Application of knocking out or knocking down SlMYB52 gene in reducing tomato lateral buds

Abstract

The present invention belongs to the field of modern agricultural industry, and specifically relates to the application of knocking out or knocking down the SlMYB52 gene in reducing tomato lateral buds. The present invention constructs tomato SlMYB52 gene knockout and overexpression plants by genetic means, and regulates the expression level of SlMYB52 protein to study its regulatory mechanism on tomato lateral buds. The results show that overexpressing the SlMYB52 gene can significantly increase the number and length of tomato lateral buds, while the number and length of tomato lateral buds significantly decreased after knocking out the SlMYB52 gene. In the field of modern agricultural industry, the cultivation of tomatoes with few lateral buds can bear fruit early, increase yield, improve quality, and solve the planting problems of cumbersome pruning and high labor costs.

Description

Technical Field

[0001] The invention belongs to the field of modern agricultural industry, and discloses an application of knocking out or knocking down the SlMYB52 gene in reducing tomato lateral buds. Background Art

[0002] Tomato (Solanum lycopersicum L.) belongs to the genus Solanaceae, native to South America, and is one of the most widely grown vegetable crops in the world. There are many varieties of tomatoes, which can be used as both vegetables and fruits. Its fruit is rich in nutrients, containing considerable organic acids such as malic acid and citric acid, as well as nutrients such as carotenoids, vitamin B1, and lycopene. It is favored by consumers for its unique flavor and nutritional value. Tomato is a crop with a super strong ability to sprout branches. It can grow side buds at each joint to form side branches. The free growth of these side branches will consume unnecessary nutrients. In the process of tomato planting and production, pruning and branching is an important link, which is very critical to the formation of tomato yield and quality. Reasonable pruning and branching can optimize the plant shape, reduce nutrient consumption, control the nutritional growth of stems and leaves, promote the development of flowers and fruits, reduce the occurrence of diseases, early maturity, increase single fruit weight, increase yield, and improve quality. Tomato side buds refer to the branches growing between the tomato leaves and the main stem, which will consume the nutrients of the plant and affect flowering and fruiting. Therefore, the lateral buds should be pruned in time during the growth of tomatoes, and are generally removed when they grow to 4 to 7 cm. Due to the limitations of the tomato planting environment and the technology for pruning lateral buds, pruning lateral buds of tomatoes can usually only be done manually, which is a cumbersome task and often results in huge manpower and time costs. Therefore, it is necessary to develop a tomato variety with a small number of lateral buds and a short length of lateral buds, which can not only lay the foundation for optimizing plants, reducing tomato pruning, and promoting simplified tomato cultivation, but also provide an effective solution for the development of modern agriculture, reducing the burden on farmers, and helping farmers increase their income. Summary of the invention

[0003] The first aspect of the present invention aims to provide a knockout or knockdown SlMYB52 The application of genes in reducing lateral shoots in tomato.

[0004] The object of the second aspect of the present invention is to provide the application of a1) to a3) in at least one of b1) to b4).

[0005] The third aspect of the present invention aims to provide a use of a SlMYB52 protein inhibitor in at least one of d1) to d8).

[0006] The fourth aspect of the present invention aims to provide a method comprising the step of reducing the expression level of SlMYB52 protein in tomatoes.

[0007] The fifth aspect of the present invention aims to provide a method comprising the step of increasing the expression level of SlMYB52 protein in tomatoes.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides the use of knocking out or knocking down the SlMYB52 gene in reducing tomato lateral buds.

[0010] Said SlMYB52 The gene number in the tomato genome database https: / / solgenomics.net / is Solyc03g093890, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0011] The reducing of tomato lateral buds includes reducing the length of tomato lateral buds and / or reducing the number of tomato lateral buds.

[0012] The second aspect of the present invention provides the use of a1) to a3) in at least one of b1) to b4):

[0013] a1) SlMYB52 protein;

[0014] a2) biological materials related to SlMYB52 protein;

[0015] a3) a reagent for targeting and upregulating the expression of SlMYB52 protein;

[0016] b1) Increase the side shoots of tomatoes;

[0017] b2) Cultivating tomato varieties;

[0018] b3) preparing a product for increasing lateral shoots of tomatoes;

[0019] b4) preparing products of cultivated tomato varieties.

[0020] The increasing of tomato lateral buds includes increasing the length of tomato lateral buds and / or increasing the number of tomato lateral buds.

[0021] Preferably, the biomaterial comprises at least one of c1) to c12):

[0022] c1) a nucleic acid molecule encoding a S1MYB52 protein;

[0023] c2) an expression cassette containing the nucleic acid molecule described in c1);

[0024] c3) a recombinant vector containing the nucleic acid molecule described in c1);

[0025] c4) a recombinant vector containing the expression cassette described in c2);

[0026] c5) a recombinant cell containing the nucleic acid molecule described in c1);

[0027] c6) a recombinant cell containing the expression cassette described in c2);

[0028] c7) a recombinant cell containing the recombinant vector described in c3);

[0029] c8) a recombinant cell containing the recombinant vector described in c4);

[0030] c9) a recombinant microorganism containing the nucleic acid molecule described in c1);

[0031] c10) a recombinant microorganism containing the expression cassette described in c2);

[0032] c11) a recombinant microorganism containing the recombinant vector described in c3);

[0033] c12) A recombinant microorganism containing the recombinant vector described in c4).

[0034] Preferably, the tomato variety comprises the following characteristics: the tomato has increased lateral shoots.

[0035] The third aspect of the present invention provides the use of SlMYB52 protein inhibitor in at least one of d1) to d4):

[0036] d1) Reduce the side shoots of tomatoes;

[0037] d2) Cultivating tomato varieties;

[0038] d3) preparing a product for reducing lateral sprouts in tomatoes;

[0039] d4) preparing a product of cultivated tomato variety.

[0040] Preferably, the tomato variety comprises the following characteristics: the tomato has reduced side shoots.

[0041] Preferably, reducing the tomato lateral buds includes reducing the length of the tomato lateral buds and / or reducing the number of the tomato lateral buds.

[0042] Preferably, the SlMYB52 protein inhibitor comprises at least one of a substance that inhibits the activity of the SlMYB52 protein, a substance that degrades the SlMYB52 protein, and a substance that reduces the expression level of the SlMYB52 protein.

[0043] Preferably, the substance that reduces the expression level of SlMYB52 protein comprises at least one of e1) to e13):

[0044] e1) at least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting S1MYB52 protein;

[0045] e2) a nucleic acid molecule encoding e1);

[0046] e3) an expression cassette comprising the nucleic acid molecule described in e2);

[0047] e4) a recombinant vector comprising the nucleic acid molecule described in e2);

[0048] e5) a recombinant vector comprising the expression cassette described in e3);

[0049] e6) a transgenic cell comprising the nucleic acid molecule described in e2);

[0050] e7) a transgenic cell comprising the expression cassette described in e3);

[0051] e8) a transgenic cell comprising the recombinant vector described in e4);

[0052] e9) a transgenic cell comprising the recombinant vector described in e5);

[0053] e10) a recombinant microorganism containing the nucleic acid molecule described in e2);

[0054] e11) a recombinant microorganism containing the expression cassette described in e3);

[0055] e12) a recombinant microorganism containing the recombinant vector described in e4);

[0056] e13) A recombinant microorganism containing the recombinant vector described in e5).

[0057] Preferably, the SlMYB52 protein inhibitor comprises a CRISPR / Cas system targeting the SlMYB52 protein, and the CRISPR / Cas system comprises sgRNA.

[0058] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 4.

[0059] Preferably, the CRISPR / Cas system targeting SlMYB52 protein further comprises Cas protein and / or biological material associated with Cas protein; the biological material comprises: at least one of f1) to f12): f1) a nucleic acid molecule encoding Cas protein; f2) an expression cassette comprising the nucleic acid molecule of f1); f3) a recombinant vector comprising the nucleic acid molecule of f1); f4) a recombinant vector comprising the expression cassette of f2); f5) a transgenic cell comprising the nucleic acid molecule of f1); f6) a transgenic cell comprising the expression cassette of f2); f7) a transgenic cell comprising the vector of f3); f8) a transgenic cell comprising the vector of f4); f9) a recombinant microorganism containing the nucleic acid molecule of f1); f10) a recombinant microorganism containing the expression cassette of f2); f11) a recombinant microorganism containing the recombinant vector of f3); f12) a recombinant microorganism containing the recombinant vector of f4).

[0060] Preferably, the Cas protein comprises a Cas9 protein.

[0061] A fourth aspect of the present invention provides a method comprising: a step of reducing the expression level and / or activity of the SlMYB52 protein in tomatoes.

[0062] Preferably, the method is at least one of g1) to g2): g1) a method for reducing lateral buds of tomatoes; g2) a method for cultivating tomato varieties.

[0063] Preferably, the tomato variety comprises the following characteristics: reduced lateral buds.

[0064] Preferably, the tomato variety comprises the following characteristics: the number and / or length of lateral buds are reduced relative to a reference level; the reference level is the level of the wild type.

[0065] Preferably, the step of reducing the expression level and / or activity of the SlMYB52 protein in tomatoes is to introduce at least one of h1) to h3) into tomato tissues and / or tomato cells.

[0066] h1) the above-mentioned sgRNA; h2) the biological material of the above-mentioned sgRNA; h3) the above-mentioned CRISPR / Cas system.

[0067] Preferably, the introduction method includes various conventional or specific genetic transformation methods such as using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0068] A fifth aspect of the present invention provides a method comprising: a step of increasing the expression level and / or activity of the SlMYB52 protein in tomatoes.

[0069] Preferably, the method is at least one of i1) to i2): i1) a method for increasing lateral buds of tomatoes; i2) a method for cultivating tomato varieties.

[0070] Preferably, the tomato variety comprises the following characteristics: increased lateral buds.

[0071] Preferably, the tomato variety comprises the following characteristics: the number and / or length of lateral buds are reduced relative to a reference level; the reference level is the level of the wild type.

[0072] Preferably, the step of increasing the expression level and / or activity of the SlMYB52 protein in tomatoes is to introduce a nucleic acid molecule encoding the SlMYB52 protein into tomato tissues or tomato cells.

[0073] The beneficial effects of the present invention are:

[0074] The present invention is the first to discover the application of tomato SlMYB52 in tomato variety breeding. SlMYB52 can regulate tomato salt tolerance, biomass accumulation, photosynthesis level, plant height, number of lateral buds and other aspects. The present invention is the first to construct a tomato SlMYB52 Gene overexpression and gene knockout transgenic plants, and functional studies. SlMYB52 The gene can regulate the number and length of tomato lateral buds. SlMYB52 The gene provides genetic resources for breeding new varieties of tomatoes that are easy to care for, and has good potential application value. In the field of modern agricultural industry, the cultivation of tomatoes with few side buds can produce fruits earlier, increase yields, improve quality, reduce inputs, and increase land utilization. It is of great significance and wide application value for promoting the commercialization and modernization of tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 In Example 3 of the present invention SlMYB52 Western Blot detection results of genes and proteins in gene overexpression tomato lines; A is tomato SlMYB52 A is the expression level of the gene, and B is the expression level of tomato SlMYB52 protein.

[0076] Figure 2 The mutant in Example 3 of the present invention myb52 Sequencing results of sgRNA sequences of plants and mutant materials SlMYB52 Gene expression level; A mutant myb52 Simple diagram of the sequencing results of the sgRNA sequences of plants, B is tomato SlMYB52 Gene expression levels.

[0077] Figure 3 The tomato in Example 1 of the present invention is treated with salt stress at different times. SlMYB52 Changes in gene expression and protein accumulation; A is tomato SlMYB52 A is the expression level of the gene under salt stress, and B is the expression level of tomato SlMYB52 protein under salt stress.

[0078] Figure 4 The wild-type plants and overexpression plants in Example 1 of the present invention are MYB52 -OE and mutants myb52 Aboveground growth phenotype, fresh weight and dry matter accumulation level of plants after 7 days of normal and salt stress treatment; A is the aboveground growth of tomatoes, B is the aboveground fresh weight level of tomatoes, C is the decrease ratio of aboveground fresh weight of tomatoes of the three materials under salt stress, D is the aboveground dry weight level of tomatoes, and E is the decrease ratio of aboveground biomass of tomatoes of the three materials under salt stress.

[0079] Figure 5 The wild-type plants and overexpression plants in Example 1 of the present invention are MYB52 -OE and mutants myb52 Statistical results of plant heights after 7 days of normal and salt stress treatment; A is the statistical result of tomato plant heights, and B is the percentage of tomato plant height decrease in the three materials under salt stress.

[0080] Figure 6 The wild-type plants and overexpression plants in the embodiments of the present invention are MYB52 -OE and mutants myb52 Root growth phenotype, fresh weight and dry matter accumulation level of plants after 7 days of normal and salt stress treatment; among them, A is the growth of the underground part of tomatoes, B is the fresh weight level of tomato roots, C is the decrease ratio of fresh weight of tomato roots of the three materials under salt stress, D is the dry weight level of tomato roots, and E is the decrease ratio of root biomass of tomato roots of the three materials under salt stress.

[0081] Figure 7 The wild-type plants and overexpression plants in Example 1 of the present invention are MYB52 -OE and mutants myb52 Relative conductivity levels of leaves of plants after 7 days of normal and salt stress treatments.

[0082] Figure 8 The wild-type plants and overexpression plants in Example 1 of the present invention are MYB52 -OE and mutants myb52 Changes in the maximum photochemical efficiency (Fv / Fm) of PSII in leaves of plants after 7 days of normal and salt stress treatments.

[0083] Fig. 9 The wild-type plants and overexpression plants in Example 1 of the present invention are MYB52 -OE and mutants myb52The statistical results of tomato lateral bud growth phenotype, lateral bud number and length under normal growth conditions (no salt stress); among them, A is the lateral bud phenotype shooting result, B is the statistical result of total lateral bud length, and C is the number of lateral buds per plant. DETAILED DESCRIPTION

[0084] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0085] Significance statement: The data of the following examples of the present invention are expressed as mean ± standard deviation (n = 4), and * and different letters represent significant differences between treatments ( P <0.05, Student's t test or Tukey's test) where * stands for Student's t test and letters stand for Tukey's test.

[0086] Example 1 SlMYB52 Construction of gene overexpression vector

[0087] SlMYB52 The gene is derived from tomato, and its ID number in the tomato genome database (https: / / solgenomics.net / ) is Solyc03g093890, and its nucleic acid sequence is shown in SEQ ID NO: 1. SlMYB52 The effect of overexpression on the salt stress resistance of tomatoes was first cloned from the tomato genome. SlMYB52 Gene. According to the sequence analysis of the coding region, design specific primers SlMYB52 -F and SlMYB52 -R, and added restriction enzyme sites (AscI and KpnI) to the primers. SlMYB52 The sequence of -F is: ttacaattaccatggggcgcgccATGCCAAGGGTACAACAACAGC (5′-3′, SEQ ID NO: 2); SlMYB52 The sequence of -R is: aacatcgtatgggtaggtaccGATATTTCCAAGTACATCAATCCAGAA (5'-3', SEQ ID NO: 3). PCR amplification using KOD high-fidelity enzyme SlMYB52The fragment was then digested with enzymes for the PCR amplified fragment and the vector, and the SlMYB52 fragment was connected to pFGC1008-HA to obtain the plant overexpression vector pFGC1008::SlMYB52-HA. The above recombinant plasmid was sent to Youkang Company for sequencing confirmation, and the nucleotide sequence of the obtained gene SlMYB52 is shown in SEQ ID NO:1. The results showed that the cloned sequence was consistent with the sequence published in Solgenomics (Solyc03g093890), and the positive plasmid was extracted for use and named pFGC1008::SlMYB52-HA.

[0088] Example 2 SlMYB52 Construction of CRISPR / Cas9 gene knockout vector

[0089] To explore SlMYB52 Effect of gene deletion on salt tolerance of tomatoes. SlMYB52 The target gene sequence was sequenced and the pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-cas9SK vector was constructed by enzyme cutting and ligation. The SlMYB52 gene knockout material was constructed using CRISPR / Cas9 technology for research.

[0090] First, we designed the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). SlMYB52The target sequence of the gene, specifically the sequence of sgRNA1: GGAGGCGATCATAAAGAAGG (5'-3', SEQ ID NO: 4). The synthesized sgRNA1 sequence (single strand) was annealed to form a double-stranded sgRNA1, and both ends of the sgRNA1 had BbsI restriction endonuclease sites. The formed sgRNA1 was connected to the AtU6-26SK vector digested with BbsI restriction endonuclease, and the positive plasmid was extracted for standby use, named U6-26-sgRNA1-SlMYB52-SK. The U6-26-sgRNA1-SlMYB52-SK and 35S-Cas9SK vectors were double-digested with KpnI and SalI restriction endonucleases at the same time, and the respective digestion products were recovered and the digested U6-26-sgRNA1-SlMYB52-SK fragments were connected to the 35S-Cas9SK vector that was also digested with the same enzymes. The primers for bacterial liquid PCR detection were U6-26-F: GACGGCCAGTGAATTGTA (5'-3', SEQ ID NO: 5), U6-26-R: TATCTAAGCGATGTGGGACT (5'-3', SEQ ID NO: 6), and the positive clones were verified by sequencing. The positive plasmid was extracted for standby use and named U6-26-sgRNA1- SlMYB52-35S-cas9SK. The U6-26-sgRNA1- SlMYB52-35S-cas9SK and pCAMBIA1301 vector were double-digested with KpnI and XbaI restriction endonucleases at the same time. The U6-26-sgRNA1- SlMYB52-35S-cas9SK recovered a band of about 6 kb, namely the U6-26-sgRNA1- SlMYB52-35S-cas9 fragment, which was ligated to the digested pCAMBIA1301 vector. The ligation product was transformed into E. coli DH5α competent cells, and a single colony was picked and cultured overnight in liquid LB medium containing 50 mg / L kanamycin (Kan) at 37°C and 200 rpm. Primers were designed at the 5' end of the pCAMBIA1301 vector for bacterial liquid PCR detection (~550 bp). The upstream and downstream primers were U6-26-Cas9-F: GCTCGTATGTTGTGTGGAAT (5'-3', SEQ ID NO: 7) and U6-26-Cas9-R: TATCTAAGCGATGTGGGACT (5'-3', SEQ ID NO: 8). The positive clones were verified by sequencing by Youkang Company, and the positive plasmid was extracted for standby use, named pCAMBIA1301-U6-26-sgRNA1- SlMYB52-35S-cas9.

[0091] Example 3 SlMYB52 Obtaining transgenic plants

[0092] The plant overexpression vector pFGC1008::SlMYB52-HA and the gene editing vector pCAMBIA1301-U6-26-sgRNA1-Sl MYB52-35S-cas9 were transformed into Agrobacterium GV3101 by electroporation, and wild-type (Ailsa Craig) tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance induction differentiation and rooting culture, and single plant verification and harvesting were performed. The verification method is as follows: Fluorescence quantitative experiment and Western Blot verification SlMYB52 The results of fluorescence quantitative experiments showed that the overexpression positive transgenic plants were significantly higher than those of the wild type. SlMYB52 Gene expression was significantly upregulated (e.g. Figure 1 The results of Western Blot experiments showed that there was no SlMYB52-HA protein band in the wild type, and obvious SlMYB52-HA bands appeared in the overexpression plants (as shown in Figure 1 The primer sequences used in the fluorescence quantitative experiment are as follows: RT-SlMYB52-F: CCAACCACATTCCATTCCCC (5'-3', SEQ ID NO: 9), RT-SlMYB52-R: AACTAGGACCTGCACATGGG (5'-3', SEQ ID NO: 10), RT-SlACTIN2-F: TGTCCCTATTTACGAGGGTTATGC (5'-3', SEQ ID NO: 11), RT-SlACTIN2-R: CAGTTAAATCACGACCAGCAAGAT (5'-3', SEQ ID NO: 12), RT-SlUBI3-F: GCCGACTACAACATCCAGAAGG (5'-3', SEQ ID NO: 13), RT-SlUBI3-R: TGCAACACAGCGAGCTTAACC (5'-3', SEQ ID NO: 14).

[0093] The positive results were verified by DNA extraction, PCR and sequencing of plant tissues. SlMYB52 Mutant transgenic plants (plants transformed with the pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-cas9 vector prepared in Example 2), sequencing results showed that the mutant myb52 Plants (SlMYB52 CRISPR / Cas9 knockout lines) lacking 1 base (e.g. Figure 2 As shown in A in the figure, and due to the base deletion, the stop codon appears early to stop translation, thereby achieving the effect of inactivating the function of MYB52 protein. This example also detects the wild type and mutant myb52In leaves MYB52 The expression level of the gene was found to be MYB52 Gene expression showed a sharp decrease in the mutant. myb52 Almost undetectable in the material MYB52 Gene expression (e.g. Figure 2 (shown in B).

[0094] Effect Example 1 SlMYB52 Evaluation of salt tolerance in transgenic plants

[0095] 1. Experimental Materials

[0096] The tomato varieties selected for the experiment were wild-type Ailsa Craig and the SlMYB52 overexpression and SlMYB52 CRISPR / Cas9 knockout strains obtained in Example 3.

[0097] 2. Experimental methods

[0098] Tomato seeds were sterilized by soaking in 55°C hot water for 15 min and then transferred to a shaking incubator at 28°C and 200 rpm for germination for 2 days. When about 80% of the seeds turned white, they were sown in 72-hole trays filled with a mixture of peat and vermiculite (2:1, v / v) for seedling cultivation in a plant factory. The growth conditions were: room temperature of 25°C / 20°C, photosynthetic photon flux density of 300 μmol·m -2 ·s -1 , the photoperiod is 12 / 12 h (day / night). After the seedlings emerge, water the substrate according to the moisture content to keep it moist. During the whole process, water the Hogland nutrient solution (PH1782, PHYGENE). When the tomato seedlings grow to 3 leaves and 1 heart (about 15 days after sowing), the seedlings are transplanted into nutrient pots with a diameter of 10 cm and a depth of 9 cm and planted in the plant factory.

[0099] Salt stress treatment and control: When the tomato seedlings grow to five leaves and one heart, salt stress treatment is carried out: 200 mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250 mM NaCl per plant is used as salt stress treatment, and the same volume (200 mL) of Hoagland nutrient solution containing 0 mM NaCl is used as control. Root irrigation treatment is carried out respectively, and treatment is carried out once every three days. After 7 days of salt stress treatment, phenotypic photography, dry weight, maximum photochemical efficiency of photosystem II and relative conductivity are calculated; for gene and protein experiments under salt stress response, RNA and protein sampling are carried out at 0h, 6h, 12h, 24h, 48h, and 72h of salt stress treatment.

[0100] Tomato total RNA extraction, cDNA synthesis and gene expression analysis: RNA was extracted from young tomato leaves treated with salt stress for 0h, 6h, 12h, 24h, 48h and 72h. After the plant leaf tissue was ground with liquid nitrogen, the total RNA of the tissue was extracted using the Plant Total RNA Extraction Kit (Tiangen, Beijing) according to the instructions. After confirming the concentration and quality of the RNA sample with Nanodrop, the RNA was reverse transcribed into cDNA using the ReverTraAce qPCR RT Kit (Toyobo) (containing genomic DNA removal enzyme) according to the instructions. Real-time fluorescence quantitative PCR used the SYBR fluorescent dye kit (Takala) and the PCR reaction was performed on the Roche light cycler480PCR instrument. Tomato ACTIN2 and UBI3 ( Ubiquitin 3 ) gene was used as an internal reference, and the relative expression of the gene was calculated according to the method of (Livak and Schmittgen., 2001).

[0101] Protein extraction and Western-blot detection of tomato leaves: For the extraction of total tomato protein, young tomato leaves treated with salt stress for 0h, 6h, 12h, 24h, 48h, and 72h were taken. About 0.1 g was ground into powder in liquid nitrogen, and 0.2~0.3mL of extraction solution (100 mM HEPES, pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 10 mM NaVO3,10 mM NaF, 50 mM-glycerophosphate, 10% (v / v) glycerol, 1 mM PMSF and 5% (w / v) PVPP) was added. After vortex mixing, centrifugation was performed at 13000 rpm and 4 ℃ for 20 min. The supernatant was the obtained protein. The protein content was quantified using Coomassie Brilliant Blue, and the supernatant was mixed with 2× loading buffer (250 mM Tris-HCl, pH 6.8, 10% (w / v) SDS, 0.5% (w / v) bromophenol blue, 50% (v / v) glycerol, 10 mM DTT) were mixed in equal volumes and heated at 95 °C for 10 min. 80 or 100 μg of total protein were separated by 10% (w / v) SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. After blocking with TBST (20 mM Tris, pH 7.5, 30 mM NaCl, 0.05% (v / v) Tween 20) containing 5% (w / v) BSA at room temperature for 1 h, the membrane was washed 3-5 times with TBST, 5 min each time.

[0102] For MYB52 protein: Incubate with 0.1% (v / v) HA polyclonal antibody (Abcam, ab18181, Cambridge, MA, USA) at room temperature for 1 h, then wash and incubate with anti-mouse-HRP conjugated antibody (Abcam, ab205719, Cambridge, MA, USA) at room temperature for 1 h. Wash the membrane with TBST 5 times, 5 min each time. Finally, use the high-sensitivity chemiluminescence kit (Perkin Elmer, Massachusetts, USA) to observe the signal on the blot according to the manufacturer's instructions. Plant actin monoclonal antibody (Plant actin Monoclonal Antibody, Q30, Cat#YM3034) was used as a control for Western-blot analysis.

[0103] The relative conductivity of the plant was determined as follows: the tomato leaves after treatment were cut into strips of appropriate length (avoiding the main veins), and three fresh samples were weighed quickly, each weighing 0.2 g, and placed in graduated centrifuge tubes containing 20 mL of deionized water, covered with lids, and placed in a 28°C shaker for 1.5 h-2 h. The conductivity R1 of the extract was measured with a conductivity meter, and then heated in a boiling water bath for 15 min, cooled to room temperature, and shaken, and the conductivity R2 of the extract was measured again. Relative conductivity = R1 / R2*100%.

[0104] The specific method for determining the maximum photochemical efficiency of photosystem II was as follows: after the plants were placed in a dark environment for 30 minutes, a chlorophyll fluorescence imager (IMAG-PAM; Heinz Walz, Germany) was used to irradiate the plants with detection light (<0.5 μmol m- 2 s -1 ), the minimum fluorescence Fo was measured, and then saturation pulse light (4000 μmol m -2 s -1 ), and measure the maximum fluorescence Fm.

[0105] Calculation method of fluorescence parameters: PSⅡ maximum photochemical efficiency (Fv / Fm) = (Fm-Fo) / Fm.

[0106] The observation and statistical methods of tomato lateral branch phenotype were as follows: the three materials of tomatoes were grown under the above normal conditions (no salt stress treatment) for about 50 days (10-12 leaf stage), the lateral bud phenotype was observed and photographed, and the length and number of lateral buds were counted. The total lateral bud length of the three materials was counted from the bottom to the top of the lateral bud length of 10 nodes starting from the first true leaf, and the sum was the total length of the lateral bud; the number of lateral buds per plant was counted according to the length of the lateral bud at each node greater than 0.3 cm, 15 replicates were added for each treatment, and the independent experiment was repeated 3 times.

[0107] 2. Experimental results

[0108] 1) Tomato SlMYB52 responds to salt stress

[0109] The tomato varieties selected for the experiment were wild-type Ailsa Craig and the SlMYB52 overexpression and SlMYB52 CRISPR / Cas9 knockout strains obtained in Example 3. The seeds were sown in plastic pots filled with a 3:1 peat and vermiculite composite cultivation matrix. After emergence, the matrix was watered according to the moisture content of the matrix to keep the matrix moist. The Hoagland nutrient solution was watered throughout the process. When the tomato seedlings grew to five leaves and one heart, salt stress treatment was carried out: 200 mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250 mM NaCl per plant was used for salt stress treatment, and an equal volume (200 mL) of Hoagland nutrient solution containing 0 mM NaCl was used as a control. Root irrigation treatment was performed respectively, and the treatment was performed once every three days. After 7 days of salt stress treatment, phenotypic photography was performed, and the dry weight, maximum photochemical efficiency of photosystem II and relative conductivity were calculated. For gene and protein experiments under salt stress response, RNA and protein sampling were performed at 0h, 6h, 12h, 24h, 48h and 72h of salt stress treatment.

[0110] First, wild-type Ailsa Craig tomato seedlings grown to five leaves and one heart were treated with salt stress by applying 200 mL of Hoagland nutrient solution containing 250 mM NaCl to each plant. RNA and protein samples were collected at 0h, 6h, 12h, 24h, 48h, and 72h of salt stress treatment, and related tests were performed. SlMYB52 The results of gene transcription are as follows Figure 3 As shown in A, the expression results of SlMYB52 protein are as follows Figure 3 As shown in B. Salt stress can significantly induce SlMYB52 The transcription of MYB52 and the accumulation of MYB52 protein increased with the increase of salt stress treatment time. SlMYB52 The transcription of the gene showed a trend of increasing first and then gradually decreasing. Salt stress treatment for 6 h induced SlMYB52The gene expression level was the highest; and the MYB52 protein also showed a trend of gradually accumulating and then decreasing with the increase of salt stress treatment time. Salt stress treatment for 24 hours promoted the accumulation of SlMYB52 protein. The above results show that tomato SlMYB52 responds to salt stress.

[0111] 2) Effects of SlMYB52 on tomato phenotype

[0112] Then, the five-leaf, one-heart wild-type tomato seedlings (WT) and the SlMYB52 gene overexpression strain obtained in Example 3 ( MYB52 -OE) and mutant lines ( myb52 ) were treated with salt stress: 200 mL of Hoagland's nutrient solution containing 250 mM NaCl per plant was used as salt stress treatment, and an equal volume (200 mL) of Hoagland's nutrient solution containing 0 mM NaCl was used as control. Root irrigation was performed every three days, and the growth phenotype and salt damage phenotype of the wild-type, overexpression and mutant tomato plants were observed after one week.

[0113] The actual shooting results of the aboveground growth of tomatoes are as follows Figure 4 As shown in A, the fresh weight of the aboveground parts is as follows Figure 4 As shown in B, the aboveground fresh weight of tomatoes of the three materials decreased by Figure 4 As shown in C, the aboveground dry weight is as follows Figure 4 As shown in D, the aboveground biomass of tomatoes in the three materials decreased by more than Figure 4 As shown in E. The effect of salt stress on the growth and development of individual plants can be manifested in many aspects. Among them, the change in plant biomass is an intuitive reflection of the plant's salt stress. It is also a direct indicator of plant tolerance. To a certain extent, it can reflect the plant's growth condition and ability to resist salt stress. The results showed that after wild-type tomato plants were subjected to salt stress, the leaves turned yellow, and the aboveground fresh weight and biomass decreased significantly, with a decrease of 32.1% and 42.4%, respectively. myb52 The plant's tolerance to salt stress is the worst. myb52 The leaves at the base of the plant's aboveground stems turn yellow and fall off and die (such as Figure 4 Moreover, after salt stress myb52 The mutant plants had the largest decreases in aboveground fresh weight and dry weight, with decreases of 51.5% and 62.8%, respectively. MYB5 2-OE plants had the strongest tolerance to salt stress. MYB52 -OE plants still have bright green leaves, no yellowing of leaves, and MYB52 -OE plants had the smallest decrease in aboveground fresh weight and biomass after salt stress, with decreases of 19% and 34.8%, respectively (e.g. Figure 4 BE).

[0114] The statistical results of tomato plant height phenotype are as follows Figure 5 The statistical results of tomato plant height are shown in Figure 5 As shown in A, the height of tomatoes in the three materials decreased by more than Figure 5 As shown in B. Studies have shown that under normal growth conditions, the mutant myb52 The maximum plant height was 25.1 cm, which was significantly higher than that of WT and MYB52 -OE plants, while overexpressing SlMYB52 The height of the plants was significantly lower than that of the wild-type plants, only 12.3 cm. The salt tolerance of crops can be identified by indicators such as plant dry matter and plant height, among which plant height is one of the more sensitive indicators of salt stress. The study also found that under salt stress treatment, WT, MYB52 -OE and myb52 The plant heights of the three plants were significantly reduced, but under salt stress MYB52 -OE plants had the lowest height reduction rate of 23.3%. myb52 The highest reduction in plant height of mutant plants was 40.8%, which further proved that MYB52 -OE plants have a stronger tolerance to salt stress.

[0115] The actual shooting results of the underground growth of tomatoes are as follows Figure 6 As shown in A, the fresh weight of underground parts is as follows Figure 6 As shown in B, the fresh weight of tomato roots of the three materials decreased by Figure 6 As shown in C, the root dry weight measurement results are as follows Figure 6 As shown in D, the root biomass of tomatoes in the three materials decreased by more than Figure 6 As shown in E. Salt stress can significantly inhibit the growth of tomatoes, resulting in short plants, yellowing leaves, and poor root development. Root changes are also one of the indicators for measuring salt stress resistance. The study found that the root system of WT tomato plants was significantly inhibited under salt stress, the number of roots decreased, and the fresh weight and dry weight of the roots were significantly reduced. Compared with the control without salt stress, the decrease rates were 34.8% and 32.5%, respectively. myb52 When plants were subjected to salt stress, their root system was most severely inhibited, the root system was the shortest and the least, and the fresh weight and dry weight of the root system decreased most significantly, with a decrease of 49.9% and 41.4% respectively. MYB52 -OE plants had the least root inhibition, and the fresh weight and dry weight of the roots decreased the least, with the decrease rates being 25.3% and 19.6% respectively. MYB52 The root system of -OE plants was least affected by salt stress and had the strongest tolerance to salt stress.

[0116] Overall, MYB52 -OE plants have the strongest tolerance to salt stress. Their leaves remain dark green without yellowing or falling off. They have long roots and many lateral roots and are basically not inhibited. The decline in aboveground and root biomass is the lowest, and they can accumulate more biomass under salt stress.

[0117] The conductivity measurement results of tomato leaves are as follows Figure 7 As shown. Under normal circumstances, plant cell membranes have the ability to selectively permeate substances. When plants are affected by stressful environments, cell membranes are damaged, membrane permeability increases, and electrolytes in cells leak out, resulting in increased conductivity of cell extracts. Therefore, the greater the relative conductivity, the greater the degree of damage to plant tissues and the more serious the leakage of cellular molecular substances. The results showed that under normal circumstances, there was no significant difference in the leaf conductivity content of the three materials; however, the leaf conductivity content of wild-type (WT) tomato plants increased significantly after salt stress, which was 134.0% higher than the control without salt stress. myb52 The leaf conductivity of mutant plants increased dramatically after salt stress, increasing by 177.1% compared with the control without salt stress; however MYB52 -OE plants had the lowest percentage of leaf conductivity increase under salt stress, at 71.8%, and the leaf conductivity increased under salt stress. MYB52 -OE plants were significantly lower than those in the wild type (WT) and myb52 The content in the mutant strains shows that overexpression MYB52 The gene can significantly improve the salt tolerance of tomatoes.

[0118] In addition, the maximum photochemical efficiency of photosystem II (PS II) of tomato plants was measured as follows Figure 8 As shown. The maximum photochemical efficiency of PSⅡ Fv / Fm is the most basic parameter in chlorophyll fluorescence parameters. It reflects the potential maximum photosynthetic capacity of plants and is an effective indicator for measuring the degree of light inhibition. The Fv / Fm of plant leaves that have not been subjected to adverse stress and have undergone sufficient dark adaptation is generally constant between 0.70 and 0.85. After suffering from adverse stress, the Fv / Fm of plant leaves will show a significant downward trend. Fv / Fm is the best indicator for measuring adverse stress. The results showed that under normal conditions (no salt stress control group), WT, MYB52 -OE and myb52 There was no significant difference in the leaf Fv / Fm of the three materials, all of which were around 0.81; however, the leaf Fv / Fm of the wild-type tomato (WT) obtained under salt stress showed a significant downward trend, from 0.81 to 0.53; myb52 The Fv / Fm ratio of the mutant plant leaves decreased most significantly, from 0.81 to 0.26. MYB52-OE plant leaves Fv / Fm decreased the least, from 0.81 to 0.63; under salt stress MYB52 The maximum photochemical quantum yield (Fv / Fm) of PSII in leaves of -OE plants was significantly higher than that of wild-type tomatoes (WT), while under salt stress myb52 The mutant plant had the lowest Fv / Fm in its leaves. MYB52 -OE plants had the strongest tolerance to salt stress and their light absorption capacity after salt stress was closer to the normal level.

[0119] Next, wild-type tomato seedlings (WT) and the SlMYB52 Gene overexpression lines ( MYB52 -OE) and mutant lines ( myb52 ) were grown under the above normal conditions (without salt stress treatment) for about 50 days (10-12 leaf stage), the lateral bud phenotype was observed and photographed, and the length and number of lateral buds were counted.

[0120] The actual shooting results of the growth of the aboveground lateral branches of tomatoes are as follows Fig. 9 As shown in A, the total length of the lateral buds is as follows Fig. 9 As shown in B, the number of lateral buds per plant is as follows Fig. 9 As shown in C. The results show that SlMYB52 Genes involved in regulating the number and length of tomato lateral buds MYB52 -OE plants had significantly higher number and length of lateral buds than WT plants and mutants myb52 Plant, mutant myb52 The plant has the shortest and fewest lateral buds.

[0121] In summary, SlMYB52 Genes are of great value in the field of modern tomato agriculture. SlMYB52 Tomato plants with the knockout gene have taller plants and fewer lateral buds. The tomato planting process has a problem of many lateral branches, tedious pruning and high labor costs. SlMYB52Genetic tomato plants can reduce the number and length of tomato side branches, which has important theoretical and application value for reducing tomato pruning and branching, optimizing plant type, and promoting light and simplified tomato cultivation. Tomato is a vegetable crop widely grown worldwide. The growth of its side branches affects the aboveground morphology of the plant, and a good plant type is the key to efficient use of light energy and yield formation. Tomatoes have a strong ability to branch out, and side branches can be formed in each leaf axil, thereby competing for nutrients required for plant growth and flowering and fruiting. Reasonable pruning and side branch removal of tomatoes is the key to utilizing vertical space and increasing group yield. Side branches are an important part of the aboveground plant type and have plasticity. The aboveground plant type of plants is the main factor of "yield per unit area", which is of great significance to agricultural practices such as agricultural mechanization. As one of the model plants for studying branching, important indicators such as tomato yield, quality and production efficiency are all affected by branching. Tomato has many branches, which are easy to shade each other and cause pests and diseases. In production, it is often necessary to prune and prune to improve fruit yield and quality, which also greatly increases production management costs and is not conducive to improving economic benefits. Therefore, a transgenic plant of tomato SlMYB52 gene overexpression and gene knockout was constructed by technical means such as transgenic, and it was found for the first time that SlMYB52 gene can regulate the number and length of lateral buds of tomato. The SlMYB52 gene provided by the present invention provides gene resources for cultivating new varieties of tomatoes that are easy to take care of, and has good potential application value. In the field of modern agricultural industry, the cultivation of tomatoes with few lateral buds can bear fruit early, increase yield, improve quality, promote the simplified cultivation of tomatoes, reduce input, and improve land utilization, which is of great significance and wide application value for promoting the commercialization of tomatoes and the process of modern breeding.

Claims

1. Application of knocking out or knocking down the SlMYB52 gene in reducing tomato lateral buds; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO: 1; The reducing of tomato lateral buds includes reducing the length of tomato lateral buds and / or reducing the number of tomato lateral buds.

2. Use of biological materials related to overexpression of SlMYB52 gene in at least one of b1) to b2): b1) Increase the side shoots of tomatoes; b2) preparing a product for increasing lateral sprouts of tomatoes; The increasing of tomato lateral buds includes increasing the length of tomato lateral buds and / or increasing the number of tomato lateral buds; The biological material related to overexpression of the SlMYB52 gene comprises at least one of c1) to c12): c1) a nucleic acid molecule that overexpresses the S1MYB52 gene; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1); c4) a recombinant vector containing the expression cassette described in c2); c5) a recombinant cell containing the nucleic acid molecule described in c1); c6) a recombinant cell containing the expression cassette described in c2); c7) a recombinant cell containing the recombinant vector described in c3); c8) a recombinant cell containing the recombinant vector described in c4); c9) a recombinant microorganism containing the nucleic acid molecule described in c1); c10) a recombinant microorganism containing the expression cassette described in c2); c11) a recombinant microorganism containing the recombinant vector described in c3); c12) a recombinant microorganism containing the recombinant vector described in c4); The tomato variety comprises the following characteristics: the tomato has increased lateral shoots; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO:

1.

3. Use of SlMYB52 gene inhibitor in at least one of d1) to d2): d1) Reduce the side shoots of tomatoes; d2) preparing a product for reducing lateral sprouts in tomatoes; The tomato variety comprises the following characteristics: the tomato has reduced lateral buds; The reducing of tomato lateral buds comprises reducing the length of tomato lateral buds and / or reducing the number of tomato lateral buds; The SlMYB52 gene inhibitor is a CRISPR / Cas9 system targeting the SlMYB52 gene described in claim 1, wherein the CRISPR / Cas9 system comprises sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 4; The CRISPR / Cas9 system further comprises a Cas protein and / or biological materials related to the Cas protein; the biological materials comprise at least one of: f1) to f8): f1) a nucleic acid molecule encoding the Cas protein; f2) an expression cassette comprising the nucleic acid molecule described in f1); f3) a recombinant vector comprising the nucleic acid molecule described in f1); f4) a recombinant vector comprising the expression cassette described in f2); f5) a recombinant microorganism containing the nucleic acid molecule described in f1); f6) a recombinant microorganism containing the expression cassette described in f2); f7) a recombinant microorganism containing the recombinant vector described in f3); f8) a recombinant microorganism containing the recombinant vector described in f4); The Cas protein is Cas9 protein; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO:

1.

4. A method for reducing lateral buds of tomatoes, comprising: reducing the expression level of the SlMYB52 gene in tomatoes; The tomato variety comprises the following characteristics: the lateral buds are reduced; the number and / or length of the lateral buds are reduced relative to a reference level; the reference level is the level of the wild type; The step of reducing the expression level of the SlMYB52 gene in tomatoes is to introduce at least one of h1) to h3) into tomato tissues and / or tomato cells; h1) the sgRNA described in claim 3; h2) the biological material of the sgRNA described in claim 3; h3) the CRISPR / Cas9 system described in claim 3; The introduction method includes at least one of using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

5. A method for increasing lateral buds of tomatoes, comprising: increasing the expression level of the SlMYB52 gene in tomatoes; The tomato variety comprises the following characteristics: the lateral buds are increased; the number and / or length of the lateral buds are increased relative to a reference level; the reference level is the level of the wild type; The step of increasing the expression level and / or activity of the SlMYB52 gene in tomatoes is to introduce the nucleic acid molecule for overexpressing the SlMYB52 gene as described in claim 2 into tomato tissues or tomato cells; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO: 1.

Images