A strain of Pediococcus acidilactici MY8 and its application in the preparation of sleep-aiding and whitening food and medicine

Abstract

The present invention belongs to the field of probiotics and their application technology, and specifically relates to a strain of Pediococcus acidilactici MY8 and its application in the preparation of sleep-aiding and whitening food and medicine. The present invention separates and purifies a strain of Pediococcus acidilactici MY8 from a fecal sample of a healthy adult in Guangdong, China, and the strain has excellent protease activity and cellulase activity, can produce and secrete 3-hydroxybutyric acid, γ-aminobutyric acid and hyaluronic acid, can inhibit α-glucosidase activity, can remove DPPH free radicals, and thus can promote the digestion and absorption of protein food, improve protein allergy; can resist inflammation and improve intestinal flora; can resist depression and improve sleep; anti-aging, anti-wrinkle and whitening; lower blood sugar and lose weight; can resist oxidation whitening, delay aging and other functions, can be used in the fields of sleep-aiding and whitening, and has important application value and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics and their applications, and specifically relates to a strain of Pediococcus acidilactici MY8 and its application in the preparation of sleep-aiding and whitening food and medicine. Background Art

[0002] Pediococcus acidilactici is a Gram-positive coccus that usually exists in pairs or tetrads. It belongs to the genus Pediococcus and the species Pediococcus acidilactici. The colony surface is smooth and white, it cannot form spores, cannot synthesize cytochromes, and is non-motile. The cell morphology is spherical and does not form chains. Pediococcus acidilactici is commonly found in fermented vegetables, fermented dairy products, and meat. It is a facultative anaerobe with low sensitivity to oxygen and can grow in a wide range of pH, temperature, and osmotic pressure, allowing it to colonize in the gastrointestinal tract. It also shows that Pediococcus acidilactici is a normal strain present in the human body and is widely present in the intestines of humans and animals. In addition, Pediococcus acidilactici can antagonize other microorganisms, including intestinal pathogens, by producing lactic acid and secreting bacteriocins called pediocins.

[0003] Pediococcus acidilactici is one of the species that can be produced and processed. It is widely present in the intestines of humans and animals and is discharged with feces. As a probiotic in the intestinal flora, it is also an edible lactic acid bacteria. Pediococcus acidilactici can also help intestinal peristalsis, and can also enhance the digestive ability of the human body and improve immunity. Therefore, Pediococcus acidilactici has the functions of maintaining the balance of intestinal microecology, improving the growth performance of the body, and assisting in enhancing the immunity of the body. In recent years, Pediococcus acidilactici, as a probiotic lactobacillus with great potential, has become a hot topic of research in recent years, is widely used in the production of probiotic products, and is constantly being used to make probiotic preparations suitable for humans and animals.

[0004] According to research reports, different strains of Pediococcus acidilactici have different probiotic functions: (1) Intestinal development, intestinal acid-base environment, intestinal antioxidant capacity and intestinal microbial flora structure are all important factors affecting the function of the intestine. For example, Qin Hong et al. studied the effects of Pediococcus acidilactici on the growth performance and intestinal tract of fattening pigs (Qin Hong, Zhao Yan, Che Xiangrong, et al. Effects of Pediococcus acidilactici on the growth performance and intestinal antioxidant capacity, morphological structure and flora of fattening pigs [J]. Journal of Animal Nutrition, 2017, 29(08): 2953-2960.). Yuan Zhongfen et al. have confirmed that lactic acid Pediococcus can repair the disorder of intestinal flora in mice caused by antibiotics (Yuan Zhongfen, Nie Wansen, Yao Xiaohui, et al. The repair effect of lactic acid Pediococcus on intestinal flora disorder caused by antibiotic-associated diarrhea [J]. Chemistry of Life, 2023, 43(08): 1292-1301. DOI: 10.13488 / j.smhx.20230463.). (2) The lactic acid Pediococcus HAO2018 strain has good acid tolerance and bile salt tolerance, and is sensitive to most antibiotics such as kanamycin. At the same time, it has a strong inhibitory effect on tumor cells, further revealing the antioxidant and anti-tumor functions of lactic acid Pediococcus (Jiang Jiayun, Zhao Chongjie, Li Xuening, et al. Study on the biological activity of extracellular polysaccharides of lactic acid Pediococcus HAO2018 [J]. Food and Fermentation Industries, 2023, 49(22): 27-32. DOI: 10.13995 / j.cnki.11-1802 / ts.034793.). (3) Changes in intestinal microorganisms and their metabolites in patients with depression lead to the destruction of intestinal homeostasis, affecting the function of the intestinal epithelium, causing intestinal barrier function damage, and the phenomenon of "intestinal leakage", which in turn allows intestinal metabolites, microbial cell components, etc. to enter the body fluid circulation through the intestinal barrier, increasing the incidence of inflammatory reactions related to the pathogenesis of depression. Studies have shown that Pediococcus acidilactici CCFM6432 can intervene in the regulatory mechanism of intestinal flora and its metabolites in mice, providing a reference for the screening and mechanism research of probiotics for alleviating depressive symptoms (Yang Hongyu, Jiang Jiahao, Pei Yuxuan, et al. Pediococcus acidilactici CCFM6432 improves depressive behavior in mice by alleviating brain inflammation [J / OL]. Food and Fermentation Industries: 1-10 [2024-05-07]. https: / / doi.org / 10.13995 / j.cnki.11-1802 / ts.037523.). (4) As people's living standards continue to improve, the nutrition they consume is becoming more abundant, which leads to an increase in serum cholesterol in the body, thereby causing a series of diseases such as hypertension, coronary heart disease, and arteriosclerosis.Studies have reported that oral administration of Pediococcus acidilactici R037 can reduce chronic inflammation, regulate immune response, and successfully alleviate atherosclerosis (Mizoguchi T, Kasahara K, Yamashita T, et al. Oral administration of the lactic acid bacteriumPediococcus acidilactici attenuates atherosclerosis in mice by inducingtolerogenic dendritic cells. Heart Vessels. 2017Jun;32(6):768-776.doi:10.1007 / s00380-017-0949-8.Epub 2017Feb 8.PMID:28181012.). Pediococcus acidilactici AS185 has good adhesion and tolerance capabilities, and can improve anti-atherosclerotic symptoms by regulating blood lipids, inhibiting inflammatory factors and adhesion molecules (Zhang Lin, Gao Lei, Wang Chao, et al. Pediococcus acidilactici AS185 regulates metabolic syndrome induced by high-fat and high-sugar diet [J]. Food Science, 2021, 42(01): 215-221.).

[0005] Due to the diversity of sources, lactic acid Pediococcus has genetic diversity and functional diversity. However, there are still few studies on the isolation and identification, probiotic properties and metabolic mechanisms of lactic acid Pediococcus, which to some extent affects the development and utilization of lactic acid Pediococcus. Therefore, it is necessary to explore more new strains based on the different sources of lactic acid Pediococcus, determine their efficacy based on the functions of the strains or their probiotic metabolites, clarify their application prospects, and enable them to better play their probiotic role. In summary, the research and application of probiotic lactic acid Pediococcus has a broad development space. Summary of the invention

[0006] In order to overcome the shortcomings of the above-mentioned prior art, the present invention isolates and purifies a Pediococcus acidilactici MY8 strain from a fecal sample of a healthy adult in Guangdong, China. The strain has excellent protease activity and cellulase activity, can produce and secrete 3-hydroxybutyric acid, can produce and secrete γ-aminobutyric acid, can produce and secrete hyaluronic acid, can inhibit α-glucosidase activity, can scavenge DPPH free radicals, and has important potential application value in the fields of helping sleep and whitening.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a Pediococcus acidilactici MY8 strain, which was deposited in the China Center for Type Culture Collection on October 25, 2023, with the accession number: CCTCCNO:M 20232014; the 16S rDNA sequence of the Pediococcus acidilactici MY8 strain is shown in SEQ ID No: 1.

[0009] The second aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in producing protease.

[0010] Research has found that the probiotic Pediococcus acidilactici MY8 strain can produce protease, suggesting that the Pediococcus acidilactici MY8 strain is expected to be used to produce protease, and through this property of producing protease, it can be used to promote the human body's digestion and absorption of protein in food, anti-allergy, and help animals digest and absorb nutrients.

[0011] The third aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in producing 3-hydroxybutyric acid.

[0012] Studies have found that the probiotic Pediococcus acidilactici MY8 strain can produce 3-hydroxybutyric acid (3-HB), suggesting that the Pediococcus acidilactici MY8 strain can be used to produce 3-HB, and through the characteristic of producing 3-HB, it can be used to provide energy for various body activities, fight osteoporosis, prevent and treat chronic syndromes, improve brain cognitive function, improve lipid metabolism, and relieve intestinal inflammation.

[0013] The fourth aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in producing γ-aminobutyric acid.

[0014] Studies have shown that the probiotic Pediococcus acidilactici MY8 strain can produce γ-aminobutyric acid (GABA), suggesting that the Pediococcus acidilactici MY8 strain can be used to produce GABA, and through this characteristic of producing GABA, it can be used to improve the body's sleep quality, anti-depression, anti-anxiety, lower blood pressure, improve lipid metabolism and other fields.

[0015] The fifth aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in producing hyaluronic acid.

[0016] Studies have found that the probiotic Pediococcus acidilactici MY8 strain can produce hyaluronic acid (HA), suggesting that the Pediococcus acidilactici MY8 strain is expected to be used to produce HA, and through this property of producing HA, it can be used in anti-inflammatory and anti-angiogenic effects, anti-aging, hydrating, wrinkle smoothing, and promoting wound anti-inflammatory and healing.

[0017] The sixth aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in producing cellulase.

[0018] Research has found that the probiotic Pediococcus acidilactici MY8 strain can produce cellulase, suggesting that the Pediococcus acidilactici MY8 strain can be used to produce cellulase, and through this characteristic of producing cellulase, it can be used to promote the human body's digestion and absorption of protein in food, improve the absorption of small peptides and amino acids, and anti-allergy.

[0019] The seventh aspect of the present invention provides use of the Pediococcus acidilactici MY8 strain described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0020] Studies have shown that the probiotic Pediococcus acidilactici MY8 strain can effectively inhibit the activity of α-glucosidase, which is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, suggesting that the Pediococcus acidilactici MY8 strain is expected to be used in areas such as lowering blood sugar and inhibiting obesity.

[0021] The eighth aspect of the present invention provides the use of the Pediococcus acidilactici MY8 strain described in the first aspect in the preparation of a DPPH free radical scavenger.

[0022] Research has found that the probiotic Pediococcus acidilactici MY8 strain can eliminate DPPH free radicals and thus avoid the harm caused by such free radicals to the body. It can be used in anti-aging, cancer prevention, cardiovascular and cerebrovascular protection and other fields.

[0023] The second aspect of the present invention provides a bacterial agent with probiotic function, wherein the bacterial agent comprises the Pediococcus acidilactici MY8 strain described in the first aspect.

[0024] Preferably, the bacterial agent is a fermentation product of Pediococcus acidilactici MY8 strain.

[0025] Preferably, in the field of medical applications, the bacterial agent also includes pharmaceutically acceptable excipients.

[0026] More preferably, the excipients include carriers and excipients. The excipients refer to diluents, adhesives, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carrier is a functional pharmaceutical excipient available in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0027] Preferably, in the field of medical applications, the dosage forms of the bacterial agent include tablets, granules, capsules, pills, sustained-release preparations, oral liquid preparations, and injections.

[0028] More preferably, the above dosage forms refer to the dosage forms commonly used in clinical practice. The pharmaceutical preparations can be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention separates and purifies a Pediococcus acidilactici MY8 strain from a fecal sample of a healthy adult in Guangdong, China. The strain has a variety of probiotic effects, including superior protease activity and cellulase activity, can produce and secrete 3-hydroxybutyric acid, can produce and secrete γ-aminobutyric acid, can produce and secrete hyaluronic acid, can inhibit α-glucosidase activity, and can remove DPPH free radicals. Therefore, the Pediococcus acidilactici MY8 strain has the functions of promoting digestion and absorption of protein food, improving protein allergy; anti-inflammatory and improving intestinal flora; anti-depression and improving sleep; anti-aging, anti-wrinkle and whitening; lowering blood sugar and losing weight; anti-oxidation whitening, delaying aging, anti-inflammatory; promoting the absorption of cellulose, improving constipation and other functions. It can be seen that the newly isolated Pediococcus acidilactici MY8 strain of the present invention has a variety of probiotic effects, which can be used in the fields of helping sleep and whitening, for example, it is made into medicines that help sleep and whitening, and has important application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the phylogenetic tree of Pediococcus acidilactici MY8 strain (all strains are derived from the Genome database of NCBI);

[0032] Figure 2 This is the degradation experiment of Pediococcus acidilactici MY8 strain on milk plate (a is the blank control group; b is the experimental group);

[0033] Figure 3 The Pediococcus acidilactici MY8 strain can produce and secrete 3-hydroxybutyrate;

[0034] Figure 4 The Pediococcus acidilactici MY8 strain can produce and secrete γ-aminobutyric acid;

[0035] Figure 5 The Pediococcus acidilactici MY8 strain can produce and secrete hyaluronic acid;

[0036] Figure 6 The fermentation broth of Pediococcus acidilactici MY8 can secrete substances that significantly inhibit the activity of α-glucosidase;

[0037] Figure 7 The Pediococcus acidilactici MY8 strain can scavenge DPPH free radicals;

[0038] Figure 8 This is an experiment on the degradation of cellulose plates by Pediococcus acidilactici MY8 strain (left side, blank control group; right side, experimental group). DETAILED DESCRIPTION

[0039] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0041] The experimental materials involved in the following examples are as follows:

[0042] (1) The test bacteria was Pediococcus acidilactici MY8 strain, which was isolated from the feces of a healthy adult in Guangdong, China by Runze Laboratory for Intestinal Microbiome Research and stored in glycerol tubes at -80°C. In general, colonies can be obtained by inoculating it on the surface of an MRS solid culture medium plate and inverting it in a 37°C constant temperature anaerobic incubator for 24 hours, or by shaking it in an MRS liquid culture medium in a 37°C constant temperature anaerobic incubator for 24-48 hours to obtain a fermentation liquid.

[0043] (2) Kits: 3-Hydroxybutyric acid (3-HB) detection kit (Cloud-Clone Corp., Cat: CEB022Ge), γ-aminobutyric acid (GABA) detection kit (Cloud-Clone Corp., Cat: CEA900Ge), hyaluronic acid (HA) detection kit (Cloud-Clone Corp., Cat: CEA182Ge), α-glucosidase inhibitor screening kit (abcam, Cat: ab284520), DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1).

[0044] (3) MRS plate: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium hydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO 2 O to 1 L, adjust the pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20 min, and prepare MRS plates.

[0045] (4) MRS liquid medium: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium hydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, ddHO 2 O to 1 L, adjust the pH to 6.2-6.6, and sterilize by high pressure at 121°C for 20 min to prepare MRS liquid culture medium.

[0046] (5) MP plate: skim milk powder 10 g, sodium chloride 1 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, dipotassium hydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO 2 DMEM: O to 1 L, adjust pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20 min, and prepare MP plates.

[0047] (6) CMC plate: sodium carboxymethyl cellulose 10 g, ammonium sulfate 1.5 g, manganese sulfate 0.3 g, calcium chloride 0.2 g, sodium chloride 5 g, urea 0.3 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, potassium dihydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddHO 2 O to 1L, adjust the pH to 6.2-6.6, sterilize by high pressure at 121℃ for 20min, and prepare into CMC plates.

[0048] Example 1 Isolation and Identification of Pediococcus acidilactici MY8 Strain

[0049] Pediococcus acidilactici MY8 strain was isolated from the feces of a healthy adult (BMI=20.2) in Guangdong Province, China, as follows:

[0050] The fecal sample was repeatedly washed 3 times with sterile water, placed in a mortar, 500uL sterile water was added for every 100mg of feces, the homogenate was thoroughly ground, an appropriate amount of grinding liquid was taken with a pipette, and it was spread on an MRS plate and cultured at room temperature for 3 days. Then, the colonies to be streaked and purified in the separation experiment plate were numbered with a marker, and the strain number was marked on the plate accordingly. After marking, the colonies were picked and inoculated on the MRS plate, and the strains were purified by the plate streaking method. If this method cannot separate the strains, it is necessary to pick the colonies from the enrichment plate, dilute them with the MRS liquid culture medium gradient, and spread them on the culture medium. Finally, referring to the Bergey Bacterial Identification Manual (Eighth Edition) and the Fungal Classification and Identification Manual, the strains belonging to bacteria were first distinguished. A purified strain was initially isolated, the strain number was MY8, and the colonies of the strain were observed to be milky white and small in round shape after 48 hours of culture.

[0051] Next, the isolated MY8 strain was molecularly identified using 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the whole genome of the MY8 strain was sequenced by Beijing Biomark Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-matched in the Genome database of NCBI. The results showed that the homology of the MY8 strain with the known 16S rDNA sequence of Pediococcus acidilactici was >99%, and evolutionary analysis was performed with homologous strains ( Figure 1 ), confirming that the MY8 strain is a different strain of the same species of Pediococcus acidilactici.

[0052] Finally, the strain MY8 was deposited, and the deposit information is as follows: deposit time: October 25, 2023; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO:M 20232014; address of the depository: Wuhan University, Wuhan, China; classification name: Pediococcus acidilactici.

[0053] Pediococcus acidilactici is a probiotic strain with a wide range of probiotic effects, but strains from different sources have different effects, which shows that the new Pediococcus acidilactici MY8 strain isolated from human feces in the present invention can be used as a probiotic and may have new effects and functions.

[0054] Pediococcus acidilactici MY8 16S rDNA sequence (1452bp, SEQ ID No: 1):

[0055]

[0056] Example 2 Function and application of Pediococcus acidilactici MY8 strain

[0057] (1) Pediococcus acidilactici MY8 strain can produce protease

[0058] The ability of Pediococcus acidilactici MY8 to secrete protease to hydrolyze proteins was identified and measured using skim milk plate medium (MP plate) according to the agar well diffusion test. During the test, 3uL of 10Abs concentration of Pediococcus acidilactici MY8 bacterial solution was added to the MP plate of the experimental group, and 3uL of blank MRS medium was added to the control group, and then inverted in a 37°C constant temperature anaerobic incubator for 3 days. The results showed that compared with the control with blank medium added, strain MY8 could significantly degrade proteins, forming a clear degradation circle ( Figure 2 ). This indicates that the Pediococcus acidilactici MY8 strain can produce protease that degrades milk protein.

[0059] The MY8 strain of Pediococcus acidilactici can produce protease, which can be used as a probiotic strain to promote the digestion and absorption of protein in food by the human body and improve the absorption of small peptides and amino acids. At the same time, it can also be used for anti-allergy (improving food allergies caused by protein indigestion or non-absorption). In addition, it can also be used for the extraction of protease and applied to the production of protease in the food industry or the washing industry; it can also be used in microbial feed to help animals digest and absorb nutrients and improve the utilization rate of feed.

[0060] (2) Pediococcus acidilactici MY8 strain can produce and secrete 3-hydroxybutyrate (3-HB)

[0061] The lactic acid Pediococcus MY8 cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4℃ for 10 minutes. The 3-HB concentration in the fermentation supernatant was then determined by a 3-HB specific ELISA kit (CEB022Ge). The results showed that compared with the absence of 3-HB in the blank medium MRS, the concentration of 3-HB in the supernatant of strain MY8 was 0.29μg / mL, indicating that lactic acid Pediococcus MY8 can produce and secrete 3-hydroxybutyrate ( Figure 3 ).

[0062] 3-Hydroxybutyric acid (3-HB) can provide energy for various activities of the body and is a potential energy / functional food. It has been added to athletes' drinks, so the probiotic Pediococcus acidilactici MY8 strain can be used as an energy-type food additive. At the same time, given that 3-HB can effectively fight osteoporosis, prevent and treat chronic syndromes (hypertension, alcoholic fatty liver, enteritis, and intestinal cancer), improve brain cognitive function (improve learning and memory ability, protect glial cells, and improve Alzheimer's disease), and improve lipid metabolism. The probiotic Pediococcus acidilactici MY8 strain can achieve the above multiple uses by producing 3-hydroxybutyric acid.

[0063] In addition, 3-HB is an endogenous small molecule naturally produced by the body. It plays an important role in maintaining the integrity of colorectal tissues, and has the functions of maintaining intestinal health, preventing colon diseases and reducing inflammation. 3-HB treatment can promote the proliferation of beneficial intestinal bacteria and relieve the symptoms of multiple sclerosis. It has great potential in regulating flora and improving health. Therefore, the probiotic Pediococcus acidilactici MY8 strain can also help improve intestinal flora and relieve intestinal inflammation.

[0064] (3) Pediococcus acidilactici MY8 strain can produce and secrete γ-aminobutyric acid (GABA)

[0065] The lactic acid Pediococcus MY8 cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4℃ for 10 minutes. The GABA concentration in the fermentation supernatant was then determined by a GABA-specific ELISA kit (CEA900Ge). The results showed that compared with the low concentration of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of strain MY8 increased significantly, and the accumulated amount was 41.67pg / mL, indicating that lactic acid Pediococcus MY8 can produce and secrete γ-aminobutyric acid ( Figure 4 ).

[0066] GABA is an important inhibitory neurotransmitter of the central nervous system, which is widely found in animals, plants and microorganisms. It has been confirmed that GABA, a small molecular weight non-protein amino acid, is safe for consumption and can be used as a food additive. Studies have shown that taking a certain amount of GABA can improve the body's sleep quality, resist depression, antianxiety, lower blood pressure, improve lipid metabolism, enhance memory and improve brain activity, accelerate brain metabolism, strengthen the liver and kidneys, promote ethanol metabolism (detoxification), and improve menopausal syndrome.

[0067] Therefore, the probiotic Pediococcus acidilactici MY8 strain can play the above multiple roles by producing γ-aminobutyric acid.

[0068] (4) Pediococcus acidilactici MY8 strain can produce and secrete hyaluronic acid (HA)

[0069] The lactic acid Pediococcus MY8 cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The HA concentration in the fermentation supernatant was then determined by a hyaluronic acid (also known as hyaluronic acid, HA) specific ELISA kit (CEA182Ge). The results showed that compared with the low concentration of HA in the blank medium MRS, the concentration of HA in the fermentation supernatant of strain MY8 increased significantly, and the accumulated amount was 31.96 ng / mL, indicating that the lactic acid Pediococcus MY8 strain can produce and secrete γ-aminobutyric acid ( Figure 5 ).

[0070] Hyaluronic acid, also known as hyaluronic acid, is a biodegradable, biocompatible, non-toxic, non-sensitizing polymer with multiple biological functions. It has anti-inflammatory and anti-angiogenic effects, as well as strong anti-aging, moisturizing, and wrinkle-smoothing abilities. Because it helps the skin resist wrinkles, promotes wound inflammation and healing, it can be used as an anti-wrinkle agent and has the potential to develop skin cosmetics. In addition, because HA has high lubrication, water absorption and water retention capabilities, it can affect multiple cell functions, such as migration, adhesion and proliferation, making HA also widely used in ophthalmic surgery, arthritis treatment, wound healing scaffolds, tissue engineering, and implant materials and other biomedical fields.

[0071] Therefore, the probiotic Pediococcus acidilactici MY8 strain can achieve the above multiple uses by producing hyaluronic acid.

[0072] (5) The fermentation broth of Pediococcus acidilactici MY8 strain can effectively inhibit the activity of α-glucosidase

[0073] The lactic acid Pediococcus MY8 cultured to the stable phase in MRS liquid medium was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected when the culture reached the stable phase for 24 hours, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4℃ for 10 minutes. The effect of the fermentation supernatant on the enzymatic activity of α-glucosidase to hydrolyze glucose was then determined using the α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the blank medium MRS without inhibition, the fermentation supernatant of strain MY8 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, with an inhibition rate of about 38.96%, indicating that the fermentation broth of lactic acid Pediococcus MY8 can effectively inhibit the activity of α-glucosidase ( Figure 6 ).

[0074] α-glucosidase is an enzyme that plays a role in the breakdown of carbohydrates and is associated with type 2 diabetes. Inhibiting α-glucosidase is one of the ways to control postprandial hyperglycemia, thereby contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood sugar balance and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0075] Therefore, the probiotic Pediococcus acidilactici MY8 strain has the ability to inhibit α-glucosidase activity, which makes it a potential probiotic for lowering blood sugar and inhibiting obesity.

[0076] (6) Pediococcus acidilactici MY8 strain can scavenge DPPH free radicals

[0077] The lactic acid Pediococcus MY8 strain cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected 24 hours after the stable phase was reached. The fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The DPPH free radical scavenging ability of the fermentation supernatant was then measured using a DPPH free radical scavenging ability kit (Nanjing Jiancheng, Cat: A153-1-1). The results showed that compared with the blank control MRS, the fermentation supernatant of strain MY8 had a DPPH free radical scavenging ability of 187.5 Trolox / mL, which was significantly improved ( * P<0.05), indicating that Pediococcus acidilactici MY8 has a good ability to scavenge DPPH free radicals and exhibits good antioxidant capacity ( Figure 7 ).

[0078] Free radicals, also known as "free radicals" in chemistry, refer to atoms or groups with unpaired electrons formed by the homolytic cleavage of covalent bonds in the molecules of a compound under external conditions such as light and heat. Since free radicals contain unpaired electrons, they are extremely unstable (especially hydroxyl free radicals), so they will steal electrons from neighboring molecules (including fats, proteins, and DNA) to keep themselves in a stable state. In this way, the neighboring molecule becomes a new free radical, which then steals electrons... As a result of such a chain reaction, the structure of the cell is damaged, causing loss of cell function, gene mutation, and even death.

[0079] Free radicals have many negative effects. For example: (1) weakening the resistance of cells, making the body susceptible to bacterial and pathogenic infections; (2) producing chemical substances that damage cells and form carcinogens; (3) hindering the normal development of cells, interfering with their recovery function, and causing the cell renewal rate to be lower than the withering rate; (4) destroying the genetic gene (DNA) organization in the body, disrupting the operation and regeneration function of cells, causing gene mutations and evolving into cancer; (5) destroying the mitochondria (energy storage bodies) in cells, causing oxidative fatigue; (6) destroying cell membranes, interfering with cell metabolism, and causing the cell membrane to lose its function of protecting cells; (7) attacking the amino acids necessary for cell tissue and hormones, interfering with the operation of the body's systems, leading to a vicious cycle and producing more free radicals. The chain reaction can cause free radical damage throughout the body; (8) destroying proteins and enzymes in the body, leading to inflammation and aging; (9) destroying fats, causing lipid peroxidation, leading to atherosclerosis and cardiovascular and cerebrovascular diseases; (10) destroying carbohydrates, causing hyaluronic acid degradation, leading to arthritis, etc.

[0080] Eliminating DPPH free radicals has many effects, such as: ① Anti-aging: A very obvious manifestation of free radicals on the human body is aging. Eliminating free radicals can prevent free radicals from damaging cells, causing cell aging and death, thereby causing the aging of the body. Therefore, scavenging free radicals has an anti-aging effect. ② Cancer prevention: When free radicals damage cell membrane proteins, they will promote changes in cell function and shape, and at the same time damage other cells around them. When free radicals damage DNA, they will cause mutations in proto-oncogenes and tumor suppressor genes, leading to the formation of cancer cells. Therefore, scavenging free radicals has the effect of preventing cancer. ③ Protecting the cardiovascular and cerebrovascular system: Free radicals deposit on the blood vessel wall, which will destroy the elastic fibers of the blood vessel, causing hardening of vascular cells and the occurrence of atherosclerosis. At the same time, free radicals will cause lipid peroxidation, which is easy to cause various cardiovascular and cerebrovascular diseases such as thrombosis. Eliminating free radicals can prevent free radicals from depositing on the blood vessel wall, so it has the effect of protecting the cardiovascular and cerebrovascular system.

[0081] (7) Pediococcus acidilactici MY8 strain can produce cellulase

[0082] The ability of lactic acid bacteria MY8 to degrade cellulose was identified and determined using cellulose plate medium (CMC plate) according to the agar well diffusion method. During the test, 3uL of lactic acid bacteria MY8 bacterial solution with a concentration of 10Abs was added to the CMC plate of the experimental group, and 3uL of blank MRS medium was added to the control group. After inverted culture in a 37°C constant temperature anaerobic incubator for 3 days, Congo red staining was performed. The results showed that compared with the control group with blank culture medium added, strain MY8 could significantly degrade cellulose, forming an obvious degradation circle ( Figure 8 ). This indicates that Pediococcus acidilactici MY8 strain can produce cellulase.

[0083] Since the MY8 strain of Pediococcus acidilactici can produce cellulase, the probiotic strain of Pediococcus acidilactici can play the following multiple roles through the effect of producing cellulase: (1) It is used to promote the digestion and absorption of dietary ingredients; (2) It improves constipation. Probiotics break down cellulose in the intestine to produce a certain amount of water, which has the effect of softening stool; (3) Lowering cholesterol is the most important effect of cellulose. After being absorbed by the human body, soluble fiber can inhibit the body's absorption of cholesterol, and can combine with cholesterol in the intestine to accelerate the metabolism of cholesterol in the body, preventing the body from inducing hyperlipidemia due to high cholesterol, and can reduce the incidence of arteriosclerosis and coronary heart disease; (4) Cellulose, a non-sweet "sugar", can slow down the absorption of glucose by the blood, balance blood sugar concentration, and promote the sensitivity of muscle and fat cells to insulin, thereby preventing and assisting in the treatment of diabetes.

[0084] In addition, the MY8 strain of Pediococcus acidilactici can also be used for the fermentation and extraction of cellulase; for degrading the cell walls of pathogenic fungi and controlling diseases; for the decomposition of cellulose in compost; and for the preparation of livestock and poultry feed, such as feed for monogastric animals such as pigs and chickens, to overcome their inability to utilize cellulose.

[0085] In summary, the newly isolated Pediococcus acidilactici MY8 strain of the present invention has multiple probiotic effects: (1) has excellent protease activity; (2) can produce and secrete 3-hydroxybutyric acid; (3) can produce and secrete γ-aminobutyric acid; (4) can produce and secrete hyaluronic acid; (5) can inhibit α-glucosidase activity; (6) can scavenge DPPH free radicals; (7) has excellent cellulase activity. It can be seen that the newly isolated Pediococcus acidilactici MY8 strain of the present invention has important application value and economic value in the fields of helping sleep and whitening.

[0086] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A Pediococcus acidilactici MY8 strain, characterized in that: The Pediococcus acidilactici MY8 strain was deposited in the China Center for Type Culture Collection on October 25, 2023, with the deposit number: CCTCC NO:M20232014; the 16S rDNA sequence of the Pediococcus acidilactici MY8 strain is shown in SEQ ID No:

1.

2. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in producing a protease for degrading milk protein.

3. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in producing 3-hydroxybutyric acid.

4. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in producing γ-aminobutyric acid.

5. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in producing hyaluronic acid.

6. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in producing cellulase.

7. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in the preparation of an α-glucosidase inhibitor.

8. Use of the Pediococcus acidilactici MY8 strain according to claim 1 in the preparation of a DPPH free radical scavenger.

9. A bacterial agent with probiotic function, characterized in that: The bacterial agent includes the Pediococcus acidilactici MY8 strain according to claim 1.

10. The bacterial agent with probiotic function according to claim 9, characterized in that: The bacterial agent is a fermentation product of Pediococcus acidilactici MY8 strain.

Images