically significant difference.

[0019] Figure 4 ROC curves for tRFs used to distinguish between cases and healthy controls. Comparison of ROC curves for the three validation cohorts (A, C, and D): (A) Single tRFs distinguishing between chronic hepatitis B (CHB), (B) cirrhosis cases, and (C) acute-on-chronic liver failure (ACLF) cases and healthy controls; different colored lines correspond to different analysis methods—yellow line for tRF-Val-TAC, blue line for tRF-Lys-CTT, and green line for tRF-Lys-TTT. Results of combined tRF analysis in group DF: (D) Comparison of ROC curves for chronic hepatitis B (CHB), (E) cirrhosis cases, and (F) ACLF cases with healthy controls. Detailed Implementation

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0022] The present invention will now be further illustrated with specific examples. The following embodiments are only for explaining the present invention and do not constitute a limitation thereof. The test samples and test procedures used in the following embodiments include the following (if the specific experimental conditions are not specified in the embodiments, they are understood according to conventional conditions or the conditions recommended by the reagent company; unless otherwise specified, the reagents, consumables, etc. used in the following embodiments can be obtained from commercial sources).

[0023] 1. Research subjects This study was conducted at the Third Affiliated Hospital of Sun Yat-sen University from April 2023 to July 2024, enrolling a total of 125 participants. The discovery cohort (n=16) included healthy controls (n=3), patients diagnosed with chronic hepatitis B (CHB) (n=6, including 3 with cirrhosis and 3 without cirrhosis), and patients with HBV-related acute-on-chronic liver failure (HBV-ACLF) (n=7). The validation cohort (n=109) consisted of healthy controls (n=25), patients with chronic hepatitis B (n=29), patients with HBV-related cirrhosis (n=25), and patients with HBV-ACLF (n=30). All participants, except the healthy controls, were admitted to the hospital due to HBsAg positivity for more than 6 months.

[0024] The inclusion criteria for studies on HBV-related cirrhosis patients specifically include: histopathological evidence of cirrhosis confirmed by liver biopsy, i.e., a METAVIR score of F4 or an Ishak score ≥5; clinical and imaging manifestations of cirrhosis, such as nodular liver surface, splenomegaly, or portal hypertension, which can be confirmed by indicators such as varicose veins, ascites, or thrombocytopenia; and non-invasive liver fibrosis assessment results, such as a liver stiffness of ≥12.5 kPa measured by FibroScan or equivalent methods. The diagnosis of HBV-related acute-on-chronic liver failure (HBV-ACLF) is based on the Australian Association for the Study of the Liver (APASL) 2019 guidelines, which require meeting the following criteria: international normalized ratio (INR) >1.5, total bilirubin exceeding the upper limit of normal by more than 5 times, and the presence of hepatic encephalopathy or ascites within the past two weeks. All patients had to be excluded from co-infection with hepatitis C virus (HCV), hepatitis D virus (HDV), or human immunodeficiency virus (HIV), and had no evidence of other chronic liver diseases (such as alcoholic liver disease, non-alcoholic steatohepatitis, autoimmune hepatitis, or Wilson's disease). In addition, this study included healthy subjects recruited from the Staff Health Examination Center of the Third Affiliated Hospital of Sun Yat-sen University. The workflow of this study is as follows: Figure 1 As shown.

[0025] 2. Serum collection and RNA isolation Blood samples were collected from the subjects and the serum was separated by centrifugation at 3000g for 15 minutes. The serum was then centrifuged at 2000g for 20 minutes to remove cell debris and other contaminants. The serum samples were then stored at -80℃.

[0026] Total RNA was isolated from serum using Trizol reagent. Specifically, 250 μL of serum was mixed with 750 μL of Trizol and incubated at room temperature for 5 minutes. Then, 200 μL of chloroform was added and the mixture was shaken, and incubated for another 3 minutes. The sample was centrifuged at 12,000 × g for 15 minutes at 4 °C to separate the phases. After transferring the aqueous phase, isopropanol was added, and the mixture was allowed to stand at room temperature for 10 minutes to precipitate RNA. The precipitate was then centrifuged at 12,000 × g for 10 minutes at 4 °C. The RNA precipitate was washed with 75% ethanol, air-dried, and dissolved in RNase-free water. RNA concentration and purity were determined spectrophotometrically (A260 / A280 ratio of 1.8–2.0 indicates high quality), and RNA integrity was verified by agarose gel electrophoresis or a bioanalyzer.

[0027] 3. High-throughput sequencing of serum tRFs The small RNA sequencing workflow focuses on tRNA-derived fragments (tRFs) and tRNA half-molecules (tiRNAs), therefore, a carefully designed experimental protocol was implemented to ensure data quality. First, total RNA was extracted from serum samples, and its quality and purity were assessed using agarose gel electrophoresis and a Nanodrop™ instrument. Samples with total RNA content between 1-2 µg and an A260 / A280 ratio between 1.8-2.0 were selected for further processing. To address the challenges posed by RNA modification, a series of pretreatment steps were implemented: deacylation of the 3'-aminoacyl group to generate a 3'-hydroxyl terminus; removal of 3'-cP (2', 3' cyclic phosphate) to ensure 3'-linker ligation; phosphorylation of the 5'-hydroxyl group for 5'-linker ligation; and demethylation of m1A and m3C to promote efficient reverse transcription.

[0028] Sequencing libraries were prepared by screening target RNA biotypes by size using an automated gel cutter. The quality and absolute concentration of the libraries were validated using an Agilent BioAnalyzer 2100 system.

[0029] Sequencing experiments were performed on the Illumina NextSeq platform, generating 50 bp single-end reads. Annotation of the raw tsRNA sequencing data was performed using SPORTS software (version 1.1), allowing for one base mismatch. To ensure comprehensive analysis, we manually corrected the mature tRNA and pre-tRNA sequences—cytoplasmic tRNA sequences were obtained from the GtRNAdb database, and mitochondrial tRNA sequences were predicted using tRNAscan SE software. The construction process for the mature tRNA library involved removing intron sequences and adding a 3' "CCA" tail; the pre-tRNA library contained 40 nt flanking sequences on each side of the tRNA sequence. For differentially expressed genes, we used the heatmap function in R to generate heatmaps. To address the high dimensionality of RNA sequencing data, a Lasso logistic regression model was used to screen candidate tRFs for validation, and a Lasso multinomial logistic regression model was constructed using the glmnet package to select independent variables.

[0030] 4. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) To validate the high-throughput sequencing results, we selected some differentially expressed tRFs for quantitative reverse transcription PCR (qRT-PCR) analysis. First, we synthesized miRNA first-strand cDNA using the PrimeScript RT kit (Takara, Cat# RR037A) according to the manufacturer's instructions. We then performed triple-replica experiments using TBGreen Premix ExTaq™ II (Takara, Cat# RR820A) to measure the quantitative PCR reagents. We standardized tRF expression levels using cel-miR-39 as an internal control and analyzed gene expression levels using the ΔΔCt relative quantification method. The relative expression levels of tRFs were analyzed using a 22... -ΔΔCt The primer sequences used are detailed in Table 1.

[0031] Table 1. Primer sequence listing

[0032] 5. Diagnostic performance evaluation To evaluate the diagnostic efficacy of the selected tRFs, researchers analyzed the receiver operating characteristic (ROC) curves and their area under the curve (AUC). Backward stepwise logistic regression analysis was used to screen for the mature tRFs with the highest diagnostic potential. Finally, the optimal cutoff point was determined based on the Youden index, and the detection sensitivity and specificity were further evaluated at this critical value.

[0033] 6. Statistical Analysis Demographic characteristics and clinical manifestations are presented as frequencies and percentages. Continuous variables are expressed as mean ± standard deviation. Comparisons between two groups were performed using the Mann-Whitney U test and Student's t test, while comparisons among multiple groups were performed using the Kruskal-Wallis test. All statistical analyses were performed using GraphPadPrism9 (GraphPad Software, LLC) and R software (version 4.0.3). A p-value less than 0.05 was considered statistically significant.

[0034] Experiment 1 Subject Characteristic Analysis This study enrolled 125 participants, including healthy controls (n=28), CHB patients with cirrhosis stratification (no cirrhosis, n=32; with cirrhosis, n=28), and ACLF patients (n=37). The mean age of the cohort was 46.55 years, and the majority were male (93.33%). Figure 1 This is a diagram illustrating the admission process and workflow for test subjects.

[0035] Compared with the healthy control group, the white blood cell count (WBC) of ACLF patients was 6.76 × 10⁻⁶. 9 Significantly elevated levels of bilirubin (TBIL: 349.63 µmol / L), total bilirubin (TBIL: 349.63 µmol / L), and international normalized ratio (INR: 2.38), along with a significantly elevated platelet count (PLT: 99.9 × 10⁻⁶). 9 The levels of HBV-DNA (AST: 802.63 U / L; ALT: 1227 U / L) and total bilirubin (TBIL: 99.08 µmol / L) were significantly decreased. In contrast, CHB patients showed moderately elevated liver enzyme levels (AST: 802.63 U / L; ALT: 1227 U / L) and total bilirubin (TBIL: 99.08 µmol / L), while cirrhotic patients exhibited moderate liver damage with lower enzyme levels (AST: 92.64 U / L; ALT: 126.12 U / L) and total bilirubin (TBIL: 44.58 µmol / L). Notably, ACLF patients had the highest HBV-DNA levels (7.69 × 10⁻⁶). 7 The blood alcohol concentration (IU / mL) indicates that the virus is actively replicating. Furthermore, ACLF patients showed significantly prolonged prothrombin time (PT: 25.43 seconds) and decreased prothrombin activity (PTA: 34.7%). These findings suggest that ACLF patients have severe liver dysfunction and coagulation abnormalities.

[0036] Experiment 2: Differential expression analysis of serum tRFs in HBV-ACLF patients To clarify the differential expression of serum tRFs in HBV-ACLF patients, we performed sequencing analysis on the serum of 16 subjects in the cohort. This cohort included 3 healthy controls (N), 6 patients with chronic hepatitis B (CHB) (including cirrhotic patients (H) and non-cirrhotic patients (L), with the H group consisting of 3 cirrhotic patients and 3 non-cirrhotic patients), and 7 patients with HBV-related ACLF (L). Figure 2 A, B). To assess the overall correlation of RNA sequencing data from 16 different groups of samples, we used Pearson correlation analysis to perform correlation analysis on all samples from the ACLF group, CHB group, and healthy control group. Intergroup correlation heatmap ( Figure 2 The significant difference in R values ​​in the CD (Centers for Diagnostics, Cities, and Suits) reveals a substantial difference in the correlation patterns of specific variables or features among these three groups of samples.

[0037] By analyzing the intersection of differentially expressed transfer RNA fragments (tRFs) in two control groups (H vs. N; L vs. N), we screened 17 overlapping candidate genes based on the following criteria: |fold change (FC)| > 2, RPM > 1000 and P < 0.05. Figure 2 E). Subsequently, a more stringent screening criterion was adopted, namely, an absolute fold change (|FoldChange|) ≥ 4 and a p-value < 0.05, ultimately identifying 9 differentially expressed transfer RNA fragments. Analysis showed that these 9 tRFs exhibited an upregulation trend in both the H group vs. N group and the L group vs. N group.

[0038] Subsequently, based on peak nuclear matching (PKM) readings of characteristic molecules in RNA sequencing data, we screened potential candidate tRFs using a least absolute shrinkage selective logistic regression (LASSO) model. From these candidate tRFs, we ultimately selected three tRFs (tRF-Val-TAC, tRFsLys-CTT, and tRF-Lys-TTT) for further investigation.

[0039] Experiment 3: Validation of differentially expressed tsRNA This study used a validation cohort (n=109) including healthy controls (N; n=25), non-cirrhotic chronic hepatitis B patients (H; n=29), cirrhotic chronic hepatitis B patients (C; n=29), and HBV-ACLF patients (L; n=30) to assess the expression levels of three selected tRFs in independent cohorts. Figure 3 A). The results showed that, compared with the healthy control group, the expression levels of tRF-Val-TAC in the H, C, and L groups were significantly upregulated. For tRF-Lys-CTT ( Figure 3B), its expression level in groups C and L was also significantly increased compared to the healthy control group. Although an increase in expression level was also observed in patients with chronic hepatitis B who had not developed cirrhosis (group H), the difference did not reach statistical significance. Figure 3 C). For tRF-Lys-TTT molecules ( Figure 3 D), whose expression levels were significantly upregulated in groups H, C, and L. These findings are consistent with high-throughput sequencing results, indicating significant differences in the expression levels of these tRFs, potentially suggesting different roles in different disease states. However, further analysis showed that these three molecules did not exhibit statistically significant differences in group L when compared separately with groups H and C. The above evidence suggests that during the development of HBV-ACLF, changes in cellular function induced by viral infection and liver injury may affect the generation and release of the tRNA family into the bloodstream, resulting in significant differences in the expression levels of tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT at different disease stages after HBV infection.

[0040] Experiment 4: Diagnostic efficacy of serum tRFs against ACLF The diagnostic potential of these three tRFs was evaluated using ROC curve analysis. Since no significant difference in expression was observed among the tRF-Lys-CTT groups, they were excluded from subsequent ROC analysis for the diagnostic efficacy of CHB. The optimal diagnostic sensitivity and specificity thresholds were determined using the Youden index, and a logistic regression model was then used to construct a diagnostic combination incorporating the expression levels of the three tRFs. Figure 4 The AUC values ​​and their 95% confidence intervals are shown. ROC curve analysis indicates that each of the three selected tRFs has excellent diagnostic performance for HBV-related liver injury. Figure 4 AC). It is noteworthy that these tRF combinations exhibit higher diagnostic efficacy ( Figure 4 (DF). In patients with acute-on-chronic liver failure (ACLF), the combination showed an AUC of 0.929 (95% CI: 0.852–1), with a specificity of 0.8 and a sensitivity of 0.9524. Furthermore, this combination effectively differentiated patients with chronic hepatitis B (CHB) with an AUC of 0.911 (95% CI: 0.819–1), a specificity of 1, and a sensitivity of 0.7727. It also effectively differentiated patients with cirrhosis with an AUC of 0.859 (95% CI: 0.736–0.982), a specificity of 0.85, and a sensitivity of 0.8182.

[0041] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the technical solution of the present invention, and are not intended to limit the specific implementation of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the claims of the present invention should be included within the protection scope of the claims of the present invention.

Claims

1. The application of a reagent for quantitatively detecting biomarkers tRFs in the preparation of diagnostic products for HBV-related liver injury, characterized in that, The biomarkers tRFs include tRF-Val-TAC, tRF-Lys-CTT, and / or tRF-Lys-TTT, with the following sequences: tRF-Val-TAC: CTTAACTTGACCGCTCTGACCA; tRF-Lys-CTT: AGTCGGTAGAGCATG; tRF-Lys-TTT: AGTCGGTAGAGCATGAGA.

2. The application according to claim 1, characterized in that, The HBV-related liver injury includes hepatitis B-related acute-on-chronic liver failure, chronic hepatitis B, and / or cirrhosis.

3. The application according to claim 1, characterized in that, The biomarkers tRFs are located in serum, and a single peripheral blood sample does not exceed 5 mL.

4. The application according to claim 1, characterized in that, The reagents for quantitatively detecting the biomarker tRFs include at least one of the following primers: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, the sequences of which are shown in Seq NO. 4~12.

5. The application according to claim 1, characterized in that, The expression level of tRFs was calculated using the ΔΔCt relative quantification method.

6. The application according to claim 1, characterized in that, The expression level of the marker tRFs was upregulated.

7. The application according to claim 6, characterized in that, The expression levels of tRF-Val-TAC, tRF-Lys-CTT, and tRF-Lys-TTT were all upregulated.

8. A diagnostic product, characterized in that, The primers include at least one of the following: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, the sequences of which are shown in Seq NO.4~12.

9. A reagent kit, characterized in that, The primers include at least one of the following: tRF-Val-TAC-RT, tRF-Val-TAC-qFw, tRF-Lys-CTT-RT, tRF-Lys-CTT-qFw, tRF-Lys-TTT-RT, tRF-Lys-TTT-qFw, cel-miR-39-3p-RT, cel-miR-39-3p-qFw, and universal-tRF-qRe, the sequences of which are shown in Seq NO. 4~12.

10. The application of the kit according to claim 9 in regulating tRFs-related signaling pathways.

Images