A snp molecular marker related to pork yield efficiency of pigs and application thereof
By identifying and verifying SNP sites on pig chromosome 15 that affect MSTN gene expression, genetic markers associated with pig meat production traits were screened out, solving the problem of slow breeding progress in existing technologies and achieving the effect of improving pig meat production efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2024-06-13
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies struggle to effectively utilize molecular marker-assisted selection (MAS) to improve meat production efficiency in pigs, particularly the regulation of MSTN gene expression, leading to slow breeding progress.
By cloning the gene sequence of the segment 93707248-93708218 on pig chromosome 15, a SNP site (rs324385100) that significantly affects MSTN gene expression was discovered and verified. This site is located downstream of the MSTN gene, with position 306 of the nucleotide sequence changing from A to G. Primer pairs were designed for PCR amplification and sequencing to screen for genetic markers associated with pig meat production traits.
Individuals with the AA genotype at this SNP locus exhibit significant advantages in traits such as live backfat thickness, eye muscle area, and eye muscle depth, providing important genetic breeding guidance and improving meat production efficiency in pigs.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to an SNP molecular marker related to pig meat production efficiency; it also relates to the use of an SNP molecular marker related to pig meat production efficiency, wherein the SNP molecular marker is an eQTL that significantly affects the expression of the MSTN gene; the molecular marker clone is derived from the 93707553rd base of pig chromosome 15, which is located downstream of the MSTN gene. Background Technology
[0002] Meat production traits are the most critical traits in pigs, encompassing multiple aspects such as meat yield and meat quality. [1] Specifically, meat production includes indicators such as daily weight gain, feed conversion ratio, body weight, dressing percentage, backfat thickness, lean meat percentage, eye muscle area, and eye muscle depth. [2] With the continuous advancement of molecular biology techniques, we can utilize marker-assisted selection (MAS) to supplement traditional breeding methods. MAS technology detects genotypic differences between individuals at the nucleotide level, making it particularly suitable for traits with low heritability or those that cannot be directly measured in vivo. This technology has been widely applied in animal breeding. The development of animal breeding technology has gone through three stages: from simple phenotypic value breeding, to estimated breeding value breeding, and now to the molecular breeding stage. The emergence of the new generation of molecular marker SNP (Single Nucleotide Polymorphism) technology provides us with the possibility of selecting pig-related traits at the DNA level, thereby accelerating the breeding process. A single nucleotide polymorphism (SNP) refers to a polymorphism in the genomic DNA sequence caused by a single base mutation. There are four forms of SNPs: transitions, transversions, insertions, and deletions. It is a major source of genetic diversity and can occur in both coding and non-coding regions of the genome. SNPs in coding regions can directly affect gene expression products, i.e., the structure and function of proteins, while SNPs in non-coding regions can affect gene regulation, for example, by altering transcription factor binding, non-coding RNA, and epigenetic modifications. [3] .
[0003] Myostatin (MSTN) is a member of the transforming growth factor β (TGFβ) superfamily and is a negative regulator of skeletal muscle growth and development. Overexpression of the MSTN gene inhibits skeletal muscle growth in animals, while partial or complete deletion or reduced expression can lead to double muscle phenomenon (DMP) in animals.[4] MSTN overexpression inhibits myogenesis by downregulating the mRNA levels of key muscle development genes MyoD and MyoG, thereby hindering myogenic differentiation. Conversely, interference with endogenous MSTN expression or mutations in the MSTN gene promote myogenic differentiation. [5] .
[0004] Improving the meat production efficiency of core breeds such as Large White and Landrace pigs can largely transfer the advantages gained from these improvements to a large number of commercial pig offspring. This increases the meat production efficiency of commercial pigs, enhances their competitiveness, and improves the overall profitability of commercial pig farming.
[0005] Main References
[0006] [1] Li Longyun. Genetic analysis of major meat-producing traits of Shanxia Black Pig and its industrial application [D]. Jiangxi Agricultural University, 2022.
[0007] [2] Hu Xuanzi, Li Chen. Pig genetic improvement ushers in a "golden period" [J]. Chinese Animal Husbandry and Veterinary Abstracts, 2016, 32(01):4-5.
[0008] [3] Tak YG, Farnham PJ. Making sense of GWAS relevance: using epigenomics and genome engineering to understand the functional of SNPs in non-coding regions of the human genome. Epigenetics Chromatin. 2015,8:57.
[0009] [4]Kambadur R,Sharma M,Smith TP,Bass JJ.Mutations in myostatin(GDF8)in double-muscled Belgian Blue and Piedmontese cattle.Genome Research.1997,7(9):910-916.
[0010] [5] Tang Dongsheng, Zhan Qunmei, Wei Yanyan, Zhu Xiangxing. Research progress on the mechanism of myostatin regulating skeletal muscle growth in animals [J]. Bioresources, 2019, 41(06):486-493. Summary of the Invention
[0011] The purpose of this invention is to provide a SNP molecular marker related to pig meat production efficiency and to screen genetic markers associated with the pig meat production trait. By cloning the gene sequence of the 93707248-93708218 segment of pig chromosome 15, and using direct sequencing to find SNP sites and genotyping, the association between these sites and the pig meat production trait is analyzed, thereby establishing new marker-assisted selection sites for the pig meat production trait.
[0012] Another objective of this invention is to provide an application of a SNP molecular marker in improving pork meat production efficiency. The SNP molecular marker has an allelic substitution at position 306, resulting in polymorphism at that position: changes are observed in backfat thickness, eye muscle area, and eye muscle depth. The AA genotype at this SNP locus is a favorable genotype for pork meat production efficiency. This invention aims to discover and identify SNP loci associated with pork meat production traits, thereby providing important guidance for pig genetic breeding.
[0013] This invention is achieved through the following technical solution:
[0014] A SNP molecular marker associated with porcine meat production efficiency is disclosed. The SNP site corresponds to the gene sequence of segment 93707248-93708218 on porcine chromosome 15, with a fragment length of 971 bp. Its nucleotide sequence is shown in the attached sequence listing SEQ ID NO.1. BLAST alignment on the NCBI website revealed a nucleotide polymorphism (SNP) site within this amplified fragment, specifically as follows... Figure 3 As shown. The mutation at this SNP site is specifically located at base 93707553 on chromosome 15, where the base changes from A to G. Following the naming conventions of the Ensembl database, this mutation site is named rs324385100; this SNP molecular marker is an eQTL that significantly affects MSTN gene expression.
[0015] The experimental materials included American Large White, Danish Large White, and French Landrace pigs. Whole-genome DNA was extracted from the blood of these pigs, and primer pairs were designed based on the pig genome sequence (NC_010457.5) published in the NCBI database. The primer pair sequences are as follows:
[0016] Forward primer (SEQ ID NO.2): 5'-GAATTGAATAGACAGGGTGA-3',
[0017] Reverse primer (SEQ ID NO.3): 5'-TTGGGGGCTAAAGAGAGT-3'.
[0018] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 15, segment 93707248-93708218.
[0019] After PCR amplification using the above primer pairs, purification of the PCR product, cloning and sequencing, and sequence alignment analysis, a genetic marker associated with porcine meat production traits was screened. The nucleotide sequence of this genetic marker is shown in SEQ ID NO.1 below: the mutation site is located at position 306 of the sequence.
[0020] GAATTGAATAGACAGGGTGAATAGGGGTTAATTTTGAATAATCAGGGATCTCACAGATAAAGTAGAATGTGAGCAAAGATCTGAAGGAAATAACACAGTACTTTTAAATGACCATTCTTATCAGGAGGAATGTCATCTTCAAATATTATAATCATCAACACTTATTTCAAGTTCATTCTTGAGTTATAGGAAATAACTGACAGCTAAGCATATTGTAAAGTTCATAAATAGGACACTTTACAAATGTGACTTAACAGCAAATAAAATACAAAGCATCAAAAAGTATTCTTGGAGTTCCCGTCR(A / G)TGGCTC AGTGGAAACGAATCTGAATAGGAACATGAGATTGTGGGTTCGATCCCTGGCCTTGCTCAGTGGGTTAAGGATCACAGACATGGCTCGGATCTGGTGTTGCTGTGGCTGTGGTGTAGGCCAGCAGCTACAGCTCTGATTAG ACCCCTAGCCTGGGATCCCTCCCAATGCCATGGGTGCGGCACTAAAAGACAAAAAAAAAAAAAAAAAAAAGTATTCTGTCTTGCCCTTAAATTGTTCACACCATTTCAAAAATTTCAGGAAAATATGACAATCATTCAGTGA GAAAATTTAACTTTTGTTTAAATAGTTCTCAGCTGAAAAACAAAGCTTAATTAATTAGATTAGATTGCTTTAAGACACCAAATCAGACAGTCTTAGAACACTCCATTGGACAAAAGATTTAAGAGACAAAGGTTGGGTCGAAGCTGCCATTGGATACTGAAGACAGCTTTAAGCACTCTGCTTAATTCATAGAGAAAGGTATGTGTGTGTCACTGGCTGATGGATTTCTGTTGAGCAGGAACAATAAGCAACTAGGCTTAGAGCTCACTAATAAGATGATCAG CCTGTCTGGACCTGGGAGATATGGAAAAATATATGATTCTTGATGCAACTGTCTTTTAGAAAGAACACACTAATGATACTCTCTTTAGCCCCCAA。
[0021] A method for screening genetic markers associated with meat production traits in pigs, the method comprising the following steps:
[0022] Genomic DNA was extracted from the blood of American Large White, Danish Large White, and French Landrace pigs. Primers were designed based on the genomic sequence from -305 to 665 nucleotides upstream of this locus. The porcine genomic DNA was amplified by PCR using these primers, and the nucleotide sequence from -305 to 665 nucleotides upstream of this locus (see SEQ ID NO. 1 for details) was obtained by direct sequencing. This sequence contains one SNP site. This mutation site can be used as a genetic marker for association analysis of meat production traits in American Large White, Danish Large White, and French Landrace pigs.
[0023] This invention provides a genotyping method for detecting SNP sites in the above sequence.
[0024] This invention further provides an application of direct sequencing to determine the association between individuals with different genotypes and meat production traits, including the following steps:
[0025] To determine the correlation between SNPs in the 93707248-93708218 region of porcine chromosome 15 and phenotypic differences in pigs, American Large White, Danish Large White, and French Landrace strains were selected as experimental materials. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and porcine meat production efficiency was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.
[0026] Compared with the prior art, the present invention has the following advantages and effects:
[0027] Through preliminary analysis of eQTL and omics data in the laboratory, a number of SNP loci affecting MSTN gene expression were identified. Further screening based on the correlation with target genes and effect sizes revealed SNP loci significantly associated with MSTN gene expression. This locus is physically located at nucleotide 93,707,553 on pig chromosome 15. The R at position 306 of the SNP molecular marker's nucleotide sequence represents an allele substitution, leading to polymorphism at this position: in the trait of live backfat thickness, individuals with the AA genotype at this SNP locus have thinner live backfat; in the trait of eye muscle area, individuals with the AA genotype at this SNP locus have larger eye muscle area; in the trait of eye muscle depth, individuals with the AA genotype at this SNP locus have larger eye muscle depth; and the AA genotype at this SNP locus is a favorable genotype for pig meat production efficiency. This invention aims to discover and identify SNP loci associated with pig meat production traits, thereby providing important guidance for pig genetic breeding. Attached Figure Description
[0028] Sequence listing SEQ ID NO.1 is the nucleotide sequence of segment 93707248-93708218 of porcine chromosome 15, which serves as the nucleotide sequence for the genetic marker of this invention. A mutation site for an allele exists at the 306th base of this sequence, specifically a mutation from "A" to "G". The base at the mutation site in the sequence is the original base; the mutation mode is described in this specification and... Figure 3 .
[0029] Sequence listings SEQ ID NO.2 and SEQ ID NO.3 are primer pair sequences used to amplify the segment 93707248-93708218 of pig chromosome 15, which are used to detect the genetic markers of the present invention.
[0030] Figure 1 The genetic marker of this invention is an eQTL that significantly affects MSTN gene expression. The attached figure shows the eQTL that significantly affects MSTN gene expression, obtained from PigGTEx (https: / / piggtex.farmgtex.org / ).
[0031] Figure 2 This invention describes the cloning detection results of the 93707248-93708218 segment of porcine chromosome 15. The agarose gel concentration was 1.5%. Figure labeling: Lanes 1-4: PCR amplification products; Lane M: DL2000 Maker.
[0032] Figure 3 The nucleotide sequence of region 93707248-93708218 of porcine chromosome 15. The accompanying diagram illustrates that there is one mutation site in the sequence shown, which is the specific site causing the polymorphism in this region.
[0033] Figure 4 The sequencing results of the genetic marker sequence of this invention show a bimodal pattern, where the base "A" is mutated to "G". Detailed Implementation
[0034] Example 1: Obtaining the DNA fragment from region 93707248-93708218 of porcine chromosome 15 and establishing a method for SNP detection.
[0035] Primer pairs were designed based on the genome sequence of the 93707248-93708218 segment of pig chromosome 15. The specific sequences are as follows:
[0036] Forward primer (SEQ ID NO.2): 5'-GAATTGAATAGACAGGGTGA-3',
[0037] Reverse primer (SEQ ID NO.3): 5'-TTGGGGGCTAAAGAGAGT-3'.
[0038] The above primer pairs were used to perform PCR amplification on the genomic DNA of different experimental pig groups.
[0039] The PCR reaction system is shown in Table 1.
[0040] Table 1 PCR reaction system
[0041]
[0042] The PCR reaction conditions are shown in Table 2.
[0043] Table 2 PCR reaction conditions
[0044]
[0045] After purification and cloning, the obtained PCR product was sent to Wuhan HeCe Gene Technology Co., Ltd. for sequencing. BLAST alignment analysis revealed an A / G base mutation at position 306 of the sequence.
[0046] Example 2: Correlation analysis and application of the genetic markers of the present invention with meat production efficiency of different pig breeds
[0047] To determine the correlation between SNPs in the 93707248-93708218 region of porcine chromosome 15 and phenotypic differences in pigs, this study selected American Large White (465 pigs), Danish Large White (619 pigs), and French Landrace (126 pigs) as experimental materials. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and porcine meat production efficiency was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values. The analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the pattern N(0, σ). 2 )distributed.
[0048] Polymorphism detection was performed on the rs324385100 locus in the 93707248-93708218 region of pig chromosome 15, and three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.
[0049] Table 3 Genotype and allele frequencies of polymorphic site rs324385100
[0050]
[0051] Table 3 shows that the A allele frequency of the polymorphic site rs324385100 is higher than the G allele frequency in American and Danish Large White pig populations, while the A allele frequency is lower than the G allele frequency in French Landrace pig populations. The Hardy-Weinberg equilibrium test results indicate that in American Large White (χ²) pigs... 2 =2.64, P=0.10>0.05), Danish-type large white (χ²) 2 =3.57, P=0.06>0.05) and French Changbai (χ²) 2 =2.96, P=0.09>0.05) The genotype distribution of the polymorphic site rs324385100 conforms to the state of genetic equilibrium.
[0052] Table 4. Association analysis between polymorphic site rs324385100 and meat production efficiency.
[0053]
[0054] Note: The above values are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no label indicates no significant difference (P>0.05). The number in parentheses indicates the number of pigs.
[0055] Analysis of Table 4 revealed that the polymorphic locus rs324385100 was significantly correlated with live backfat thickness in American Large White, Danish Large White, and French Landrace pigs (P<0.05). Specifically, individuals with the AA genotype had significantly lower live backfat thickness than those with the GG genotype (P<0.05). Regarding eye muscle area, individuals with the AA genotype in both American and French Landrace pigs had significantly larger eye muscle areas than those with the GG genotype (P<0.05). Conversely, individuals with the AA genotype in Danish Large White pigs had significantly greater eye muscle depth than those with the GG genotype (P<0.05). From the perspectives of genetic stability and genetic progression, the AA genotype showed a clear advantage in reducing live backfat thickness and increasing eye muscle area and depth. Based on these results, we hypothesize that the polymorphic locus rs324385100 could serve as a potential genetic marker for increasing pig meat production efficiency.
Claims
1. The application of a SNP molecular marker associated with pig meat production efficiency in improving pig meat production efficiency, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the R at the SNP site in the sequence is A or G; the SNP molecular marker is a significant influence MSTN The eQTL for gene expression; the pigs are American Large White, Danish Large White, and French Landrace; the primer pair sequences used to detect the SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.3; the relevant traits for meat production efficiency are live backfat thickness, eye muscle area, and eye muscle depth; in the live backfat thickness trait, individuals with the AA genotype at this SNP locus have significantly lower live backfat thickness than individuals with the GG genotype; in the eye muscle area trait, individuals with the AA genotype at this SNP locus in American Large White and French Landrace pigs have significantly larger eye muscle area than individuals with the GG genotype; in the eye muscle depth trait, individuals with the AA genotype at this SNP locus in Danish Large White pigs have significantly larger eye muscle depth than individuals with the GG genotype; the AA genotype at this SNP locus is a favorable genotype for pig meat production efficiency.