Molecular marker for stem strength of tartary buckwheat and its application in identifying stem strength trait of tartary buckwheat
By using molecular markers at 358,296,60 bp on chromosome 1 of tartary buckwheat and KASP molecular marker primer sets, the stem strength of tartary buckwheat can be rapidly identified, solving the problem of screening and identification difficulties in existing technologies and improving the efficiency of germplasm breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANXI AGRI UNIV
- Filing Date
- 2024-06-06
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies make it difficult to efficiently screen and identify the strength of buckwheat stalks, affecting its yield and quality. Furthermore, the lodged crop stalks are not easy to recycle and process, which affects their economic value.
A molecular marker for tartary buckwheat stem strength is provided, located at 358,296,60 bp on chromosome 1. PCR amplification and genotyping using the KASP molecular marker primer set can rapidly identify stem strength.
It enables rapid screening and identification of tartary buckwheat with strong stems, improves germplasm breeding efficiency, is stable and reliable, and reduces environmental impact.
Smart Images

Figure CN118563002B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to molecular markers for tartary buckwheat stem strength and their application in identifying tartary buckwheat stem strength traits. Background Technology
[0002] Tartary buckwheat is an annual herbaceous plant belonging to the class Dicotyledonous, order Polygonales, family Polygonaceae, and genus Fagopyrum. It has a short growth cycle, is tolerant of poor soil, and exhibits strong adaptability to adverse conditions, making it an excellent crop for filling gaps, disaster relief, and environmental friendliness. However, because tartary buckwheat is mostly grown in high-altitude, cold mountainous areas with poor soil and harsh climates, cultivation and management techniques are relatively backward. Furthermore, the tall, hollow stems of cultivated tartary buckwheat plants are prone to lodging, severely impacting its yield and quality. In addition, while crop stems contain a large amount of organic matter that can be recycled or processed into fertilizer, biofuel, and agricultural byproducts, lodged crop stems are not only difficult to recycle but also suffer a significant reduction in quality, affecting their economic value.
[0003] With increasing consumer demand for tartary buckwheat products, cultivating lodging-resistant varieties has become a key focus of tartary buckwheat research. In 2020 and 2021, a two-year, three-location trial was conducted in Datong, Kelan, and Taigu ecological zones. Correlation analysis of lodging-resistant traits at harvest revealed a highly significant negative correlation between stem strength and lodging index. Therefore, identifying molecular markers for stem strength in tartary buckwheat, cultivating tartary buckwheat germplasm with strong stem strength, and improving the breeding efficiency of such germplasm are particularly important. Summary of the Invention
[0004] The purpose of this invention is to provide molecular markers for tartary buckwheat stem strength and their application in identifying tartary buckwheat stem strength traits, to rapidly screen and identify tartary buckwheat with strong stem strength, to cultivate tartary buckwheat germplasm with strong stem strength, and to improve the breeding efficiency of tartary buckwheat germplasm with strong stem strength.
[0005] This invention provides a molecular marker for identifying the stem strength of tartary buckwheat. The molecular marker is located at 35,829,660 bp on chromosome 1 of tartary buckwheat and has a single nucleotide polymorphism of C / G.
[0006] The present invention also provides a DNA fragment for identifying the strength of buckwheat stems, the DNA fragment comprising a nucleotide sequence as shown in SEQ ID NO. 1, wherein Y in the nucleotide sequence is C / G.
[0007] The present invention also provides a KASP molecular marker primer set for detecting the molecular markers or DNA fragments described in the above technical solutions, wherein the KASP molecular marker primer set includes forward primer 1, forward primer 2 and reverse primer;
[0008] The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO. 2;
[0009] The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO. 3;
[0010] The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.4.
[0011] This invention also provides the application of the molecular markers or DNA fragments or KASP molecular marker primer sets described in the above technical solutions in buckwheat breeding.
[0012] This invention also provides the application of the molecular markers or DNA fragments or KASP molecular marker primer sets described in the above technical solutions in screening for tartary buckwheat with strong stem strength.
[0013] Preferably, the high-stem-strength buckwheat includes high-stem-strength buckwheat at the base of the stem.
[0014] Preferably, the stem base strong tartary buckwheat includes the stem base fifth internode strong tartary buckwheat.
[0015] The present invention also provides a method for identifying the strength of buckwheat stems, comprising the following steps:
[0016] The genomic DNA of the buckwheat to be identified was amplified by PCR using the KASP molecular marker primer set described in the above technical solution, and the amplification product was then used for KASP genotyping detection.
[0017] When the KASP genotyping result is CC type, the buckwheat to be identified is buckwheat with strong stem strength;
[0018] When the KASP genotyping result is GG or CG, the buckwheat to be identified is buckwheat with poor stem strength.
[0019] Preferably, the PCR amplification reaction system comprises, in 10 μL: 2 μL of 50-100 ng / μL genomic DNA, 0.14 μL of 100 μmol / L KASP molecular marker primer set, 5 μL of 2× Probe Mix A solution, and the remainder ddH2O;
[0020] The PCR amplification program is as follows: the first stage is pre-denaturation at 95℃ for 10 min; the second stage is denaturation at 95℃ for 20 s, followed by annealing at 55℃~61℃ for 40 s, for a total of 10 cycles; the third stage is denaturation at 95℃ for 20 s, followed by annealing at 55℃ for 40 s, for a total of 31 cycles.
[0021] Preferably, in the KASP molecular marker primer set, the concentration ratio of forward primer 1, forward primer 2 and reverse primer is 2:2:5.
[0022] Beneficial effects:
[0023] The molecular marker provided by this invention is located at 35,829,660 bp on chromosome 1 of Tartary buckwheat, and has a single nucleotide polymorphism of C / G. When the base is C, Tartary buckwheat exhibits the trait of strong stem strength. Based on this molecular marker, selection of different stem strengths in Tartary buckwheat can be achieved. Sample identification can be completed simply through DNA extraction, PCR-specific amplification, and KASP genotyping. This allows for the differentiation of Tartary buckwheat with strong and weak stem strength, rapid screening and identification of Tartary buckwheat with different stem strengths, improved breeding efficiency of Tartary buckwheat germplasm with strong stem strength, and provides a basis for utilizing superior allelic variations related to stem strength traits in Tartary buckwheat, thus accelerating the breeding process. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0025] Figure 1 The results are from the KASP experiment in Example 1 (KASP-6019600). Detailed Implementation
[0026] This invention provides a molecular marker for identifying the strength of buckwheat stems. The molecular marker is located at 35829660 bp on chromosome 1 of buckwheat and has a single nucleotide polymorphism of C / G.
[0027] The molecular markers described in this invention are significantly correlated with the stem strength trait of tartary buckwheat. The stem strength property of the tartary buckwheat to be tested can be determined by genotyping the molecular markers: when the molecular marker polymorphism is C, the tartary buckwheat trait is strong stem strength; when the molecular marker polymorphism is G, the tartary buckwheat trait is weak stem strength. The tartary buckwheat reference genome described in this invention is: http: / / www.mbkbase.org / Pinku1 / .
[0028] The present invention also provides a DNA fragment for identifying the strength of buckwheat stems, the DNA fragment comprising a nucleotide sequence as shown in SEQ ID NO.1, wherein Y (at 151 bp) in the nucleotide sequence is C / G.
[0029] The present invention also provides a KASP molecular marker primer set for detecting the molecular markers or DNA fragments described in the above technical solutions, wherein the KASP molecular marker primer set includes forward primer 1, forward primer 2 and reverse primer;
[0030] The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO. 2;
[0031] The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO. 3;
[0032] The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.4.
[0033] The nucleotide sequences described in SEQ ID NO. 1~4 of this invention are as follows:
[0034] SEQ ID NO.1: 5'-GCCGATTTAAATTTGATTCTAATAGGGTTGCTATAATAGTTGATTATTGGCATGCTCAACATATAACCCATTTTTCAAGTTGAAACTACATTTTATCCTAGTTTTAAAATATGTTCTAGTTTTAAAATATGTTCTATATTCAACTCGTTTA Y AAAGTGAACAAGTTTGAACCGGATTTTTTCTTATGAGTTTTTAATATATATTCATATTCAGCTCGTTTATAAAGTGAACGAGCTTGAGCCGAACTTTTTCCGAGCCGGGCACAAGTAGTTCGTCTAAACCACCCTATGAAAACTCATGACT-3'; where Y is C / G;
[0035] SEQ ID NO.2: 5'-AATCCGGTTCAAACTTGTTCACTTTc-3'; where lowercase letters represent bases at the linker.
[0036] SEQ ID NO.3: 5'-AATCCGGTTCAAACTTGTTCACTTTg-3'; where the lowercase letters are the bases at the linker;
[0037] SEQ ID NO. 4: 5'-GGCATGCTCAACATATACCCATT-3'.
[0038] This invention also provides the application of the molecular markers, DNA fragments, or KASP molecular marker primer sets described in the above-mentioned technical solutions in buckwheat breeding. In this invention, the breeding preferably includes cultivating buckwheat varieties with strong stems.
[0039] This invention also provides the application of the molecular markers, DNA fragments, or KASP molecular marker primer sets described in the above-mentioned technical solutions in screening for tartary buckwheat with strong stem strength. In this invention, the tartary buckwheat with strong stem strength preferably includes tartary buckwheat with strong stem strength at the base of the stem, and more preferably, tartary buckwheat with strong stem strength (N5) at the fifth internode of the base of the stem. The molecular markers described in this invention have a significant correlation with the stem strength of tartary buckwheat. The KASP molecular marker primer set using the described molecular markers can be used to detect the genotype of the tartary buckwheat to be tested, and the results are almost unaffected by the environment, with stable and reliable experimental results.
[0040] The present invention also provides a method for identifying the strength of buckwheat stems, comprising the following steps:
[0041] The genomic DNA of the buckwheat to be identified was amplified by PCR using the KASP molecular marker primer set described in the above technical solution, and the amplification product was then used for KASP genotyping detection.
[0042] When the KASP genotyping result is CC type, the buckwheat to be identified is buckwheat with strong stem strength;
[0043] When the KASP genotyping result is GG or CG, the buckwheat to be identified is buckwheat with weak stem strength.
[0044] This invention extracts genomic DNA from buckwheat. There are no special requirements regarding the species of buckwheat to be tested; any species can be used. The method for extracting the genomic DNA from the buckwheat is not particularly limited; conventional plant cell genome extraction methods in the art can be used. In the specific implementation of this invention, fresh leaves of the buckwheat to be tested are used as material, and the CTAB method is employed for extraction.
[0045] After obtaining the genomic DNA of the buckwheat to be tested, this invention uses the genomic DNA as a template and performs PCR amplification using the KASP molecular marker primer set described in the above technical solution to obtain the amplification product. In this invention, the PCR amplification reaction system is preferably 10 μL, preferably including 2 μL of 50~100 ng / μL genomic DNA, 0.14 μL of 100 μmol / L KASP molecular marker primer set, 5 μL of 2× Probe Mix A solution, and the balance ddH2O. The concentrations of forward primer 1, forward primer 2, and reverse primer in the KASP molecular marker primer set of this invention are preferably each independently 100 μmol / L; the concentration ratio of forward primer 1, forward primer 2, and reverse primer in the KASP molecular marker primer set is preferably 2:2:5. The 2× Probe Mix A solution of this invention is purchased from High Genotyping. The concentration of the tartary buckwheat genomic DNA described in this invention is preferably 50-100 ng / μL, more preferably 60-80 ng / μL, and even more preferably 65-70 ng / μL; the OD of the genomic DNA... 260 / OD 280 The ratio is preferably 1.7 to 2.0, and more preferably 1.8.
[0046] In this invention, the preferred PCR amplification procedure is as follows: a first stage of pre-denaturation at 95°C for 10 min; a second stage of denaturation at 95°C for 20 s, followed by annealing at 55°C to 61°C for 40 s, for a total of 10 cycles; and a third stage of denaturation at 95°C for 20 s, followed by annealing at 55°C for 40 s, for a total of 31 cycles. Preferably, in the second stage of this invention, the temperature is decreased by 0.6°C per cycle.
[0047] After obtaining the amplification product, the present invention preferably stores the amplification product at 4°C. The amplification product of the present invention contains the DNA fragment of the target molecular marker. KASP genotyping is performed on the amplification product to determine the genotype of the molecular marker, and the tartary buckwheat stem strength trait is identified based on the genotyping results. The detection of the present invention preferably uses Taqman Genotyper Software for analysis. The present invention preferably obtains the relative fluorescence values corresponding to HEX and FAM of the amplification product, performs clustering based on the relative fluorescence values, and determines the genotype based on the sample clusters. Specifically, when the fluorescence signal of the amplification product is red, the tartary buckwheat stem strength trait is identified as homozygous for strong stem strength, with the corresponding genotype being CC; when the fluorescence signal of the amplification product is blue, the tartary buckwheat stem strength trait is identified as homozygous for poor stem strength, with the corresponding genotype being GG; when the fluorescence signal of the amplification product is green, the tartary buckwheat stem strength trait is identified as heterozygous for poor stem strength, with the corresponding genotype being CG.
[0048] To further illustrate the present invention, the molecular markers for tartary buckwheat stem strength provided by the present invention and their application in identifying the tartary buckwheat stem strength trait are described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0049] Example 1
[0050] A method for detecting buckwheat stem strength using KASP technology, comprising the following steps:
[0051] 1. Experimental Materials
[0052] The study used 256 different varieties of tartary buckwheat as the test subjects.
[0053] 2. Extraction of genomic DNA
[0054] (1) The experimental materials were seedlings, fresh medium-sized leaves were quick-frozen in liquid nitrogen, and the obtained materials were stored in a -80℃ freezer for DNA extraction.
[0055] (2) DNA was extracted using the CTAB method to obtain genomic DNA and OD. 260 / OD 280 The ratio must be between 1.7 and 2.0.
[0056] 3. Genotyping using KASP technology
[0057] A primer set was designed targeting the 35,829,660 bp site on chromosome 1 of tartary buckwheat (sequence information from http: / / www.mbkbase.org / Pinku1 / ), specifically using the nucleotide sequence shown in SEQ ID NO.1 (labeled as KASP-6019600). The genomic DNA obtained in step 2 was then amplified by PCR.
[0058] The 5'-3' nucleotide sequences of the PCR amplification primers are as follows:
[0059] Forward primer 1: 5'-AATCCGGTTCAAACTTGTTCACTTTc-3' (SEQ ID NO.2);
[0060] Forward primer 2: 5'-AATCCGGTTCAAACTTGTTCACTTTg-3' (SEQ ID NO.3);
[0061] Reverse primer: 5'-GGCATGCTCAACATATACCCATT-3' (SEQ ID NO.4);
[0062] The primers mentioned above were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0063] The KASP testing process is as follows:
[0064] 1) Extract genomic DNA from the buckwheat to be tested;
[0065] 2) Using the genomic DNA of the buckwheat to be tested as a template, PCR amplification reaction was carried out using the above-mentioned forward primer 1, forward primer 2 and reverse primer to obtain PCR amplification products;
[0066] 3) Analyze the PCR amplification products to determine the genotype of the 35,829,660 bp segment on chromosome 1 of tartary buckwheat.
[0067] The PCR amplification reaction system, in 10 μL increments, includes: 2 μL of 50 ng / μL genomic DNA, 0.14 μL of primer mix (prepared by mixing 6 μL of 100 μmmol / L forward primer 1 + 6 μL of 100 μmmol / L forward primer 2 + 15 μL of 100 μmmol / L reverse primer + 23 μL of ddH2O), 5 μL of 2× Probe Mix A solution, and 3 μL of ddH2O.
[0068] The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 31 cycles; 16℃ hold; 4℃ store.
[0069] After amplification, KASP detection was performed based on the AQP genotyping system operating instructions (purchased from Beijing Jiacheng Biotechnology Co., Ltd.). The PCR program on the ABI 7500 qPCR instrument was set to 55℃ for 30 seconds. The results were exported, and the genotypes were further determined based on the sample clusters. Results analysis was performed using Taqman Genotyper Software to obtain the relative fluorescence values for HEX and FAM for each PCR reaction well (FAM fluorescent tag sequences were observed at excitation wavelengths of 485nm and emission wavelengths of 520nm, while HEX fluorescent tag sequences were observed at excitation wavelengths of 528nm and emission wavelengths of 560nm). The samples were genotyped and classified based on the relative fluorescence values. The detection results are as follows: Figure 1 As shown.
[0070] Depend on Figure 1 It can be seen that there are 3 genotypes at this locus. The blue dots represent materials with genotype G / G (a total of 191 samples tested), the red dots represent materials with genotype C / C (a total of 40 samples tested), and the green dots represent materials with genotype C / G (a total of 4 samples tested). Another 21 materials were not detected.
[0071] Test Example 1
[0072] The stem strength of the fifth internode (N5) at the base of the stem of different varieties of tartary buckwheat was tested, and the average value was taken. Stem strength above the average value (N5=163N) was recorded as strong, and stem strength below the average value was recorded as weak. The test results were compared with the classification results, and the degree of agreement between the stem strength of the tartary buckwheat material tested in Example 1 and the classification results was calculated. The results are shown in Table 1 and Table 2.
[0073] Table 1. Correspondence between stem strength and classification results.
[0074]
[0075]
[0076]
[0077]
[0078] Table 2. KASP genotyping and phenotypic statistical results from the examples.
[0079]
[0080] According to Tables 1 and 2, and Figure 1 It can be seen that varieties with stem strength ≥163N at the base of the fifth internode of the tartary buckwheat stem clustered together and were defined as varieties with strong stem strength; varieties with stem strength <163N at the N5 internode clustered together and were defined as varieties with weak stem strength. Through calculation of stem strength classification and genotype concordance rate, it was found that among the 191 materials of the GG type, 132 exhibited weak stem strength, with a concordance rate of 69.1%; among the 40 materials of the CC type, 32 showed strong stem strength, with a concordance rate of 80%; and among the 4 materials of the CG type, 3 showed strong stem strength, with a concordance rate of 75.0%, and an average concordance rate of 74.37%. This indicates that using this molecular marker in the KASP experiment can effectively detect the genotype of the tested materials, thereby completing the identification of germplasm.
[0081] As can be seen from the above, the molecular markers, DNA fragments, and KASP molecular marker primer sets provided by this invention can be used to quickly screen and identify tartary buckwheat with different stem strengths, thereby improving the breeding efficiency of tartary buckwheat germplasm with strong stem strength.
[0082] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A KASP molecular marker primer set, characterized in that, The KASP molecular marker primer set includes forward primer 1, forward primer 2, and reverse primer; The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO. 2; The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO. 3; The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.
4.
2. The application of reagents for detecting DNA fragments or the KASP molecular marker primer set as described in claim 1 in buckwheat breeding; The buckwheat breeding mentioned above is for the purpose of cultivating buckwheat varieties with strong stems; The stem strength is the stem strength at the fifth internode at the base of the stem; The DNA fragment comprises a nucleotide sequence as shown in SEQ ID NO.1, wherein Y in the nucleotide sequence is C / G; When using the aforementioned KASP molecular marker primer set, if the KASP genotyping result is CC type, the buckwheat is buckwheat with strong stem strength; if the KASP genotyping result is GG or CG type, the buckwheat is buckwheat with poor stem strength.
3. The application of reagents for detecting DNA fragments or the KASP molecular marker primer set as described in claim 1 in screening for tartary buckwheat with strong stems; The stem strength is the stem strength at the fifth internode at the base of the stem. The DNA fragment comprises a nucleotide sequence as shown in SEQ ID NO.1, wherein Y in the nucleotide sequence is C / G; When using the aforementioned KASP molecular marker primer set, if the KASP genotyping result is CC type, the buckwheat is buckwheat with strong stem strength; if the KASP genotyping result is GG or CG type, the buckwheat is buckwheat with poor stem strength.
4. A method for determining the strength of buckwheat stalks, characterized in that, Includes the following steps: The genomic DNA of the buckwheat to be identified was amplified by PCR using the KASP molecular marker primer set described in claim 1, and the amplification product was then used for KASP genotyping detection. When the KASP genotyping result is CC type, the buckwheat to be identified is buckwheat with strong stem strength; When the KASP genotyping result is GG or CG, the buckwheat to be identified is buckwheat with poor stem strength; The stem strength is the stem strength of the fifth internode at the base of the stem.
5. The method according to claim 4, characterized in that, The PCR amplification reaction system, per 10 μL, includes: 2 μL of 50-100 ng / μL genomic DNA, 0.14 μL of 100 μmol / L KASP molecular marker primer set, 5 μL of 2×Probe MixA solution, and the remainder ddH2O; The PCR amplification program is as follows: the first stage is pre-denaturation at 95℃ for 10 min; the second stage is denaturation at 95℃ for 20 s, followed by annealing at 55℃~61℃ for 40 s, for a total of 10 cycles; the third stage is denaturation at 95℃ for 20 s, followed by annealing at 55℃ for 40 s, for a total of 31 cycles.
6. The method according to claim 5, characterized in that, In the KASP molecular marker primer set, the concentration ratio of forward primer 1, forward primer 2 and reverse primer is 2:2:5.