Gene ubiE for improving tolerance of escherichia coli to pentanediamine and application thereof
By expressing the ubiE and cadA genes in Escherichia coli KA30 and constructing a recombinant expression vector, the problem of poor strain tolerance in the fermentation production of pentanediamine was solved, and the yield of pentanediamine was significantly improved.
Patent Information
- Application Number
- CN202410761786.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-13
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-06-13
AI Technical Summary
Existing fermentation methods for producing pentanediamine suffer from low product yield and poor strain tolerance, especially under high concentrations of pentanediamine stress, which inhibits the growth and metabolism of Escherichia coli.
By expressing the bifunctional gene ubiE and the lysine decarboxylase gene cadA in Escherichia coli KA30, a recombinant expression vector was constructed and introduced into the strain to improve the strain's tolerance to pentanediamine and optimize fermentation conditions to increase pentanediamine production.
It significantly improved the tolerance of Escherichia coli to pentanediamine, and the yield of pentanediamine produced by fermentation increased from 8.54 g/L to 10.63 g/L, an increase of 24.47%.
Smart Images

Figure CN118599871B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of microbial genetic engineering, and particularly relates to a gene ubiE for improving the tolerance of Escherichia coli to pentanediamine and application thereof. BACKGROUND
[0002] Pentanediamine can be used as an intermediate of a bio-based polymeric material polyamide, and is polymerized with various diacids to synthesize the bio-based polymeric material polyamide, which has the advantages of high mechanical strength and strong oil resistance compared with traditional nylon materials. At present, the demand for polyamide materials in the world is increasing, and therefore it is very important to mass-produce the precursor pentanediamine of the bio-based polyamide material.
[0003] The biological synthesis of pentanediamine mainly includes whole-cell catalysis and fermentation. The whole-cell catalysis has the problems of complicated process, high cost and low cell reuse rate, and therefore the fermentation method is selected to prepare pentanediamine. However, the accumulation of pentanediamine has an inhibitory effect on the growth and metabolism of the strain, and therefore the fermentation method has the problems of low product yield and growth efficiency, and poor strain tolerance. SUMMARY
[0004] In view of the existing production demand and the insufficient related research, the purpose of the present application is to provide a gene ubiE for improving the tolerance of Escherichia coli to pentanediamine and application thereof. The method provided by the present application is a method for efficiently improving the yield of pentanediamine, which is simple, direct and has remarkable effect.
[0005] In order to solve the above technical problems, the present application discloses a gene ubiE for improving the tolerance of Escherichia coli to pentanediamine and application thereof. The specific technical solutions are as follows:
[0006] In the first aspect, the present application provides a gene ubiE for improving the tolerance of Escherichia coli to pentanediamine, and the nucleotide sequence of the gene ubiE is shown in SEQ ID NO. 1. The gene ubiE encodes bifunctional 2-octenyl-6-methoxy-1,4-benzoquinol methyltransferase and demethylphytylquinone methyltransferase.
[0007] In the second aspect, the present application provides a recombinant expression vector containing the gene ubiE in the first aspect.
[0008] Preferably, the construction method of the recombinant expression vector containing the gene ubiE is as follows: the gene ubiE is inserted into the plasmid vector pCDFDuet by enzyme digestion and enzyme ligation to obtain the recombinant expression vector pCDFDuet-ubiE of the gene ubiE, and the enzyme digestion sites are EcoR I and Hind III.
[0009] In a third aspect, the present application provides a genetically engineered bacterium containing the gene ubiE of the first aspect or the recombinant expression vector of the second aspect.
[0010] Preferably, the starting bacterium of the genetically engineered bacterium is an Escherichia coli for producing lysine, and more preferably, the starting bacterium is Escherichia coli KA30. Details of the Escherichia coli KA30 have been disclosed in Chinese patent CN113817762A.
[0011] In a fourth aspect, the present application provides an application of the gene ubiE of the first aspect or the recombinant expression vector of the second aspect or the genetically engineered bacterium of the third aspect in improving the tolerance of Escherichia coli to pentanediamine.
[0012] Preferably, the genetically engineered bacterium has a better growth state in LB liquid medium containing 20-35 g / L pentanediamine hydrochloride than the starting bacterium.
[0013] In a fifth aspect, the present application provides a genetically engineered bacterium containing both the gene ubiE of the first aspect and the lysine decarboxylase gene cadA. Preferably, the nucleotide sequence of the lysine decarboxylase gene cadA is shown in SEQ ID NO. 2.
[0014] Preferably, the starting bacterium of the genetically engineered bacterium is an Escherichia coli for producing lysine, and more preferably, the starting bacterium is Escherichia coli KA30.
[0015] Preferably, the genetically engineered bacterium is constructed by introducing the recombinant expression vector containing the gene ubiE and the lysine decarboxylase gene cadA into the starting bacterium respectively, or by introducing the recombinant expression vector containing both the gene ubiE and the lysine decarboxylase gene cadA into the starting bacterium.
[0016] Preferably, the genetically engineered bacterium is constructed by introducing the recombinant expression vector containing both the gene ubiE and the lysine decarboxylase gene cadA into the starting bacterium. Specifically, the gene ubiE is inserted into the plasmid vector pCDFDuet by enzyme digestion and ligation to obtain the recombinant expression vector pCDFDuet-ubiE, and the enzyme digestion sites are EcoR I and Hind III. Then, the lysine decarboxylase gene cadA is inserted into the recombinant expression vector pCDFDuet-ubiE by enzyme digestion and ligation, and the enzyme digestion sites are NcoR I and BamH I, to construct the recombinant expression vector pCDFDuet-ubiE-cadA. The pCDFDuet-ubiE-cadA is introduced into the Escherichia coli KA30 to obtain the genetically engineered bacterium for producing pentanediamine.
[0017] In a sixth aspect, the present application provides the genetically engineered bacterium of the fifth aspect for use in fermentative production of pentamethylene diamine.
[0018] Preferably, the method for fermentative production of pentamethylene diamine is as follows: overnight culture of the genetically engineered bacterium to prepare seed liquid, transfer of the fermentation medium with initial OD 600 0.1 at 37℃ and 200rpm for 12h, addition of IPTG to a final concentration of 0.5mM, induction at 25-37℃ for 12-36h; after the end of the culture, centrifugation at 12000rpm for 1-2min to obtain the supernatant, and detection of the pentamethylene diamine yield by high performance liquid chromatography. The fermentation medium contains 100mg / L streptomycin, and the formula is as follows: ammonium sulfate 10g / L, protein peptone 5g / L, yeast powder 2g / L, potassium chloride 0.5g / L, magnesium sulfate heptahydrate 1.6g / L, MopasNa 100mM, CaCO310g / L, biotin 30μg / L, Vb10.06g / L, glucose 20g / L, methionine 0.3g / L, threonine 0.3g / L, zinc sulfate 0.086g / L, copper sulfate 0.077g / L, manganese sulfate 0.032g / L, nicotinamide 0.01g / L, ferrous sulfate heptahydrate 0.032g / L.
[0019] Beneficial effects:
[0020] The present application provides a gene ubiE for improving the tolerance of Escherichia coli to pentamethylene diamine and applications thereof. The specific advantages are as follows:
[0021] (1) The present application expresses ubiE in Escherichia coli KA30 with high lysine production, and the growth experiment and transcriptomics under different pentamethylene diamine concentration stress verify that overexpression of the ubiE gene can effectively improve the tolerance of Escherichia coli to pentamethylene diamine.
[0022] (2) The strain expressing the ubiE gene is applied to the production of pentamethylene diamine, and finally the yield of fermentative production of pentamethylene diamine is improved.
[0023] (3) By expressing ubiE in the pentamethylene diamine production strain KA30-cadA, the yield of fermentative production of pentamethylene diamine of the obtained strain KA30-cadA-ubiE is significantly improved compared with KA30-cadA, from 8.54g / L to 10.63g / L, an increase of 24.47%. BRIEF DESCRIPTION OF DRAWINGS
[0024] The above and / or other aspects of the present application will become apparent and more readily appreciated from the following description, taken in conjunction with the accompanying drawings, in which:
[0025] Figure 1Growth of KA30-ubiE strain and control strain KA30 under 35 g / L pentamethylene diamine hydrochloride stress.
[0026] Figure 2 Growth of KA30-ubiE strain and control strain KA30 under 20 g / L pentamethylene diamine hydrochloride stress.
[0027] Figure 3 GO enrichment analysis of genes significantly down-regulated by overexpression of ubiE under 35 g / L pentamethylene diamine hydrochloride stress.
[0028] Figure 4 Growth of KA30-ubiE-cadA strain and KA30-cadA strain for fermentation production of pentamethylene diamine.
[0029] Figure 5 Yield chart of KA30-ubiE-cadA strain and KA30-cadA strain for fermentation production of pentamethylene diamine. DETAILED DESCRIPTION
[0030] The experimental methods described in the following examples are all conventional methods in the art unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.
[0031] In the following examples, the formula of the LB liquid medium is 10 g / L proteose peptone, 5 g / L yeast powder, and 5 g / L sodium chloride. The formula of the LB plate is 10 g / L proteose peptone, 5 g / L yeast powder, 5 g / L sodium chloride, and 15 g / L agar powder.
[0032] In the following examples, the detailed information of E. coli KA30 has been disclosed in Chinese patent CN113817762A.
[0033] Example 1 Verification of ubiE gene performance in lysine high-yield strain KA30
[0034] 1. Preparation of recombinant E. coli KA30-ubiE
[0035] (1) Construction of recombinant expression vector pCDFDuet-ubiE
[0036] The bifunctional 2-octenyl-6-methoxy-1,4-benzoquinol methytransferase and demethyl naphthoquinone methyltransferase gene ubiE was found through NCBI and was synthesized by Nanjing Qikexing Biological Technology Co., Ltd. The nucleotide coding sequence is shown in SEQ ID NO. 1:
[0037] ATGGTGGATAAGTCACAAGAAACGACGCACTTTGGTTTTCAGACCGTCGCGAAG
[0038] GAACAAAAAGCGGATATGGTCGCCCACGTTTTCCATTCCGTGGCATCAAAATACG
[0039] ATGTCATGAATGATTTGATGTCATTTGGTATTCATCGTTTGTGGAAGCGATTCACGA
[0040] TTGATTGCAGCGGCGTACGCCGTGGGCAGACCGTGCTGGATCTGGCTGGTGGCAC
[0041] CGGCGACCTGACAGCGAAATTCTCCCGCCTGGTCGGAGAAACTGGCAAAGTGGT
[0042] CCTTGCTGATATCAATGAATCCATGCTCAAAATGGGCCGCGAGAAGCTGCGTAATA
[0043] TCGGTGTGATTGGCAACGTTGAGTATGTTCAGGCGAACGCTGAGGCGCTGCCGTT
[0044] CCCGGATAACACCTTTGATTGCATCACCATTTCGTTTGGTCTGCGTAACGTCACCG
[0045] ACAAAGATAAAGCACTGCGTTCAATGTATCGCGTGCTGAAACCCGGCGGCCGCCT
[0046] GCTGGTGCTTGAGTTCTCGAAGCCAATTATCGAGCCGCTGAGCAAAGCCTATGAT
[0047] GCATACTCCTTCCATGTGCTGCCGCGTATTGGCTCACTGGTCGCGAACGACGCCG
[0048] ACAGCTACCGTTATCTGGCAGAATCCATCCGTATGCATCCCGATCAGGATACCCTG
[0049] AAAGCCATGATGCAGGATGCCGGATTCGAAAGTGTCGACTACTACAATCTGACGG
[0050] CAGGGGTTGTGGCGCTGCATCGTGGTTATAAGTTCTGA
[0051] The upstream primer ubiE-F has an EcoR I enzyme cutting site, and the sequence is as follows:
[0052] AAGAAGGAGATATACATAATGGTGGATAAGTCACAAGAAAC
[0053] The downstream primer ubiE-R has a Hind III enzyme cutting site, and the sequence is as follows:
[0054] TCTTTACCAGACTCGAGGTCAGAACTTATAACCACGATGCAG
[0055] The gene ubiE synthesized by GenScript is subjected to PCR amplification using the upstream primer ubiE-F and the downstream primer ubiE-R, and the PCR amplification conditions are as follows: 95℃ for 2 min, 95℃ for 20 s, 50℃ for 20 s, 72℃ for 30 s, for a total of 30 cycles, and 72℃ for 5 min. After 1% agarose gel electrophoresis, the corresponding ubiE gene fragment is recovered by using a purification recovery kit (purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.).
[0056] The ubiE gene fragment and the expression vector pCDFDuet are subjected to enzyme cutting by EcoR I and Hind III of Takara, respectively, and the enzyme cutting reaction system is as follows: 10×buffer 1 μL, EcoR I 1 μL, Hind III 1 μL, ubiE gene fragment or expression vector pCDFDuet 7 μL. After the enzyme cutting reaction system is reacted at 30℃ for 45 min, the enzyme-cut ubiE gene fragment and the enzyme-cut expression vector pCDFDuet are obtained, and then reacted at 37℃ for 45 min. The two enzyme cutting products are connected, and the reaction system is as follows: 10×Ligasebuffer 1 μL, T4 DNA Ligase (Takara) 1 μL, enzyme-cut ubiE gene fragment 7 μL, enzyme-cut expression vector pCDFDuet 1 μL. Then, the reaction is carried out at 25℃ for 3 hours, and the ligation product is transformed into Escherichia coli Trans1-T1. The positive strain Trans1-T1-pCDFDuet-ubiE is screened by PCR and subjected to DNA sequencing to verify that the recombinant plasmid is correctly constructed.
[0057] The positive strain Trans1-T1-pCDFDuet-ubiE is inoculated into 5 mL of LB liquid medium, and cultured at 37℃ and 200 rpm for overnight. After 12 hours, the recombinant expression vector pCDFDuet-ubiE is obtained by extraction according to the operation instruction of the plasmid extraction kit.
[0058] (2) Construction of recombinant E. coli KA30-ubiE
[0059] Mix 5 μL of recombinant expression vector pCDFDuet-ubiE with 30 μL of E. coli KA30 competent cells, after 25 min ice bath, 42℃ heat shock for 45 s, then ice bath for 2 min. In the clean bench, add 1 mL of LB liquid medium, and place it in a 37℃ shaker for 1 h. After the culture is complete, centrifuge at 4000 rpm for 4 min, remove 800 μL of supernatant in the clean bench, resuspend the remaining bacteria, and spread on LB plates containing 100 mg / L streptomycin. After spreading, place it in a 37℃ incubator for 20 h, and obtain the recombinant E. coli KA30-ubiE.
[0060] Inoculate the positive strain of recombinant E. coli KA30-ubiE into 5 mL of LB liquid medium containing 100 mg / L streptomycin, and shake culture at 37℃, 200 rpm overnight. When the OD 600 To 0.6-0.8, according to 800 μL of 30% v / v glycerol + 800 μL of bacterial solution, store the strain at -80℃.
[0061] 2, The effect of overexpression of ubiE on the tolerance of E. coli to pentamethylenediamine
[0062] (1) Strain activation
[0063] Inoculate the recombinant strain KA30-ubiE and the control strain KA30 on LB solid plates, and invert in a 37℃ incubator for 24 h, and separate single colonies.
[0064] Pick single colonies on the seed activation plate into 50 mL centrifuge tubes containing LB liquid medium, and place it in a 37℃, 200 rpm shaker for 8 h to obtain shake tube activated culture.
[0065] (2) Seed culture
[0066] Configure the LB liquid culture with a liquid volume of 30 mL in a 250 mL shake flask, after autoclaving, place it in a clean bench, and sterilize with ultraviolet light until it can be used after cooling. Take 1 mL of shake tube activated culture and inoculate it into the shake flask. And place it in a 37℃, 200 rpm shaker for 10 h to obtain the seed liquid.
[0067] (3) Drawing of growth curve in pentamethylenediamine hydrochloride medium
[0068] LB liquid culture containing 20 g / L and 35 g / L 1,5-pentanediamine hydrochloride respectively with a volume of 50 mL were configured in 250 mL shake flasks, which were sterilized by autoclaving and then placed in a clean bench for ultraviolet sterilization until cooling. The initial OD of the strain was controlled at 0.2, and the seed liquid obtained in step (2) was inoculated into LB liquid medium containing 20 g / L and 35 g / L 1,5-pentanediamine hydrochloride respectively, and 0.5 mmol / L IPTG was added, and then the culture was incubated at 37°C, 200 rpm for 24 h. The OD was detected every 4 h to draw the growth curve. 600 The OD was detected every 4 h to draw the growth curve. 600
[0069] The experimental results are shown in Figure 1 and Figure 2 The highest biomass of the experimental strains was higher than that of the control strain under the culture of LB liquid medium containing 20 g / L and 35 g / L 1,5-pentanediamine hydrochloride. Figure 1 The growth of the two strains under the stress of 35 g / L 1,5-pentanediamine hydrochloride, the growth of the two strains was not affected by 1,5-pentanediamine in the early growth stage, but the presence of 1,5-pentanediamine had a significant impact on the growth of the control strain in the logarithmic phase. After 24 h of culture, the OD 600 of the control group could only reach 0.61, while the OD 600 of the experimental group could reach 0.83. Figure 2 The growth of the two strains under the stress of 20 g / L 1,5-pentanediamine hydrochloride, due to the low concentration of 1,5-pentanediamine hydrochloride, the two strains quickly entered the logarithmic growth phase, and the OD 600 of the control group reached 2.7, and the OD 600 of the experimental group reached 3.1. The above results all showed that the tolerance of E. coli KA30 strain was significantly improved when ubiE was overexpressed.
[0070] 3. Transcriptome analysis
[0071] When KA30-ubiE was cultured in LB liquid medium containing 35 g / L 1,5-pentanediamine hydrochloride according to the above culture method, the bacterial cells were collected by 4°C, 4000 rpm, 10 min, and then washed twice with 4°C sterilized water and placed in an RNA-free 1.5 mL centrifuge tube. The centrifuge tube was frozen in liquid nitrogen for 15 minutes, and then stored at -80°C. The subsequent transcriptome sequencing analysis was carried out by Shanghai Pisenol Bio. The analysis work included: total RNA extraction, total RNA quality detection, rRNA removal, RNA fragmentation, cDNA synthesis, PCR enrichment library fragment, library quality control and Illumina platform sequencing.
[0072] The GO enrichment analysis is shown in Figure 3 .Figure 3 In the table, FDR is the false discovery rate, the lower the value, the more significant the enrichment of differentially expressed genes significantly down-regulated under external pentamethylene diamine stress, and the more reliable the comparison; Number represents the number of genes, indicating the number of genes down-regulated under external stress, wherein response to stimulus (14), cellular response to stimulus (10), cellular response to stress (9) and response to stress (12). Through GO enrichment analysis of down-regulated genes, it was found that the cell as a whole responded to external stress (including stimulus and stress) and was significantly down-regulated, indicating that overexpression of ubiE at the molecular transcription level relieved the stress stimulation on the cell and effectively improved the strain's tolerance to pentamethylene diamine.
[0073] Example 2 Fermentation of genetically engineered strain KA30-ubiE-cadA to produce pentamethylene diamine
[0074] 1. Construction of genetically engineered strain KA30-ubiE-cadA
[0075] (1) Construction of recombinant expression vectors pCDFDuet-ubiE-cadA and pCDFDuet-cadA
[0076] The lysine decarboxylase gene cadA was obtained through NCBI, and was synthesized by Nanjing Qikexi Biological Technology Co., Ltd. The nucleotide coding sequence is shown as SEQ ID NO. 2:
[0077]
[0078] The upstream primer cadA-F has a NcoR I enzyme cutting site, and the sequence is as follows:
[0079] AAGAAGGAGATATACATAATGAACGTTATTGCAATATTGAATCACATGGG The downstream primer cadA-R has a BamH I enzyme cutting site, and the sequence is as follows:
[0080] TCTTTACCAGACTCGAGGTTATTTTTTGCTTTCTTCTTTCAATACCTTAACGGTATA
[0081] GC
[0082] The upstream primer cadA-F and the downstream primer cadA-R are used for PCR amplification of the gene cadA synthesized by GenScript, and the amplification conditions are as follows: 95℃ for 2 min, 95℃ for 20 s, 50℃ for 20 s, 72℃ for 30 s, for a total of 30 cycles; and 72℃ for 5 min. After 1% agarose gel electrophoresis of the obtained PCR product, the corresponding cadA gene fragment is recovered by using a purification recovery kit (purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.).
[0083] The cadA gene fragment and the expression vector pCDFDuet-ubiE and the expression vector pCDFDuet are respectively cut by NcoR I and BamH I of Takara, and the enzyme cutting reaction system is as follows: 10×buffer 1 μL, NcoR I 1 μL, BamH I 1 μL, ubiE gene fragment or expression vector pCDFDuet-ubiE or pCDFDuet 7 μL. After the enzyme cutting reaction system is reacted at 30℃ for 45 min, the enzyme-cut cadA gene fragment and the enzyme-cut expression vector pCDFDuet-ubiE and the expression vector pCDFDuet are obtained, and then reacted at 37℃ for 45 min. The two enzyme cutting products are connected, and the reaction system is as follows: 10×Ligase buffer 1 μL, T4 DNA Ligase (Takara) 1 μL, enzyme-cut cadA gene fragment 7 μL, enzyme-cut expression vector 1 μL. Then, the connection product is reacted at 25℃ for 3 hours, and is transformed into Escherichia coli Trans1-T1. The positive strain Trans1-T1-pCDFDuet-ubiE-cadA and Trans1-T1-pCDFDuet-cadA are screened by PCR and DNA sequencing, and the correct construction of the recombinant plasmid is verified.
[0084] Positive strains Trans1-T1-pCDFDuet-ubiE-cadA and Trans1-T1-pCDFDuet-cadA were inoculated into 5 mL LB liquid medium, respectively, and 100 mg / L streptomycin was added, and the culture was shaken at 37°C, 200 rpm overnight. After 12 hours, the recombinant plasmids pCDFDuet-ubiE-cadA and pCDFDuet-cadA were extracted according to the operation instructions of the Genomic DNA Extraction Kit.
[0085] (2) Construction of genetically engineered bacteria KA30-ubiE-cadA and KA30-cadA
[0086] 5 μL of recombinant plasmid pCDFDuet-ubiE-cadA and recombinant plasmid pCDFDuet-cadA were mixed with 30 μL of E. coli KA30 competent cells, respectively, and then ice-bathed for 25 min, 42°C heat-shocked for 45 s, and then ice-bathed for 2 min. In the clean bench, 1 mL of LB medium was added and cultured at 37°C on a shaker for 1 h. After the culture was completed, it was centrifuged at 4000 rpm for 4 min, and 800 μL of supernatant was removed in the clean bench, the remaining bacterial body was resuspended and plated on LB plates containing 100 mg / L streptomycin. After plating, it was inverted and cultured in a 37°C incubator for 20 h to obtain recombinant E. coli KA30-ubiE-cadA and recombinant E. coli KA30-cadA. The E. coli KA30 has been disclosed in patent CN113817762B.
[0087] Positive strains of recombinant E. coli KA30-ubiE-cadA and recombinant E. coli KA30-cadA were inoculated into 5 mL LB liquid medium containing 100 mg / L streptomycin, and cultured at 37°C, 200 rpm overnight. When the OD 600 When the OD reached 0.6-0.8, the bacteria were preserved at -80°C by adding 800 μL of 30% glycerol and 800 μL of bacterial solution.
[0088] Strain activation: Genetically engineered bacteria KA30-ubiE-cadA (experimental group) and KA30-cadA (control group) were activated on LB plates for 24-36 h.
[0089] Seed liquid: positive single colonies were inoculated into 5 mL LB liquid medium (containing 100 mg / L streptomycin) and cultured at 37°C, 200 rpm overnight. When the OD 600 reached 1-2, the fermentation medium was transferred.
[0090] Fermentation broth culture: Seed broth was transferred to fermentation medium at 1-5% v / v inoculation, and the initial OD of fermentation broth was controlled at 0.1, and then the fermentation was carried out at 37℃ for 12h, and then IPTG was added to a final concentration of 0.5mmol / L, and the fermentation was induced at 25℃ for 12h. 600 Fermentation broth culture: Seed broth was transferred to fermentation medium at 1-5% v / v inoculation, and the initial OD of fermentation broth was controlled at 0.1, and then the fermentation was carried out at 37℃ for 12h, and then IPTG was added to a final concentration of 0.5mmol / L, and the fermentation was induced at 25℃ for 12h.
[0091] The fermentation medium added with 100mg / L streptomycin has the following formula: ammonium sulfate 10g / L, peptone 5g / L, yeast powder 2g / L, potassium chloride 0.5g / L, magnesium sulfate heptahydrate 1.6g / L, MopasNa 100mM, CaCO310g / L, biotin 30μg / L, Vb10.06g / L, glucose 20g / L, methionine 0.3g / L, threonine 0.3g / L, zinc sulfate 0.086g / L, copper sulfate 0.077g / L, manganese sulfate 0.032g / L, nicotinamide 0.01g / L, ferrous sulfate heptahydrate 0.032g / L.
[0092] 2mL of fermentation broth was centrifuged at 12000rpm for 2min, and the supernatant was taken for liquid phase detection, and the final growth OD value was measured. 600 The biomass data are shown in Table 1, and the biomass of strain KA30-cadA and KA30-ubiE-cadA under the same fermentation conditions is close, and the OD 600 is about 8.3. Figure 4
[0093] The detection method of pentanediamine is as follows: 1,5-pentanediamine concentration determination uses Agilent 1290 high performance liquid chromatography system and Agilent YMC Carotenoid C30 chromatographic column (4.6x250mm), mobile phase composition: 0.5% trifluoroacetic acid, 5% acetonitrile; flow rate 0.8mL·min -1 ; column oven temperature is 35℃; injection volume is 10μl; differential detector. The results are shown in Table 2, and the production of recombinant E. coli KA30-ubiE-cadA is better than that of negative control KA30-cadA. In the fermentation broth of 20g / L glucose, the yield of KA30-cadA pentanediamine is 8.54g / L, and the yield of recombinant E. coli KA30-ubiE-cadA reaches 10.63g / L, and the yield is increased by 24.47%. Figure 5
[0094] The application provides a gene ubiE for improving pentamethylenediamine tolerance of Escherichia coli and a thinking and method for application of the gene ubiE. The method and approach for specifically realizing the technical scheme are various, and the above description is only a preferred embodiment of the application. It should be pointed out that, for ordinary skilled technicians in the technical field, several improvements and refinements can be made without departing from the principle of the application, and the improvements and refinements should also be regarded as the protection scope of the application. The components not explicitly described in the embodiment can be realized by using the prior art.
Claims
1. A gene ubiE or a recombinant expression vector containing the gene ubiE or a genetically engineered bacterium containing the recombinant expression vector for use in improving the tolerance of Escherichia coli to pentanediamine, characterized in that, The nucleotide sequence of the gene ubiE The nucleotide sequence of the gene is shown as SEQ ID NO. 1; the starting strain of the genetically engineered bacteria is Escherichia coli for producing lysine.
2. Use according to claim 1, characterized in that, The growth state of the genetically engineered bacteria in the LB liquid medium containing 20-35 g / L pentanediamine hydrochloride is better than that of the starting bacteria.
3. The use of genetically engineered bacteria in the fermentation production of pentanediamine, characterized in that, The genetically engineered bacteria contain genes ubiE and lysine decarboxylase genes cadA The nucleotide sequence of the gene ubiE is shown in SEQ ID NO. 1; and the starting bacteria of the genetically engineered bacteria are Escherichia coli for producing lysine.
4. Use according to claim 3, characterized in that, The genetically engineered bacteria are constructed by introducing the recombinant expression vectors containing the genes ubiE and the lysine decarboxylase gene cadA into the original bacteria, or by introducing the recombinant expression vectors containing the genes ubiE and the lysine decarboxylase gene cadA into the original bacteria at the same time.
Citation Information
Patent Citations
Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli
CN113817762A
A recombinant Escherichia coli producing pentamethylenediamine and its application
CN113817762B
Method for producing 3-hydroxypropionic acid and other products
CN102695799A
Construction and application of pentamethylene diamine-tolerant recombinant escherichia coli
CN114774472A