Use of a maize ZmMKK1 gene in regulating plant plant height and ear position height
Editing the ZmMKK1 gene in maize using CRISPR-Cas9 gene editing technology solved the problem of scarce gene resources for regulating maize plant height and ear height, achieving a reduction in plant height and ear height, and improving maize lodging resistance and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANHUI AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-06-25
- Publication Date
- 2026-05-01
AI Technical Summary
In existing technologies, there is a lack of genetic resources for maize plant height and ear height. There are limited reports on reducing plant height through genetic engineering, which leads to lodging and yield loss when planting at high density, and there is a lack of effective control methods.
Using CRISPR-Cas9 gene editing technology, sgRNAs specifically targeting the ZmMKK1 gene were designed to edit the maize ZmMKK1 gene, inhibiting its expression, and a ZmMKK1-CRISPR-Cas9 gene editing vector was constructed to regulate maize plant height and ear height.
Significantly reducing maize plant height and ear height provides a theoretical basis for improving lodging resistance and increasing yield, and provides a scientific basis for tapping the production potential of maize.
Smart Images

Figure CN118599805B_ABST
Abstract
Description
Application of a maize ZmMKK1 gene in regulating plant height and ear height Technical Field
[0001] This invention relates to the technical field, specifically to the application of the maize ZmMKK1 gene in regulating plant height and ear height. Background Technology
[0002] Corn is the most widely planted and used crop in my country. In recent years, due to the adjustment of agricultural industrial structure and the sharp increase in demand for feed and industrial grains, there is an urgent need to increase corn yield. High-density planting is the main factor for the continuous growth of corn yield. However, high planting density usually triggers shade avoidance response, leading to lodging and yield loss. Corn plant height and ear position are important factors affecting lodging resistance and corn yield. They are typical quantitative traits controlled by multiple genes. Many scholars at home and abroad have studied this trait. After years of research, some progress has been made in the molecular genetic mechanism of corn plant height. However, gene resources are relatively scarce, and there is an urgent need to discover and utilize more superior alleles. Moreover, reports on reducing corn plant height through genetic engineering technology are still quite limited. Therefore, using genetic engineering technology to select genes that can be used for breeding is the focus of research.
[0003] Bioinformatics analysis of the published ZmMKK1 gene sequence (Zm00001d045359) revealed that it encodes a mitogen-activated protein kinase. It belongs to the MAPK cascade pathway, which amplifies signals through stepwise phosphorylation and plays an important role in regulating plant biological development, biotic stress, and abiotic stress. However, there are no reports of its correlation with maize plant height. Summary of the Invention
[0004] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide an application of the maize ZmMKK1 gene in regulating plant height and ear height, which has the following functions.
[0005] The present invention achieves the above objectives through the following technical solutions:
[0006] This invention provides an application of the maize ZmMKK1 gene in regulating plant height and ear height. The nucleotide sequence of the ZmMKK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ZmMKK1 gene is shown in SEQ ID NO.2.
[0007] As a further optimization of the present invention, the expression of the ZmMKK1 gene is used to increase the plant height and ear height, and the loss of function of the ZmMKK1 gene is used to decrease the plant height and ear height.
[0008] As a further optimization of the present invention, the plant is corn.
[0009] As a further optimization of the present invention, the corn is the corn inbred line KN5585.
[0010] A method for obtaining maize germplasm with low plant height and / or high ear position involves editing the ZmMKK1 gene in maize using CRISPR-Cas9 gene editing technology to suppress its expression. After constructing a ZmMKK1-CRISPR-Cas9 gene editing vector, maize is genetically transformed. The resulting positive seedlings are maize germplasm with low plant height and / or high ear position.
[0011] As a further optimization of the present invention, in the CRISPR-Cas9 gene editing technology, two sgRNA target sites were designed using the nucleotide sequence of the ZmMKK1 gene as a template to construct the ZmMKK1-CRISPR-Cas9 gene editing vector. The sgRNA target sequence is as follows:
[0012] SEQ ID NO.3: Nucleotide sequence containing target site one: CCTTGCAGATTTCCTGAAGACTG;
[0013] SEQ ID NO.4: Nucleotide sequence containing target site 2: CCATTCCAGAGGCCTACCTCGCT.
[0014] As a further optimization of the present invention, editing the ZmMKK1 gene includes deleting 28 bp between target site one and target site two or deleting 1 bp at target site two.
[0015] The present invention has the following beneficial effects:
[0016] This invention is the first to discover that by inhibiting the expression of the gene encoding ZmMKK1 protein, ZmMKK1 can significantly reduce maize plant height and ear height. This provides a good theoretical basis for the genetic improvement of plant height and the cultivation of maize with lodging resistance and high yield. It also provides a scientific basis for further fully tapping the production potential of maize and increasing maize yield. The application prospects are promising. Attached Figure Description
[0017] Figure 1 shows the identification diagram of the MKK1 knockout maize mutant;
[0018] Figure 2 shows a comparison of plant height among different maize lines;
[0019] Figure 3 shows the plant height statistics of different maize lines;
[0020] Figure 4 shows the statistical chart of ear height for different maize lines. Detailed Implementation
[0021] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.
[0022] 1. Materials
[0023] The full-length CDS sequence (SEQ ID No. 1) and protein sequence (SEQ ID No. 2) of the maize ZmMKK1 gene were obtained from the Plant Genome Database website (https: / / phytozome.jgi.doe.gov / pz / portal.html).
[0024] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.
[0025] 2. Method
[0026] 2.1 Identification of MKK1 knockout maize mutants
[0027] Based on the full-length CDS sequence of the ZmMKK1 gene, a ZmMKK1-CRISPR-Cas9 gene editing vector was constructed and genetically transformed to obtain maize mutant seeds. To ensure the accuracy of gene editing, specific dual-target sequences were designed, with target site 1 and target site 2 both located on the antisense strand. The sequence containing target site 1 is (SEQ ID No. 3: 5'-CCTTGCAGATTTCCTGAAGACTG-3'); the sequence containing target site 2 is (SEQ ID No. 4: 5'-CCATTCCAGAGGCCTACCTCGCT-3'). Maize leaf genome was extracted and fragments containing gene knockout target sequences were amplified and sequence alignment was performed.
[0028] The results are shown in Figure 1. Two homozygous maize lines, MKK1-KO1 and MKK1-KO2, were successfully edited. MKK1-KO1 had a deletion of 28 bp between the first and second target sites. MKK1-KO2 had a deletion of 1 bp at the second target site. This resulted in a frameshift in the ZmMKK1 gene nucleotide sequence, preventing it from encoding the normal ZmMKK1 protein.
[0029] 2.2 Phenotypic Identification of MKK1 Knockout Maize Mutants
[0030] The identified MKK1 knockout lines KO1 and KO2, as well as the wild-type KN5585, were planted in the Nongcuiyuan experimental field of Anhui Agricultural University. After maturity, they were harvested, and plant height was recorded. Figure 2 shows the plant height phenotype of wild-type KN5585 and the MKK1 knockout lines KO1 and KO2; Figure 3 shows the plant height statistics of wild-type KN5585 and the MKK1 knockout lines KO1 and KO2; and Figure 4 shows the ear height statistics of wild-type KN5585 and the MKK1 knockout lines KO1 and KO2. Phenotypic analysis revealed that the ZmMKK1 gene mutation significantly reduced both plant height and ear height in maize.
[0031] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. An application of the maize ZmMKK1 gene in regulating plant height and ear height, characterized in that, The nucleotide sequence of the ZmMKK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ZmMKK1 gene is shown in SEQ ID NO.
2. The ZmMKK1 gene is lost to reduce plant height and ear height. The plant is maize.
2. The application according to claim 1, characterized in that, The corn in question is the corn inbred line KN5585.
3. A method for obtaining maize germplasm with low plant height and / or low ear position, characterized in that, The ZmMKK1 gene in maize as described in any one of claims 1-2 was edited using CRISPR-Cas9 gene editing technology to suppress the expression of the ZmMKK1 gene. After constructing the ZmMKK1-CRISPR-Cas9 gene editing vector, maize genetic transformation was carried out, and the resulting positive seedlings were maize germplasm with low plant height and / or low ear position.
4. The method for obtaining maize germplasm with low plant height and / or low ear position according to claim 3, characterized in that, In CRISPR-Cas9 gene editing technology, two sgRNA target sites were designed using the nucleotide sequence of the ZmMKK1 gene as a template to construct the ZmMKK1-CRISPR-Cas9 gene editing vector. The sgRNA target site sequences are as follows: SEQ ID NO.3: Nucleotide sequence containing target site one: CCTTGCAGATTTCCTGAAGACTG; SEQ ID NO.4: Nucleotide sequence containing target site two: CCATTCCAGAGGCCTACCTCGCT.
Citation Information
Patent Citations
Transgenic plants with increased stress tolerance and yield
CN101743314A
Method for creating brassica napus dwarfing material by using gene editing technology and application of brassica napus dwarfing material
CN115838757A