Construction and application of bocavirus infectious clones carrying reporter genes

Abstract

The present invention provides a recombinant nucleic acid molecule, which contains the entire genomic sequence of bocavirus and the coding sequence of the HiBiT reporter gene. The present invention provides an infectious clone of bocavirus, which carries the HiBiT reporter gene. The present invention also provides a method for constructing the infectious clone of bocavirus and its applications. The replication ability of the infectious clone of bocavirus constructed by the present invention with the HiBiT tag inserted at the N-terminus of NS1 is comparable to that of the wild type, ensuring its effectiveness and accuracy in the research of viral replication mechanism and drug screening applications. In addition, the replication ability of the infectious clone of the present invention can be indicated by detecting the activity of Nano-Luc luciferase. When used for screening antiviral drugs and evaluating vaccines against human bocavirus, the antiviral effect can be directly judged according to the intensity of the luminescence signal, and it can also be used to calculate the EC 50 value, etc.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the construction and application of a bocavirus infectious clone with a reporter gene, and more specifically to a construction method and application of a bocavirus infectious clone with a HiBiT reporter gene. Background Art

[0002] It has been reported that human bocavirus (HBoV) can only be isolated from well-differentiated or polarized human airway epithelial (HAE) cells through air-liquid interface (ALI) culture. Because its culture materials are difficult to obtain and the culture method is time-consuming and expensive, it has not been widely used, which has slowed the development of current HBoV research. Based on this, researchers constructed an infectious clone of human bocavirus and used its high-efficiency replication characteristics in HEK293T or HEK293 cells (HEK293T or HEK293 cells cannot be infected with human bocavirus due to the lack of HBoV receptor expression) to express and purify infectious human bocavirus in large quantities through plasmid transfection.

[0003] In order to construct an infectious clone that is easy to detect, researchers have tried to construct an infectious clone with a reporter gene. The infectious clone with a reporter gene is constructed by inserting an exogenous reporter gene into the wild-type infectious clone. One of the widely used reporter genes is the green fluorescent protein GFP. However, the length of the EGFP gene is about 700bp, so researchers must consider its insertion site to avoid affecting the normal transcription, translation, and replication of viral genes. Despite this, some studies have reported that HBoV infectious clones with the EGFP reporter gene seriously affect the replication ability of HBoV, which makes the design and research of anti-Boca virus drugs and vaccines very difficult, and hinders the development of HBoV-related research.

[0004] Therefore, the use of the new reporter gene HiBiT, which is only 11 amino acids in size, to construct a new infectious clone of HBoV provides an important tool for conducting HBoV-related research, such as the study of the pathogenic mechanism of HBoV, drug and vaccine screening, which has far-reaching significance and broad application prospects. Summary of the invention

[0005] The present invention constructs human bocavirus type I infectious clones with different HiBiT insertion sites and evaluates their viral replication ability to obtain an HBoV1 infectious clone with a HiBiT tag (HBoV1-HiBiT NS1), and further analyzed the virus replication intermediates, virus particle morphology and Nano-Luc luciferase activity in detail, providing a powerful tool for high-throughput screening of bocavirus-related mechanism research and anti-bocavirus drug or vaccine evaluation. The replication ability of the infectious clone virus is equivalent to that of the wild type, which also ensures its effectiveness and accuracy in the study of virus replication mechanism and drug screening applications. The human bocavirus type I infectious clone with HiBiT constructed by the present invention was used to screen and obtain the antiviral drug Ivermectin that inhibits HBoV1 virus replication, further verifying the feasibility of the tool in anti-bocavirus drug screening and vaccine evaluation.

[0006] The present invention evaluates HBoV1-HiBiT NS1 The viral replication ability, viral particle morphology and Nano-Luc luciferase activity of the infectious clone were measured, and the real-time monitoring of HBoV1 replication ability was achieved in HEK293T cells overexpressing LgBiT using the HiBiT working principle, providing a high-throughput screening tool for human bocavirus antiviral drug screening and vaccine evaluation.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In one aspect, the present invention provides a recombinant nucleic acid molecule comprising the entire genome sequence of the Bocavirus and the coding sequence of the HiBiT reporter gene.

[0009] In another aspect, the present invention provides an expression vector comprising the nucleic acid molecule described above.

[0010] In another aspect, the present invention provides an expression cassette comprising a nucleic acid molecule as described above.

[0011] In another aspect, the present invention provides a cell comprising a nucleic acid molecule or an expression vector or an expression cassette as described above.

[0012] In some embodiments, the cells support infection or transfection with a bocavirus.

[0013] In some embodiments, the cell is a HEK293T cell or a HEK293 cell.

[0014] In some embodiments, the cell is a HEK293T-LgBiT cell.

[0015] In another aspect, the present invention provides a method for preparing a recombinant nucleic acid molecule, the method comprising the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the Bocavirus.

[0016] In some embodiments, the method includes the step of inserting the coding sequence of the HiBiT reporter gene into the N-terminus of the nonstructural protein NS1 of the bocavirus genome.

[0017] In some embodiments, the method includes the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the bocavirus by homologous recombination.

[0018] In another aspect, the present invention provides a bocavirus infectious clone, which comprises the entire genome sequence of the bocavirus and the coding sequence of the HiBiT reporter gene.

[0019] In some embodiments, the coding sequence of the HiBiT reporter gene is inserted at the N-terminus of the non-structural protein NS1 of the bocavirus genome.

[0020] In some embodiments, the nucleotide sequence of the HiBiT reporter gene is shown in SEQ ID NO:1.

[0021] In some embodiments, the replication ability of the bocavirus infectious clone can be indicated by detecting Nano-Luc luciferase activity.

[0022] In some embodiments, the bocavirus infectious clone has replication capacity comparable to that of a WT wild-type infectious clone.

[0023] In some embodiments, spherical virus particles of approximately 26 nm, consistent with the wild-type shape and size, can be detected in the bocavirus infectious clone.

[0024] In some embodiments, the bocavirus infectious clone is capable of correctly replicating and assembling viral particles.

[0025] In some embodiments, the replication tendency of the bocavirus infectious clone detected by Nano-Luc luciferase activity is consistent with the replication tendency detected by intracellular bocavirus DNA.

[0026] On the one hand, the present invention provides a method for constructing a bocavirus infectious clone, the method comprising the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the bocavirus, preferably, the method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the N-terminus of the non-structural protein NS1 of the bocavirus genome, preferably, the method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the bocavirus by homologous recombination.

[0027] On the other hand, the present invention provides the use of the nucleic acid molecules as described above, the expression vectors or expression cassettes or cells as described above, the infectious clones as described above, or the nucleic acid molecules or infectious clones constructed by the methods as described above in high-throughput screening for bocavirus mechanism research, anti-bocavirus drugs or vaccine evaluation.

[0028] In some embodiments, the mechanism studies of Bocavirus include studies on replication mechanism, assembly mechanism, infection mechanism, pathogenic mechanism, and mechanism of antagonizing host natural immunity.

[0029] On the other hand, the present invention provides a method for screening anti-bocavirus drugs, which comprises the step of contacting a cell line transfected with the nucleic acid molecule as described above, the expression vector or expression cassette as described above, the infectious clone as described above, or the nucleic acid molecule prepared by the method as described above or the infectious clone constructed therefrom with a drug.

[0030] In some embodiments, the method comprises: 1) transfecting a cell line with a nucleic acid molecule as described above, an expression vector or expression cassette as described above, an infectious clone as described above, or a nucleic acid molecule prepared or an infectious clone constructed by the method as described above; 2) contacting the cell line with a candidate drug; 3) detecting intracellular luciferase activity; 4) calculating the inhibition rate of the drug to be screened on the boca virus, thereby screening an anti-boca virus drug.

[0031] In some embodiments, the method includes: detecting the intracellular bocavirus DNA level, calculating the inhibition rate of the drug to be screened on the bocavirus, and thus screening anti-bocavirus drugs.

[0032] In some embodiments, the method comprises: contacting the cell line with different concentrations of the candidate drug, detecting the intracellular luciferase activity, and calculating the EC 50 , thereby screening anti-Bocavirus drugs.

[0033] Preferably, the cell is a HEK293T cell or a HEK293 cell, preferably, the cell is a HEK293T-LgBiT cell.

[0034] In some embodiments, the method further comprises the step of pre-treating the cell line and then transfecting the nucleic acid molecule as described above, the expression vector or expression cassette as described above, the infectious clone as described above, or the nucleic acid molecule prepared or the infectious clone constructed by the method as described above.

[0035] In some embodiments, the pretreatment includes the steps of preparing the drug to be screened with a culture medium, and then adding the drug to be screened to the cell line for incubation.

[0036] On the other hand, the present invention provides the use of Ivermectin in the preparation of anti-bocavirus drugs.

[0037] In another aspect, the present invention also provides a method for treating Bocavirus, comprising administering an effective amount of a drug screened by the method described above or a drug comprising Ivermectin to a subject infected with Bocavirus.

[0038] In another aspect, the present invention provides a method for preventing bocavirus, the method comprising administering an effective amount of a vaccine selected by the method described above to a subject at risk of bocavirus infection.

[0039] In some embodiments, the bocavirus is a human bocavirus.

[0040] In some embodiments, the human bocavirus is selected from HBoV1, HBoV2, HBoV3, and HBoV4.

[0041] In some embodiments, the nucleotide sequence of human bocavirus type 1 (HBoV1) is as shown in SEQ ID NO:2.

[0042] definition

[0043] Human bocavirus: Human bocavirus belongs to the genus Bocavirus of the family Parvoviridae. It is a small, non-enveloped, typical icosahedral virus with a diameter of about 26 nanometers and contains about 5.5 kb of linear single-stranded DNA (ssDNA). The human bocavirus genome includes three open reading frames (ORF1, ORF2, and ORF3), which express three structural proteins (VP1, VP2, and VP3) and six non-structural proteins (NS1, NS1-70, NS2, NS3, NS4, and NP1). The structural proteins VP1, VP2, and VP3 constitute the viral capsid in a ratio of 1:1:10. The surface of the viral capsid carries host determinants and is involved in many processes, including host tropism, cell recognition, pathogenicity, assembly, and immune response. The non-structural proteins NS1 and NP1 are essential for viral DNA replication and are highly conserved among different types of bocavirus. [6] , which is often used as a target for human bocavirus detection.

[0044] Human bocavirus is divided into four types: HBoV1, HBoV2, HBoV3 and HBoV4. Among them, the detection rate of HBoV1 in patients with respiratory diseases is between 0% and 44%. HBoV1 infection mainly causes symptoms related to respiratory infections, while HBoV2-4 types mainly cause symptoms such as diarrhea. Although the symptoms caused by HBoV1-4 infection are not the same, through the structural analysis of the 1-4 structural protein VP2, it was found that HBoV1 and HBoV2 types are different in the VR-III region, which plays an important role in receptor recognition, which also explains the difference in the infection tendency of HBoV1-4 types; however, they have the same N-terminal VP rearrangement, residue level, cysteine, histidine and some specific positions of the VP2 surface modification. In addition, the VP2 sequence is also relatively conservative.

[0045] Nano-Luc: Nano-Luc technology is a new type of bioluminescent analysis technology. It is a genetically engineered bioluminescent reporter gene. The protein product of Nano-Luc ( Luciferase can react with the novel substrate furimazine, catalyze its oxidation reaction, release energy, and produce a high-intensity, glow-type luminescent signal.

[0046] Glow-type luminescent signal: Chemiluminescence refers to the release of chemical energy in the form of photons by chromogenic substances under the action of enzymes. Chemiluminescence is divided into two types: glow type and flash type according to the form and type of luminescence. The glow-type luminescent signal has a longer and more stable luminescence time. The flash-type luminescent signal has a shorter luminescence time.

[0047] HiBiT tag: HiBiT tag is a short peptide tag composed of 11 amino acids. Its working principle is to spontaneously complement and bind with another protein subunit LgBiT to form a catalytically active nanoluciferase (NanoBiT), and to generate a luminescent signal by adding a substrate. The intensity of the luminescent signal is proportional to the content of HiBiT tag-bound protein in the cell, with a linear range of more than 7 orders of magnitude, and a stable glow-type signal can be generated within several hours.

[0048] HEK293T cells: Due to the lack of related receptor expression, the virus cannot enter the cells through infection. The present invention evaluates the replication ability of HBoV1 through a transfection system. Through the transfection system, HEK293T cells can support HBoV1 replication and produce high-titer and infectious viral particles.

[0049] Phase detection: In HEK293T-LgBiT cell line, HBoV1-WT, HBoV1-HiBiT NS1For infectious clones, intracellular samples were collected at 0, 24, 48, 72 and 96 h, and Nano-Luc luciferase activity and HBoV1 intracellular DNA levels were detected to verify the consistency between the trend of Nano-Luc activity and the intracellular HBoV1 DNA replication ability.

[0050] Infectious clone: ​​A plasmid form of a full-length clone of a viral genome that is infectious to eukaryotic cells. The full-length DNA or cDNA clone of the viral genome is integrated into the vector so that it can stably exist and replicate in the cells, and produce infectious viral particles after in vitro transcription into RNA or direct transfection.

[0051] EC 50 EC value: When the drug concentration reaches a certain value, the drug effect will reach half of its maximum value. 50 The value can reflect the activity and selectivity of the drug. 50 The smaller the value, the stronger the activity of the drug and the stronger its ability to inhibit the virus.

[0052] TE buffer: TE buffer is made of Tris and EDTA. It is mainly used to dissolve nucleic acids and can stably store DNA and RNA.

[0053] CC 50 Value: is the cell half-toxic concentration, which represents the drug concentration that causes 50% inhibition of cells.

[0054] SI: SI is CC 50 (median toxic concentration) and EC 50 (half effective concentration), the larger the SI, the larger the safety range.

[0055] PCR homologous recombination: Its core idea is to design specific primers during the PCR reaction so that the target DNA sequence and the vector DNA sequence have homology arms, and connect the target fragment to the vector under the action of the recombinase. Primer design requires that the 3' end primer of fragment A contains a part of fragment B, and the 5' end primer of fragment B contains a part of fragment A, so that the fragments containing homology arms are amplified separately. A and B are the vector DNA sequence and the target DNA sequence, respectively.

[0056] Statistical analysis

[0057] Statistical analysis was performed using GraphPad Prism software. Groups were compared using two-tailed Student t-test. Multiple group comparisons were performed by one-way analysis of variance (ANOVA). Data are presented as mean ± SD. Differences were considered statistically significant when *P < 0.05, **P < 0.01, ***P < 0.001; ns indicates no significant difference; nd indicates not detected.

[0058] Beneficial Effects

[0059] 1. By inserting a small tag HiBiT (11 amino acids) into the N-terminus of the human bocavirus type 1 infectious clone NS1, it can have the same replication ability as the WT wild-type infectious clone. Secondly, HiBiT is combined with the LaBiT subunit to form Nano-Luc, which activates the fluorescent group and realizes real-time monitoring.

[0060] 2. Human Bocavirus Type I Marker virus with HiBiT reporter gene can be used as a high-throughput screening tool for human Bocavirus antiviral drug screening and vaccine evaluation.

[0061] 3. The replication ability of the infectious cloned virus of the present invention is equivalent to that of the wild type, which ensures its effectiveness and accuracy in the study of virus replication mechanism and drug screening applications.

[0062] 4. The infectious clone of the present invention carries a HiBiT marker, which can emit light by combining with another subunit, thereby reducing the troublesome steps of extracting DNA to measure intracellular DNA, and directly achieving the purpose by simply testing luc, and can be used as a Marker virus. In this way, screening drugs through the infectious clone of the present invention greatly saves the time required for drug screening and improves the efficiency of drug screening.

[0063] 5. The luminescent signal of the present invention is a glow-type luminescent signal, which has a long and stable luminescent time, and is conducive to signal detection.

[0064] 6. The intensity of the luminescent signal of the present invention is proportional to the content of HiBiT tag binding protein in the cell. When used for human bocavirus antiviral drug screening and vaccine evaluation, the virus inhibition effect can be directly judged according to the intensity of the luminescent signal, and can also be used to calculate the EC of antiviral drugs and vaccines. 50 Value, etc.

[0065] 7. The replication ability of the infectious clone of the present invention can be monitored in real time by detecting Nano-Luc luciferase activity.

[0066] 8. Since the infectious clone of the present invention directly determines the virus inhibition effect according to the intensity of the luminescent signal when used for human bocavirus antiviral drug screening and vaccine evaluation, the cell line transfected with the infectious clone can be cultured on a 96-well high-throughput screening device, and no more sample volume is required to achieve the step of extracting DNA to measure intracellular DNA. Therefore, the infectious clone of the present invention can achieve high-throughput screening when used for antiviral drug screening and vaccine evaluation. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The schematic diagram of the Bocavirus HiBiT insertion site and the plasmid construction results are shown. A, pBBS-HBoV1 plasmid map information diagram. B, HiBiT insertion site information diagram. C, infectious clone restriction enzyme digestion identification result diagram.

[0068] Figure 2 The results of the replication characteristics analysis of pHBoV1-HiBiT infectious clones at 5 different HiBiT insertion sites are shown. A, Nano-Luc luciferase activity detection results at different insertion sites. B, HBoV1 intracellular DNA level detection results at different insertion sites. C, viral protein and HiBiT protein detection results at different insertion sites.

[0069] Figure 3 HBoV1-HiBiT is shown NS1 Results of virus replication, assembly and morphological analysis. A, Co-localization detection of viral nonstructural protein NS1 and HiBiT, Scale bar 10μM. B, Southern Blotting detection of viral replication intermediates. C, Expression and purification of HBoV1-HiBiT NS1 Virus particles were directly incubated with LgBiT protein to detect Nano-Luc luciferase activity. D, expressed and purified HBoV1-HiBiT NS1 Virus particles, negative staining to observe virus morphology. E, Colloidal gold-antibody labeling results. Structural protein VP2 and HiBiT antibody specifically label virus particles.

[0070] Figure 4 HBoV1-HiBiT is shown NS1 Replication phase detection results. A, Verification of HBoV1 and HBoV1-HiBiT in transfection system NS1 Nano-Luc luciferase activity time phase analysis results. B, HBoV1 and HBoV1-HiBiT were verified in the transfection system. NS1 The viral DNA level test results.

[0071] Figure 5 HBoV1-HiBiT is shownNS1 Application of antiviral drug screening. A, Luciferase activity analysis of 8 small molecule drugs against HBoV1 replication. B, EC of Ivermectin against HBoV1 replication 50 The results (EC 50 =2.274μM, CC 50 >9.375μM, SI>4.123). C, Detection results of intracellular DNA level of Ivermectin against HBoV1 replication.

[0072] Note: VC in the figure stands for empty vector control. DETAILED DESCRIPTION

[0073] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0074] Example 1 Construction of HBoV1 infectious clones with different HiBiT insertion sites

[0075] The present invention is based on the pBBs-HBoV1 wild-type infectious clone (pHBoV1-WT, donated by Professor Wang Hanzhong of Wuhan Institute of Virology, Chinese Academy of Sciences, with the plasmid map as shown in Figure 1 Based on the results of the experiment, five infectious clones with different HiBiT insertion sites were constructed (the insertion sites are shown in Figure 1 B, the black arrow in the figure indicates the specific insertion position), considering that the HBoV1 genome has three overlapping open reading frames, the NS1 N-terminus, NS1-70 C-terminus, and VP2 C-terminus are preferred as insertion sites; at the same time, according to the VP2 structure that has been structurally resolved, VP2-206 and VP2-460 are selected as insertion sites through secondary structure analysis and conservation analysis. The construction details are shown in Table 1, and the nucleotide sequence of the HiBiT reporter gene is shown in SEQ ID NO: 1. The nucleotide sequence of human bocavirus HBoV1 is shown in SEQ ID NO: 2.

[0076] The construction method is as follows: (1) pHBoV1 [5] As a template, select a specific restriction site (as shown in Table 1) for double restriction digestion (enzyme digestion can be completed within 5-15 minutes), purify by agarose gel electrophoresis, cut and recover the gel, and obtain the linearized vector fragment (2) Using the wild-type infectious clone of Bocavirus as a template, the HiBiT short peptide 11aa is designed on the corresponding site primer, and then the target fragment is obtained by PCR. The primer information is shown in Table 2. (3) The linearization and fragment recombination are connected by Vazyme homologous recombinase (the reaction system is shown in Table 3), and the fragment is identified by XhoⅠ and SalⅠ restriction digestion ( Figure 1C) and sequencing, and successfully obtained infectious clones of the above five insertion sites.

[0077] Table 1 Plasmid construction information of 5 different HiBiT insertion sites

[0078]

[0079]

[0080] Table 3 Homologous recombination reaction system and conditions

[0081]

[0082] Example 2 Effects of different HiBiT insertion sites on HBoV1 replication

[0083] In HEK293T-LgBiT cell line (Promega, N2672), vector, pHBoV1, pHBoV1-HiBiT were transfected NS1 、pHBoV1-HiBiT NS1-70 、pHBoV1-HiBiT VP2 、pHBoV1-HiBiT VP2-206 、pHBoV1-HiBiT VP2-460 For infectious clones, intracellular samples were collected 48 h later to detect Nano-Luc luciferase activity, HBoV1 intracellular DNA levels, and viral protein expression.

[0084] The results showed that only HiBiT inserted into the N-terminus of NS1 could effectively activate Nano-Luc luciferase activity ( Figure 2 A) Detection of intracellular HBoV1 DNA levels and the expression of viral proteins NSs, VPs, and NP1 revealed that only HBoV1-HiBiT NS1 The virus had a replication capacity comparable to that of the wild type, while the insertion of the NS1-70 C-terminus completely inhibited viral replication and the expression of the nonstructural protein NSs. The other three insertion sites weakened the viral replication capacity and significantly inhibited the expression of viral proteins ( Figure 2 BC). The above experimental results show that, in comparison, the N-terminus of NS1 is more suitable for the insertion of foreign genes. Insertion in the middle of NS1 and the middle or C-terminus of VP2 may destroy the function of viral proteins and thus weaken the ability of viral replication, and is not suitable for foreign gene insertion. NS1The infectious clone has the same viral replication ability as the wild-type HBoV1-WT, and has the advantage of HiBiT tag. With HiBiT tag, it can emit light by binding to another subunit, thus reducing the troublesome steps of extracting DNA to measure intracellular DNA, and can be used as a Marker virus by simply testing luc.

[0085] Example 3 HBoV-HiBiT NS1 Analysis of replication and viral packaging

[0086] In HEK293T cells, HBoV1-HiBiT NS1 First, the co-localization of HiBiT and its fusion virus protein was detected; secondly, the genome was extracted using the Hirt DNA extraction method, and Southern Blotting was used to further evaluate the HBoV-HiBiT NS1 The replication ability of HBoV-HiBiT was obtained by expression and purification NS1 The virus particles were co-incubated with LgBiT protein in vitro to detect Nano-Luc luciferase activity; negative staining and colloidal gold were used to label the virus particles to verify HBoV-HiBiT NS1 Assembly of infectious clones and viral morphology.

[0087] Colocalization assay: In HEK293T cells, pHBoV1 or pHBoV1-HiBiT was transfected into NS1 Infectious clones were collected 48 h later to prepare immunofluorescence samples to detect the co-localization of HiBiT and NS1.

[0088] Southern Blotting: HEK293T cells were transfected with empty vector, HBoV1-WT, HBoV1-HiBiT NS1 Infectious clones, genomes were extracted using Hirt DNA extraction method 48 h later, and HBoV-HiBiT was evaluated by Southern Blotting NS1 replication capability.

[0089] Hirt DNA extraction method:

[0090] (1) Lysis of cells: Taking a 6-well plate as an example, add 2 mL of TE buffer (10:10) and 0.13 mL of 10% SDS, mix gently, and incubate at room temperature for 30 min. Then, add 0.53 mL of 5 M NaCl solution and gently invert to mix. Place at 4°C for at least 16 h to effectively precipitate proteins.

[0091] (2) Extract genomic DNA: Centrifuge at 14,500 × g at 4°C for 30 min to separate the supernatant and precipitate. Transfer the supernatant to a clean 15 mL centrifuge tube and add an equal volume of Tris-saturated phenol for extraction. At the same time, add EDTA to a final concentration of 1 mM to remove residual protein in the supernatant. Gently invert and mix for 10 seconds, avoiding vigorous shaking or prolonged periods of time. Centrifuge at 3,500 × g at 4°C for 10 min and transfer the aqueous phase to a new centrifuge tube. Repeat this step once to ensure effective removal of impurities.

[0092] (3) Add an equal volume of Tris-saturated phenol / chloroform / isoamyl alcohol mixed solution (ratio 25:24:1). Add EDTA at the same time and gently shake to mix. Centrifuge at 3500×g at 4℃ for 10 min and transfer the aqueous phase to a new centrifuge tube again.

[0093] (4) Precipitate DNA: Add twice the volume of anhydrous ethanol, mix thoroughly by inversion, and let stand at room temperature overnight. Centrifuge at 3500×g for 30 min at 4℃ and discard the supernatant.

[0094] (5) Add an equal volume of 70% ethanol and shake gently to wash the precipitate. Centrifuge at 3500×g at 4°C for 15 min.

[0095] (6) DNA dissolution: After removing the supernatant, place the centrifuge tube in air-drying at room temperature for 10 min. Finally, add 25 μL of TE buffer (10:1) to dissolve the DNA.

[0096] Expression and purification of viral particles: transfection of HBoV1-WT, HBoV1-HiBiT by liposomes (linearized polyethyleneimine PEI 40000 transfection reagent) NS1 For infectious clones, cells were collected after 48 hours, centrifuged at 100g, cell debris was removed, and cells were lysed by repeated freezing and thawing for 3 times to release virus particles, followed by nuclease (50U / mL) digestion at 37°C for 1.5h, centrifuged at 10000g at 4°C for 30min, and cell pellets were removed. The pellets were collected by ultracentrifugation at 100,000g at 4°C for 2h using a 20% (wt / vol) sucrose cushion, and resuspended in PBS to dissolve overnight.

[0097] Analysis of luciferase activity of recombinant virus protein: 10 μL of virus particles and LgBiT protein were incubated in vitro at 37°C for 10 minutes, and the luciferase activity of the purified virus was detected using a luciferase activity detection kit.

[0098] Morphology and specific detection of purified virus particles: using negative staining and colloidal gold to label virus particles.

[0099] Immunofluorescence results showed that NS1 and HiBiT were significantly co-localized ( Figure 3A); Southern Blotting results show that HBoV1-HiBiT NS1 It can produce replication intermediates (dRF and mRF) and ssDNA ( Figure 3 B), while purified virus particles directly incubated with subunit LgBiT protein can produce Nano-Luc luciferase activity ( Figure 3 C), indicating that the HiBiT tag of the recombinant virus is located on the surface of the virus particle and can be recognized by LgBiT. Negative staining electron microscopy results show that in HBoV1-HiBiT NS1 Spherical virus particles of approximately 26 nm in size and shape consistent with the wild type were detected in the sample. Figure 3 D) In ​​addition, through the immunocolloidal gold technique, using the viral protein VP antibody and HiBiT antibody labeling, the spherical virus particles recognized by the above antibodies can be detected ( Figure 3 E).

[0100] The above experimental results show that HBoV1-HiBiT NS1 The virus is able to replicate correctly and assemble viral particles.

[0101] Example 4 HBoV1-HiBiT NS1 Phase detection of viral replication ability

[0102] In HEK293T-LgBiT cell line, HBoV1-WT, HBoV1-HiBiT NS1 For infectious clones, intracellular samples were collected at 0h, 24h, 48h, 72h and 96h to detect Nano-Luc luciferase activity and intracellular DNA levels of Bocavirus, respectively, to verify the consistency between the trends of Nano-Luc and intracellular HBoV1 DNA replication capabilities.

[0103] Results: HBoV1-HiBiT NS1 The luciferase activity showed a trend of first increasing and then decreasing, and reached a peak at 72h ( Figure 4 A) By detecting the intracellular DNA level, the results showed that HBoV1-HiBiT NS1 The replication capacity was slightly higher than that of HBoV1-WT, but the dynamic trends of the two were consistent, showing an increase first and then a decrease, and reaching a peak at 72h ( Figure 4 B).

[0104] The above experimental results show that HBoV1-HiBiT NS1 The replication capacity can be monitored in real time by detecting Nano-Luc luciferase activity.

[0105] Example 5 HBoV1-HiBiT NS1 Application of infectious clones in antiviral drug screening

[0106] Eight candidate small molecule drugs were selected based on the literature, and the HEK293T-LgBiT cell line was pretreated (a specific concentration of small molecule drugs was prepared with DMEM medium containing 10% FBS, added to HEK293T cells and pretreated in a 37°C incubator for 2 h), and then transfected with HBoV-HiBiT NS1 Infectious clones were grown, and fresh 10% FBSDMEM medium containing small molecule drugs was replaced 6 h after transfection. The intracellular Nano-Luc luciferase activity was detected 72 h after transfection to screen candidate drugs with anti-HBoV effects.

[0107] 1. Antiviral drug screening application: In HEK293T cells that stably overexpress LgBiT, 8 small molecule drugs (Cidofovir 200μM, Favipiravir 50μM, Ivermectin 10μM, Nevirapine 50μM, Remdesivir 10μM, Ribavirin 50μM, Sofosbuvir 50μM, Zidovudine 50μM) were selected for evaluation. Among them, Cidofovir and Ivermectin have been reported to inhibit the replication of Parvoviridae B19V. The other 6 are antiviral drugs that have been used for a long time in clinical practice, mainly targeting RNA-dependent RNA polymerase (RdRp) and RNA / DNA-dependent DNA polymerase viral replication inhibitors. The dosage was selected according to the literature. HBoV1-HiBiT was then transfected with liposomes. NS1 The infectious clones were cultured in fresh DMEM medium containing 10% FBS 6 hours after transfection. After 72 hours, intracellular samples were collected to detect Nano-Luc luciferase activity and screen antiviral drugs that inhibit HBoV1 replication.

[0108] Best drug candidate EC 50 and CC 50 Analysis: The best candidate drug that can inhibit viral replication was selected by gradient dilution (starting concentration 15 μM, 2-fold dilution) and transfected with HBoV1-HiBiT in HEK293T cells stably overexpressing LgBiT. NS1 System, 72h detection of Nano-Luc luciferase activity and calculation of EC 50 ; At the same time, the ability of Ivermectin (initial concentration 7.5 μM, 2-fold dilution) to inhibit HBoV1 viral replication was verified by detecting the intracellular HBoV1 DNA level.

[0109] Results: For 8 candidate drugs, the activity of Nano-Luc luciferase was detected, and it was found that 10μM Ivermectin (ivermectin) treatment could significantly inhibit the activity of Nano-Luc luciferase ( Figure 5 A).

[0110] Ivermectin inhibits HBoV1 viral replication in EC 50 =2.274μM. In addition, by detecting intracellular HBoV1 DNA, it was found that Ivermectin could significantly inhibit the replication of HBoV1 ( Figure 5 B and C).

[0111] The above experimental results show that HBoV1-HiBiT NS1 The feasibility of using infectious clones for drug screening against HBoV1 replication was investigated, and Ivermectin was found to be able to inhibit HBoV1 viral replication.

[0112] sequence

[0113] SEQ ID NO:1HiBiT novel reporter gene

[0114] GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC

[0115] SEQ ID NO:2 Nucleotide sequence of human bocavirus HBoV1

[0116]

[0117] References

[0118] 1. Shao, L., Shen, W., Wang, S., and Qiu, J. (2021). Recent Advances in Molecular Biology of Human Bocavirus 1 and Its Applications. Frontiers in microbiology 12, 696604. 10.3389 / fmicb.2021.696604.

[0119] 2. Dijkman, R., Koekkoek, S. M., Molenkamp, R., Schildgen, O., and van der Hoek, L. (2009). Human bocavirus can be cultured in differentiated human airway epithelial cells. Journal of virology 83, 7739 - 7748. 10.1128 / jvi.00614 - 09.

[0120] 3. Schildgen, V., Longo, Y., Pieper, M., and Schildgen, O. (2018). T84 air - liquid interface cultures enable isolation of human bocavirus. Influenza and other respiratory viruses 12, 667 - 668. 10.1111 / irv.12567.

[0121] 4. Huang, Q., Deng, X., Yan, Z., Cheng, F., Luo, Y., Shen, W., Lei - Butters, D. C., Chen, A. Y., Li, Y., Tang, L., et al. (2012). Establishment of a reverse genetic system for studying human bocavirus in human airway epithelia. PLoS pathogens 8, e1002899. 10.1371 / journal.ppat.1002899.

[0122] 5. Huang Q, Deng X, Yan Z, Cheng F, Luo Y, Shen W, Lei-Butters DC, Chen AY, Li Y, Tang L, M,Engelhardt JF,Qiu J.2012.Establishment of areverse genetics system for studying human bocavirus in human airwayepithelia.PLoS Pathog 8:e1002899.

[0123] 6. Trapani S, Caporizzi A, Ricci S, Indolfi G. Human Bocavirus in Childhood: A True Respiratory Pathogen or a "Passenger" Virus? AComprehensiveReview.Microorganisms.2023;11(5).Epub 2023 / 06 / 15.doi:10.3390 / microorganisms11051243.

[0124] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A recombinant nucleic acid molecule, characterized in that The nucleic acid molecule comprises the entire genome sequence of the bocavirus and the coding sequence of the HiBiT reporter gene, wherein the coding sequence of the HiBiT reporter gene is inserted into the N-terminus of the non-structural protein NS1 of the bocavirus genome, and the bocavirus is human bocavirus type I.

2. An expression vector or expression cassette or cell, characterized in that: The expression vector or expression cassette or cell comprises the nucleic acid molecule according to claim 1.

3. The expression vector or expression cassette or cell according to claim 2, characterized in that: The cells are HEK293T cells or HEK293 cells.

4. The expression vector or expression cassette or cell according to claim 2, characterized in that: The cells are HEK293T-LgBiT cells.

5. A method for preparing a recombinant nucleic acid molecule, characterized in that: The method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the N-terminus of the non-structural protein NS1 of the bocavirus genome, wherein the bocavirus is human bocavirus type I.

6. The method according to claim 5, characterized in that The method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the bocavirus by homologous recombination.

7. A bocavirus infectious clone, characterized in that The bocavirus infectious clone comprises the entire genome sequence of the bocavirus and the coding sequence of the HiBiT reporter gene, wherein the coding sequence of the HiBiT reporter gene is inserted into the N-terminus of the non-structural protein NS1 of the bocavirus genome, and the bocavirus is human bocavirus type I.

8. A method for constructing a bocavirus infectious clone, characterized in that: The method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the N-terminus of the non-structural protein NS1 of the bocavirus genome, wherein the bocavirus is human bocavirus type I.

9. The method according to claim 8, characterized in that The method comprises the step of inserting the coding sequence of the HiBiT reporter gene into the genome sequence of the bocavirus by homologous recombination.

10. The nucleic acid molecule according to claim 1, the expression vector or expression cassette or cell according to any one of claims 2 to 4, the infectious clone according to claim 7 or the method according to any one of claims 5 to 6 and 8 to 9, characterized in that: The coding sequence of the HiBiT reporter gene is shown in SEQ ID NO:

1.

11. Use of the nucleic acid molecule according to claim 1, the expression vector or expression cassette or cell according to any one of claims 2-4, the infectious clone according to claim 7, or the nucleic acid molecule prepared by the method according to claim 5 or 6, or the infectious clone constructed by the method according to claim 8 or 9 in high-throughput screening for bocavirus mechanism research and anti-bocavirus drug or vaccine evaluation.

12. The use according to claim 11, characterized in that: The mechanism research of Bocavirus includes the research of replication mechanism, assembly mechanism, infection mechanism, pathogenic mechanism, and mechanism of antagonizing host natural immunity.

13. A method for screening anti-Bocavirus drugs, wherein the method comprises the step of contacting a cell line transfected with a nucleic acid molecule according to claim 1, an expression vector or an expression cassette according to any one of claims 2 to 4, an infectious clone according to claim 7, or a nucleic acid molecule prepared by the method according to claim 5 or 6, or an infectious clone constructed by the method according to claim 8 or 9 with a candidate drug.

14. The method according to claim 13, characterized in that The method comprises: 1) transfecting a cell line with a nucleic acid molecule according to claim 1, an expression vector or expression cassette according to any one of claims 2-4, an infectious clone according to claim 7, or a nucleic acid molecule prepared by the method according to claim 5 or 6, or an infectious clone constructed by the method according to claim 7 or 8; 2) contacting the cell line with a candidate drug; 3) detecting intracellular luciferase activity; 4) calculating the inhibition rate of the drug to be screened on the boca virus, thereby screening anti-boca virus drugs.

15. The method according to claim 13, characterized in that The method further comprises: detecting the intracellular bocavirus DNA level, calculating the inhibition rate of the drug to be screened on the bocavirus, and thus screening anti-bocavirus drugs.

16. The method according to claim 13, characterized in that The method further comprises: contacting the cell line with different concentrations of candidate drugs, detecting intracellular luciferase activity, and calculating the EC50 of the drug, thereby screening anti-bocavirus drugs.

17. The method according to claim 13, characterized in that The cell line is HEK293T cell line or HEK293 cell line.

18. The method according to claim 13, characterized in that The cell line is HEK293T-LgBiT cell line.

19. Use of Ivermectin in the preparation of anti-Bocavirus drugs.

20. The nucleic acid molecule according to claim 1, the expression vector or expression cassette or cell according to any one of claims 2 to 4, the infectious clone according to claim 7, the method according to any one of claims 5 to 6 and 8 to 9 or the use according to any one of claims 11 to 12 and 19, characterized in that: The nucleotide sequence of human bocavirus type 1 (HBoV1) is shown in SEQ ID NO:2.

Images