A SNP molecular marker locus linked to the quantitative trait of epicatechin content in fresh tea leaves and its application

Abstract

The present invention discloses a SNP molecular marker site linked to the quantitative trait of epicatechin content in fresh leaves of tea trees and its application. The genotype of the SNP site located at Chr07:121313741 is detected. The genotype is significantly correlated with the epicatechin content. The epicatechin content in fresh leaves corresponding to the CC genotype is significantly different from that of the TT and TC types. Statistically speaking, when the genotype is TT or TC, it is highly likely that the epicatechin content in fresh leaves of tea trees is low; when the genotype is CC, it is highly likely that the epicatechin content in fresh leaves of tea trees is high. A kit for evaluating the epicatechin content in fresh leaves of tea trees is further established. The method and kit of the present invention can be used for tea tree resource screening and molecular breeding, which is the basis for carrying out molecular marker-assisted selection breeding of tea trees.

Description

Technical Field

[0001] The present invention relates to the technical field of tea tree molecular breeding, and more specifically, to a SNP molecular marker site linked to a quantitative trait of epicatechin content in fresh tea leaves and an application thereof. Background Art

[0002] Tea (Camellia sinensis (L.) O. Kuntze) belongs to the Camellia family, the tea group, and originated in southwest China, with a cultivation history of more than 5,000 years. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, with important economic value and a significant impact on society and culture.

[0003] The characteristic secondary metabolites of tea shoots, catechins, are the main factors affecting the taste of tea. The chemical structure of epicatechin includes two benzene rings and a trihydroxyphenyl group. Its chemical formula is C 15 H 14 O6. Epicatechin is widely present in tea plants, especially in green tea.

[0004] Epicatechin has multiple biological activities: epicatechin is a powerful antioxidant that can neutralize free radicals and reduce damage to cells caused by oxidative stress. Its antioxidant effect helps protect the body from diseases such as inflammation, cardiovascular disease, and certain cancers. Epicatechin has certain anti-inflammatory properties that can reduce inflammatory responses and tissue damage, which has a positive effect on alleviating chronic inflammatory diseases and related health problems. In addition, some studies have shown that epicatechin has a certain effect on blood sugar regulation. It can help lower blood sugar levels, improve insulin sensitivity, and help prevent and manage diabetes.

[0005] At present, tea tree breeding is mainly carried out through conventional methods, which selects excellent individual plants from wild populations and hybrid offspring for systematic breeding. This method is time-consuming and inefficient, resulting in slow replacement of new varieties and failure to quickly meet the public's demand for new products. Molecular marker-assisted breeding can significantly improve breeding efficiency because it can select breeding materials at the seedling stage. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a SNP molecular marker site linked to the quantitative trait of epicatechin content in fresh tea leaves and its application.

[0007] The first object of the present invention is to provide a method for evaluating the epicatechin content in fresh tea leaves.

[0008] The second object of the present invention is to provide a kit for evaluating the epicatechin content in fresh tea leaves.

[0009] The third object of the present invention is to provide a reagent for detecting the genotype of the SNP site located at Chr07:121313741 of the tea plant genome for use in establishing a method for evaluating the epicatechin content in fresh tea leaves.

[0010] The fourth object of the present invention is to provide a method for detecting the genotype of a SNP site located at Chr07:121313741 in the tea plant genome in the preparation of a kit for evaluating the epicatechin content in fresh tea leaves.

[0011] The fifth object of the present invention is to provide the use of the method, the kit, or any of the reagents described therein in molecular breeding of tea plants.

[0012] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0013] A method for evaluating the epicatechin content in fresh tea leaves, detecting the genotype of a SNP site located at Chr07:121313741 in the tea genome, wherein the epicatechin content level in fresh leaves of tea individuals with a genotype of TT or TC is likely to be lower than that of individuals with a genotype of CC, and the tea genome is a Tieguanyin genome.

[0014] That is, the SNP site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO:1.

[0015] Preferably, primers with nucleotide sequences such as SEQ ID NOs: 2-3 are used for detection.

[0016] As a specific embodiment, the method comprises the following steps:

[0017] (1) Extracting tea plant genomic DNA and ensuring that the A260 / A280 of each DNA sample is between 1.8 and 2.0 and the concentration is greater than 100 μg / μL;

[0018] (2) PCR amplification

[0019] The PCR system (10 μl) is as follows:

[0020] 2×Taq PCR Master Mix 5μl Primers 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0021] The PCR amplification procedure is as follows:

[0022]

[0023] (3) Product purification

[0024] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified.

[0025] (4) Sequencing and result interpretation

[0026] The recovered and purified products were sequenced by Sanger sequencing. At the Chr07:121313741 site, when the genotype was CC, the epicatechin content in the fresh leaves of the tea plant was more likely to be higher than the normal average level in individuals with the genotype of TT or TC.

[0027] The present invention also claims a kit for evaluating the epicatechin content in fresh tea leaves, which contains a reagent for detecting the genotype of the SNP site located at Chr07:121313741.

[0028] Preferably, the reagent is a primer with a nucleotide sequence as described in SEQ ID NO: 2-3.

[0029] More preferably, it also contains a PCR amplification reagent.

[0030] As a specific example, primers containing nucleotide sequences as shown in SEQ ID NO: 2-3, 2×TaqPCR Master Mix, and ddH2O are used in the same manner as above.

[0031] The present invention also claims a use of a reagent for detecting the genotype of a SNP site located at Chr07:121313741 of a tea plant genome in establishing a method for evaluating the epicatechin content in fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0032] And, an application of a kit for detecting the genotype of a SNP site located at Chr07:121313741 of a tea plant genome in preparing a kit for evaluating the epicatechin content in fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0033] Preferably, the epicatechin content level in the fresh leaves of tea plant individuals whose genotype at the SNP site is TT or TC is likely to be lower than that of individuals whose genotype is CC.

[0034] Preferably, the reagent is a primer with a nucleotide sequence as described in SEQ ID NO: 2-3.

[0035] The use of the method, the kit, or the reagent in molecular breeding of tea trees, wherein the molecular breeding of tea trees is molecular breeding of epicatechin content in fresh leaves of tea trees, also falls within the protection scope of the present invention.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention discovered a SNP molecular marker site linked to the quantitative trait of epicatechin content in fresh leaves of tea trees, which is located on the tea tree genome Chr07: 121313741. Its genotype is significantly correlated with the epicatechin content, and the epicatechin content in fresh leaves corresponding to the CC genotype is significantly different from that of the TT and TC types. Statistically speaking, when the genotype is wild-type TT or single mutation TC, it is highly likely that the epicatechin content in fresh leaves of tea trees is low; when the genotype is double mutation CC, it is highly likely that the epicatechin content in fresh leaves of tea trees is high. Further establishment of a detection method for detecting this site can be used to evaluate the epicatechin content in fresh leaves of tea trees, so as to be further used in tea tree resource screening and molecular breeding. This is the basis for carrying out molecular marker-assisted selection breeding of tea trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Epicatechin content in 300 individuals from all populations was analyzed for genome-wide association study.

[0039] Figure 2 Schematic diagram of Chr07:121313741 site and primers. N (highlighted with a yellow background) represents the base to be tested at the Chr07:121313741 position, and the bold and underlined parts are the upstream and downstream primers.

[0040] Figure 3 In the association analysis population, the Chr07:121313741 genotype was significantly correlated with the content of secondary metabolites. Statistically speaking, when the genotype is wild-type TT or single mutation TC, the epicatechin content in the fresh leaves of the tea tree is likely to be low; when it is double mutation CC, the epicatechin content in the fresh leaves of the tea tree is likely to be high.

[0041] Figure 4 In the test population, the Chr07:121313741 genotype was also significantly correlated with the content of secondary metabolites. Statistically, when the genotype was wild-type TT or single mutation TC, the epicatechin content in the fresh leaves of the tea tree was likely to be low; when the genotype was double mutation CC, the epicatechin content in the fresh leaves of the tea tree was likely to be high. DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0043] Example 1 Determination of epicatechin content in fresh tea leaves

[0044] 1. Experimental Sample

[0045] 300 tea tree materials were collected from the Tea Germplasm Resource Bank of the Tea Research Institute of Fujian Academy of Agricultural Sciences (Fu'an, Fujian, 27°N, 119°E), including 139 from Fujian, 36 from Zhejiang, 21 from Guizhou, 18 from Guangxi, 18 from Guangdong, 14 from Yunnan, 10 from Hunan, 9 from Anhui, 7 from Sichuan, 4 from Hubei, 3 from Taiwan, 2 from Shandong, 2 from Jiangxi, 2 from Chongqing, 1 from Shaanxi, 1 from Jiangsu, and 1 from Gansu. In addition, there were 5 from Vietnam, 2 from Myanmar, 1 from Sri Lanka, 1 from Kenya, 1 from Japan, 1 from India, and 1 from Georgia. The selected materials are widely representative.

[0046] The selected resources are randomly distributed in the resource library. Double-row single-plant planting is adopted, with 4 meters per row, 1.5M row spacing, and 35CM plant spacing. The resource library carries out routine water and fertilizer management. At the end of 2022, the resources are pruned and deep pit basal fertilizer is applied, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 kilograms of compound fertilizer per mu. After the spring tea and summer tea in 2023, pruning and topdressing outside the roots are carried out, 30 kilograms of compound fertilizer and 60 kilograms of urea per mu. In May 2023, one bud and two leaves of the new shoots of the tea tree are picked for the determination of epicatechin content.

[0047] 2. Experimental Methods

[0048] The content of epicatechin in fresh tea leaves was detected by high performance liquid chromatography, referring to the method described in YU, X.ETAL. METABOLITE SIGNATURES OF DIVERSE CAMELLIA SINENSISTEA POPULATIONS. NATCOMMUN 11, 5586 (2020).

[0049] 3. Experimental Results

[0050] The epicatechin content is shown in Table 1. The variation of epicatechin content in the population is shown in Figure 1 .

[0051] Table 1 Results of relative content determination of epicatechin in 300 germplasms

[0052]

[0053]

[0054]

[0055]

[0056] Example 2 Correlation analysis between tea plant genotype and epicatechin content in fresh leaves

[0057] 1. Experimental Sample

[0058] The CTAB method was used to extract the total DNA of tender shoots of each human sample of the 300 tea tree resources in Example 1, and it was ensured that the A260 / A280 of each DNA sample was between 1.8 and 2.0, and the concentration was greater than 100 μg / μL.

[0059] The extracted DNA samples were used to construct a sequencing library with a fragment length of 500bp, and double-end 150bp sequencing was performed using the DNBSEQ-T7 platform. The sequenced reads were aligned to the "Tieguanyin" CSS cultivated tea tree genome (http: / / tpia.teaplants.cn / ; Tieguanyin, TGY, PMID: 34267370) using bwa software. The whole-genome single nucleotide variations (SNPs) of 300 germplasms were detected using GATK (https: / / github.com / broadinstitute / gatk), and genome-wide association analysis (GWAS) of whole-genome SNPs and shape was performed using rMVP.

[0060] Among them, the genome of the "Tieguanyin" CSS cultivated tea tree is http: / / tpia.teaplants.cn / web / Download / Genomic_data / Tieguanyin.genome.fas.tar.gz.

[0061] 2. Experimental Results

[0062] The significance level of the association was determined by the P value. It was found that the P value of the genotype of the SNP locus located at Chr07:121313741 and the epicatechin content was 2.81E-13, which was much less than 1.0E-06, indicating that the locus was significantly associated with the epicatechin content. Among the 300 samples, only 295 had clear typing, and the genotypes of the other 5 samples were unknown. Figure 3 As shown, from a statistical point of view, when the sample genotype is CC, the content of epicatechin metabolites in the fresh leaves of the tea plant is more likely to be higher than the normal average level of samples with the genotype of TT or TC.

[0063] Example 3 Association analysis between the SNP site of Chr07:121313741 and the epicatechin content in fresh leaves

[0064] 1. Experimental Sample

[0065] A group of 92 tea tree resources, including 10 germplasms from Jiangbei tea industry area, 25 germplasms from Jiangnan tea industry area, 25 germplasms from South China tea industry area, 30 germplasms from Southwest tea industry area, and 2 foreign germplasms. All germplasms were uniformly planted at the Tea Research Institute of Guangdong Academy of Agricultural Sciences to detect the genotype of the SNP site located at Chr07:121313741 and the epicatechin content in fresh tea leaves, and conduct correlation analysis.

[0066] 2. Experimental Methods

[0067] 1. Detect the epicatechin content of 92 tea tree resources according to the method of Example 1

[0068] 2. The genotype of the SNP site Chr07:121313741 of each sample was detected using the Sanger sequencing technology platform.

[0069] (1) Primer design

[0070] Primers were designed and synthesized based on the location of Chr07:121313741 in the genome. Among them, Chr07:121313741 extended 200 bp upstream and 150 bp downstream. Its nucleotide sequence is shown in SEQ ID NO:1 ( Figure 2 , where N represents the base to be tested at position Chr07:121313741).

[0071] F: TTAGAAAATCTAGCATCACTGTTTCG (SEQ ID NO: 2);

[0072] R: AAGATTTGACAGCGTGCTCA (SEQ ID NO: 3).

[0073] (2) PCR amplification

[0074] The PCR system (10 μl) is as follows:

[0075] 2×Taq PCR Master Mix 5μl PrimerMix (matched according to amplification conditions) 1μl DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0076] The PCR amplification procedure is as follows:

[0077]

[0078] (3) Gel electrophoresis verification and extraction of PCR products

[0079] The PCR amplification products are analyzed by gel electrophoresis to confirm whether the target fragment is successfully amplified. The size of the PCR product is determined by comparison with molecular weight markers. The PCR product is extracted from the gel for subsequent Sanger sequencing.

[0080] (4) Sanger sequencing

[0081] The PCR product was sequenced using Sanger sequencing technology, and the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 were used for bidirectional sequencing to increase the accuracy of sequencing.

[0082] 3. Experimental Results

[0083] The epicatechin content of each sample and the genotype of the SNP site of Chr07:121313741 are shown in Table 2.

[0084] Table 2 Relative content of epicatechin in resources in the validation population (Log10 treatment) and genotype:

[0085]

[0086]

[0087]

[0088] As Figure 4 The results of significance analysis showed that the genotype of Chr07:121313741 was extremely significantly correlated with the epicatechin content. Statistically, when the sample genotype was double mutation CC, the genotype with a high probability of the epicatechin metabolite content in the fresh leaves of the tea tree being higher than the normal average level was the wild type TT or single mutation TC sample. This result is consistent with the result of Example 1, indicating that Chr07:121313741 can be used to evaluate the epicatechin content of tea trees, and further used for high epicatechin tea tree resource screening and molecular breeding, which has great research value.

[0089] Example 4 A method for evaluating the epicatechin content of tea plants

[0090] (1) The total DNA of tea plant buds was extracted using the CTAB method, and the A260 / A280 of each DNA sample was ensured to be between 1.8 and 2.0, and the concentration was greater than 100 μg / μL;

[0091] (2) PCR amplification

[0092] The PCR system (10 μl) is as follows:

[0093] 2×Taq PCR Master Mix 5μl Primer (SEQ ID NO: 2-3) 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0094] The PCR amplification procedure is as follows:

[0095]

[0096] (3) Product purification

[0097] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified using a commercially available gel electrophoresis DNA recovery kit.

[0098] (4) Sequencing and result interpretation

[0099] The recovered purified product was sent to a sequencing company for Sanger sequencing, and the sequencing result was compared with the nucleotide sequence shown in SEQ ID NO: 1. Figure 2 As shown in the figure (the bold and underlined parts are the upstream and downstream primers, and N represents the base to be tested at the position of Chr07: 121313741), the Chr07: 121313741 site is located at the 132nd base of the amplified product. Statistically speaking, when the genotype is TT or TC, the epicatechin content in the fresh leaves of the tea tree is likely to be low; when the genotype is CC, the epicatechin content in the fresh leaves of the tea tree is likely to be high.

[0100] Example 5 A kit for evaluating the epicatechin content of tea trees

[0101] 1. Composition

[0102] Primers with nucleotide sequences as shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, and ddH2O.

[0103] Among them, primer F: TTAGAAATATCTAGCATCACTGTTTCG (SEQ ID NO: 2);

[0104] Primer R: AAGCATTTGACAGCGTGCTCA (SEQ ID NO: 3).

[0105] 2. Usage

[0106] Same as Example 4.

Claims

1. A method for evaluating the epicatechin content in fresh tea leaves, characterized in that: The genotype of a SNP site in the tea tree genome is detected, wherein the SNP site is located at the 200th base of the nucleotide sequence as shown in SEQ ID NO: 1, and the epicatechin content level in the fresh leaves of tea tree individuals with a genotype of TT or TC is likely to be lower than that of individuals with a genotype of CC, and the tea tree genome is the Tieguanyin genome.

2. The method according to claim 1, characterized in that The detection was performed using primers having nucleotide sequences as shown in SEQ ID NOs: 2-3.

3. Use of a reagent for detecting the genotype of a SNP site in a tea plant genome in establishing a method for evaluating the epicatechin content in fresh tea leaves, characterized in that: The tea tree genome is the Tieguanyin genome, the SNP site is located at the 200th base of the nucleotide sequence as shown in SEQ ID NO: 1, and the epicatechin content level in the fresh leaves of tea tree individuals with a genotype of TT or TC at the SNP site is likely to be lower than that of individuals with a genotype of CC.

4. Use of a reagent for detecting the genotype of a SNP site in a tea plant genome in the preparation of a kit for evaluating the epicatechin content in fresh tea leaves, characterized in that: The tea tree genome is the Tieguanyin genome, the SNP site is located at the 200th base of the nucleotide sequence as shown in SEQ ID NO: 1, and the epicatechin content level in the fresh leaves of tea tree individuals with a genotype of TT or TC at the SNP site is likely to be lower than that of individuals with a genotype of CC.

5. The use according to claim 3 or 4, characterized in that: The reagent is a primer whose nucleotide sequence is shown in SEQ ID NO: 2-3.

6. Application of the method according to claim 1 or 2 in tea plant molecular breeding, characterized in that: The tea tree molecular breeding is the molecular breeding of epicatechin content in fresh tea leaves.

7. Use of the reagent according to claim 3 or 4 in tea plant molecular breeding, characterized in that: The tea tree molecular breeding is the molecular breeding of epicatechin content in fresh tea leaves.

Images