A recombinant Cas12a protein and its use in preparing gene editing and / or epigenetic editing products

Abstract

The present invention relates to a recombinant Cas12a protein and its application in the preparation of gene editing and / or epigenetic editing products, belonging to the field of gene editing technology. The amino acid sequence of the recombinant Cas12a protein of the present invention is shown in SEQ ID NO.1, and amino acid mutations of C175R, F225G, K310L, D350C and V410K occur on the basis of LbCas12a protein. The recombinant Cas12a protein of the present invention has a wider PAM recognition and cutting range and better cutting activity, and can be widely used in gene editing and epigenetic editing.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a recombinant Cas12a protein and an application thereof in preparing gene editing and / or epigenetic editing products. Background Art

[0002] CRISPR-Cas nucleases are widely used in gene, epigenetic and base editing of cells and tissues. In addition to the commonly used Cas9 (SpCas9) derived from Streptococcus pyogenes, studies on alternative CRISPR nucleases including Cas1, Cas8 and Cas9, which are homologous to Cas12a, have discovered more nucleases with unique and potential advantages.

[0003] In Cas12a, AsCas12a from Acidaminococcus sp. BV3L6 strain and LbCas12a from Lachnospiraceae bacterium ND2006 strain both have ribonuclease activity and can recognize targets of Protspacer adjacent motifs (PAM) rich in T bases. Only a 40-nucleotide CRISPR RNA (crRNA) programming target is required to achieve multiple targeting through poly-crRNA transcripts. Although AsCas12a and LbCas12a have been used for multiple gene editing, gene activation, and combinatorial library screening, their recognition requirements for PAM of 5'-TTTV (where V is A, C, or G) limit the design of related crRNA target sites. In addition, the ribonuclease activity of Cas12a nuclease homologs such as FnCas12a from Francisella novicida U112 strain and MbCas12a from Moraxella bovoculi 237 strain in human cells is not consistent and significant; although the LbCas12a variants disclosed in the prior art (such as RVR and RR) can recognize 5'-TATV and 5'-TYCV, respectively, they still cannot recognize other PAMs. Summary of the invention

[0004] The object of the present invention is to provide a recombinant Cas12a protein and its use in the preparation of gene editing and / or epigenetic editing products to meet the needs of the prior art for mutants with extended target recognition capabilities, recombinant Cas12a proteins that can support high target density and high flexibility applications.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a recombinant Cas12a protein, the amino acid sequence of the recombinant Cas12a protein is shown in SEQ ID NO.1.

[0007] The present invention also provides a method for preparing the recombinant Cas12a protein, wherein the recombinant Cas12a protein undergoes amino acid mutations based on the LbCas12a protein;

[0008] The mutated sites are positions 175, 225, 310, 350, and 410 of the amino acid sequence of the LbCas12a protein;

[0009] The amino acid at position 175 mutated from cysteine ​​to arginine;

[0010] The amino acid at position 225 mutated from phenylalanine to glycine;

[0011] The amino acid at position 310 mutated from lysine to leucine;

[0012] The amino acid at position 350 was mutated from aspartic acid to cysteine;

[0013] The amino acid at position 410 mutated from valine to lysine;

[0014] The amino acid sequence of the LbCas12a protein is shown in SEQ ID NO.2.

[0015] The present invention also provides the use of the recombinant Cas12a protein in the preparation of gene editing and / or epigenetic editing products.

[0016] The present invention also provides a nucleic acid molecule encoding the recombinant Cas12a protein, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.3.

[0017] The present invention also provides a recombinant variant plasmid, which comprises the nucleic acid molecule and an empty vector;

[0018] The empty vector is a pET-28a(+) vector.

[0019] The present invention also provides the use of the recombinant variant plasmid in preparing gene editing and / or epigenetic editing products.

[0020] The present invention also provides a base editor, which comprises the recombinant Cas12a protein or the recombinant variant plasmid.

[0021] The present invention also provides the use of the base editor in gene editing and / or epigenetic editing.

[0022] The present invention has the following technical effects and advantages:

[0023] The present invention is based on the modification of LbCas12a, obtains a recombinant Cas12a protein that can recognize a wider range of PAMs, and constructs a base editor that can recognize a wider range of PAMs. The base editor can target PAMs that cannot be recognized and contacted by existing technologies, and can achieve efficient C>T or A>G editing of both classical PAMs and non-classical PAMs at the cellular and embryonic levels. At the same time, it can achieve simultaneous multi-site efficient C>T or A>G editing at the cellular and embryonic levels, thus enriching the existing base editing tools. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the recombinant Cas12a protein plasmid map;

[0025] Figure 2 This is the pUC57 vector map;

[0026] Figure 3 It is the cleavage activity result of the recombinant Cas12a protein;

[0027] Figure 4 It is the cleavage range result of recombinant Cas12a protein. DETAILED DESCRIPTION

[0028] The present invention provides a recombinant Cas12a protein, the amino acid sequence of the recombinant Cas12a protein is shown in SEQ ID NO.1.

[0029] The present invention also provides a method for preparing the recombinant Cas12a protein, wherein the recombinant Cas12a protein undergoes amino acid mutations based on the LbCas12a protein;

[0030] The mutated sites are positions 175, 225, 310, 350, and 410 of the amino acid sequence of the LbCas12a protein;

[0031] The amino acid at position 175 was mutated from cysteine ​​to arginine (C175R);

[0032] The amino acid at position 225 was mutated from phenylalanine to glycine (F225G);

[0033] The amino acid at position 310 was mutated from lysine to leucine (K310L);

[0034] The amino acid at position 350 was mutated from aspartic acid to cysteine ​​(D350C);

[0035] The amino acid at position 410 was mutated from valine to lysine (V410K);

[0036] The amino acid sequence of the LbCas12a protein is shown in SEQ ID NO.2.

[0037] The present invention also provides the use of the recombinant Cas12a protein in the preparation of gene editing and / or epigenetic editing products.

[0038] The present invention also provides a nucleic acid molecule encoding the recombinant Cas12a protein, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.3.

[0039] In the present invention, the nucleotide sequence of the nucleic acid molecule encoding the LbCas12a protein is shown in SEQ ID NO.4.

[0040] The present invention also provides a recombinant variant plasmid, which comprises the nucleic acid molecule and an empty vector;

[0041] The empty vector is a pET-28a(+) vector.

[0042] The present invention also provides the use of the recombinant variant plasmid in preparing gene editing and / or epigenetic editing products.

[0043] The present invention also provides a base editor, which comprises the recombinant Cas12a protein or the recombinant variant plasmid.

[0044] The present invention also provides the use of the base editor in gene editing and / or epigenetic editing.

[0045] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] In the test materials of the present invention: pET-28a (+) vector was purchased from Shenzhen BGI Genomics Co., Ltd., Escherichia coli BL21 (DE3) competent cells were purchased from Sangon Biotech (Shanghai) Co., Ltd., Ni-NTA agarose purification resin was purchased from GE, T7 transcription kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and gene random mutation kit was purchased from Shanghai Biotech Co., Ltd.

[0047] In the test solvent of the present invention:

[0048] Preparation of lysis buffer: Add 50mmol Tris-HCl and 500mmol NaCl to 1L water and adjust the pH to 7.5;

[0049] Preparation of resuspension: Add 20mmol Tris-HCl to 1L water and adjust the pH to 7.0.

[0050] Example 1: Construction of recombinant Cas12a protein plasmid

[0051] (1) Primer design: The nucleotide sequence of LbCas12a extracted from the full sequence of pMBP-LbCas12a obtained from the Addgene website was used as a template to design primers LbCas12aF / R for synthesizing the nucleotide sequence of LbCas12a, and commissioned Sangon Biotech (Shanghai) Co., Ltd. to synthesize, and PCR amplification was performed to obtain a nucleic acid molecule encoding the LbCas12a protein (as shown in SEQ ID NO.4). The nucleotide sequences of the primers are shown in Table 1.

[0052] Table 1 Nucleotide sequences of primers LbCas12aF / R

[0053]

[0054] SEQ ID NO.4:

[0055]

[0056] The amino acid sequence of the encoded LbCas12a protein is shown in SEQ ID NO.2.

[0057] SEQ ID NO.2:

[0058]

[0059] (2) Plasmid construction: Referring to the operating instructions of the pET-28a(+) vector, the nucleic acid molecule encoding the LbCas12a protein was connected to the pET-28a(+) vector to obtain the plasmid pET28a-LbCas12a, and transformation and sequencing were performed. Referring to the operating instructions of the gene random mutation kit, the combined mutations of C175R, F225G, K310L, D350C and V410K were inserted into the correctly sequenced plasmid pET28a-LbCas12a to obtain the recombinant Cas12a protein plasmid. The relevant parameters for preparing the recombinant Cas12a protein plasmid are shown in Tables 2 to 3, and the map of the recombinant Cas12a protein plasmid is shown in Tables 2 to 3. Figure 1 As shown, the nucleotide sequence of the nucleic acid molecule encoding the recombinant Cas12a protein is shown in SEQ ID NO.3.

[0060] Table 2 Gene random mutation PCR reaction system

[0061]

[0062]

[0063] Table 3 Gene random mutation PCR reaction program

[0064]

[0065] SEQ ID NO.3:

[0066]

[0067] Example 2: Purification of recombinant Cas12a protein

[0068] (1) Prokaryotic expression: The recombinant Cas12a protein plasmid obtained in Example 1 was transformed into Escherichia coli BL21 (DE3) competent cells, coated on LB plates (Kan+) and cultured overnight at 37°C. Then, a single clone was picked and inoculated into 100 mL LB culture medium (Kan+), and cultured at 37°C, 210 rpm, and OD was 0. 600 =0.6 to obtain a recombinant Cas12a protein plasmid solution; IPTG was added to the recombinant Cas12a protein plasmid solution to a final concentration of 0.5 mmol / L, and the solution was induced at 37°C and 210 rpm for 4 h to obtain an induced bacterial solution.

[0069] (2) Purification: 10 mL of the induced bacterial solution was centrifuged at 8000 rpm for 8 min. The precipitate was washed twice with 20 mmol / L Tris (pH = 7.0), and then ultrasonically lysed with 1 mL of lysis buffer at 150 W for 4 s. After standing for 6 s, it was crushed for 1 min until the induced bacterial solution became clear. Then, it was centrifuged at 8000 rpm for 8 min at 4°C. The supernatant was purified with Ni-NTA agarose purification resin. Specifically, the supernatant was pumped through a peristaltic pump at a flow rate of 2 mL / min at 4°C. The sample was transferred to the balanced Ni column, the effluent was collected, and the sample was repeatedly loaded for 3 hours to obtain a Ni column bound to the recombinant Cas12a protein; the resuspension was re-equilibrated with the Ni column bound to the recombinant Cas12a protein at a flow rate of 2 mL / min until the reading of the UV detector dropped to a stable level, and then gradient eluted with imidazole at concentrations of 50 mmol / L, 150 mmol / L, 250 mmol / L, and 500 mmol / L, respectively, to obtain the purified recombinant Cas12a protein, whose amino acid sequence is shown in SEQ ID NO.1.

[0070] SEQ ID NO.1:

[0071]

[0072] Example 3: Identification of cleavage activity of recombinant Cas12a protein

[0073] (1) Primer design: Using the pUC57 plasmid containing the 48048 bp to 48509 bp nucleotide fragment of the monkeypox virus F3L gene (NCBI ID: AF380138) as a template, the primers MPVF3L F / R for synthesizing the target DNA were designed and commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. The target DNA was obtained by PCR amplification at 37°C for 30 min. The nucleotide sequences of the primers are shown in Table 4, the PCR amplification system is shown in Table 5, and the map of the pUC57 vector is shown in Figure 2 shown.

[0074] Table 4 Nucleotide sequences of primers and probes

[0075]

[0076] Table 5 PCR amplification system

[0077] Reagents Add 2×ReactionBuffer 12.5μL dNTP 2.3μL 10×BasicE-mix 2.5μL 10 μmol / L Primer MPVF3LF 1.2μL 10 μmol / L Primer MPVF3LR 1.2μL 20 × CoreReactionMix 1.25μL stencil 0.5μL 280mmol / L magnesium acetate 1.25μL water 2.3μL

[0078] (2) Preparation of crRNA: A crRNA sequence (as shown in SEQ ID NO.9) was designed according to the characteristics of the target DNA, a crRNA sequence with a T7 polymerase promoter was synthesized, and in vitro transcription was performed according to the instructions of the T7 transcription kit to obtain crRNA.

[0079] (3) Preparation of ssDNA probe: The structure of the ssDNA probe is: the N-terminus is modified with a 5'-FAM group, and the C-terminus is modified with a 3'-BHQ1 quenching group. It was commissioned to Shenzhen BGI Genomics Co., Ltd. for synthesis, and the sequence is shown in SEQ ID NO.10.

[0080] (4) Identification of cutting activity: Monkeypox virus was used as the target site to detect the trans-cutting activity of recombinant Cas12a protein on ssDNA. Specifically, 125mmol / L, 250mmol / L, and 500mmol / L recombinant Cas12a protein were taken as 15.5μL, and 2.5μL 0.5μmol / L crRNA, 2μL NEBuffer2.1, 5μL ssDNA probe and 0.5ng target DNA were added respectively. The control was free of recombinant Cas12a protein (i.e., the concentration of recombinant Cas12a protein was 0nmol / L). After incubation at 37°C for 2h, real-time fluorescence PCR was used for detection. The test results are as follows: Figure 3 shown.

[0081] The results showed that recombinant Cas12a proteins at different concentrations had certain cleavage activity, and the higher the concentration of the recombinant Cas12a protein, the greater the cleavage activity.

[0082] Example 4: Verification of the cleavage range of recombinant Cas12a protein

[0083] Different crRNAs were used as targets to verify the cleavage range of the recombinant Cas12a protein on PAM. Specifically, TTTV, TCCC, TCCA, TATG and TATA were independently used as guide crRNA-dependent sequences, and 2.5 μL 0.5 μmol / L recombinant Cas12a protein, 2 μL NEBuffer2.1, 5 μL ssDNA probe and 0.5 ng target DNA were added respectively. After incubation at 37 ° C for 2 h, real-time fluorescence PCR was used for detection. The nucleotide sequence of the guide crRNA-dependent sequence is shown in Table 6, and the test results are shown in Table 6. Figure 4 shown.

[0084] Table 6 Nucleotide sequences of guide crRNA dependent sequences

[0085] name Sequence (5'~3') SEQ ID NO. TTTV TTTATGCCTGTGTAGACATTGACGG 11 TCCC TCCCATGCCTGTGTAGACATTGACGG 12 TCCA TCCAATGCCTGTGTAGACATTGACGG 13 TATG TATGATGCCTGTGTAGACATTGACGG 14 TATA TATAATGCCTGTGTAGACATTGACGG 15

[0086] The results showed that the recombinant Cas12a protein had certain cleavage activity against TTTV, TCCC, TCCA, TATG and TATA, and the cleavage activity of the recombinant Cas12a protein on the guide crRNA-dependent sequence was ranked as follows: TATG>TATA>TCCA>TTTV>TCCC.

[0087] As can be seen from the above embodiments, the present invention provides a recombinant Cas12a protein and its application in the preparation of gene editing and / or epigenetic editing products. The recombinant Cas12a protein of the present invention has a wider PAM recognition and cutting range and better cutting activity, and can be more widely used in gene editing and epigenetic editing.

[0088] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A recombinant Cas12a protein, characterized in that The amino acid sequence of the recombinant Cas12a protein is shown in SEQ ID NO.

1.

2. The method for preparing the recombinant Cas12a protein according to claim 1, characterized in that The recombinant Cas12a protein undergoes amino acid mutations based on the LbCas12a protein; The mutated sites are positions 175, 225, 310, 350, and 410 of the amino acid sequence of the LbCas12a protein; The amino acid at position 175 mutated from cysteine ​​to arginine; The amino acid at position 225 mutated from phenylalanine to glycine; The amino acid at position 310 mutated from lysine to leucine; The amino acid at position 350 was mutated from aspartic acid to cysteine; The amino acid at position 410 mutated from valine to lysine; The amino acid sequence of the LbCas12a protein is shown in SEQ ID NO.

2.

3. Application of the recombinant Cas12a protein described in claim 1 in the preparation of products of gene editing and / or epigenetic editing.

4. A nucleic acid molecule encoding the recombinant Cas12a protein according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

3.

5. A recombinant variant plasmid, characterized in that: The recombinant variant plasmid comprises the nucleic acid molecule of claim 4 and an empty vector; The empty vector is a pET-28a(+) vector.

6. Use of the recombinant variant plasmid according to claim 5 in the preparation of gene editing and / or epigenetic editing products.

7. A base editor, characterized in that: The base editor comprises the recombinant Cas12a protein of claim 1 or the recombinant variant plasmid of claim 5.

8. Use of the base editor described in claim 7 in gene editing and / or epigenetic editing.

Images