Drug-resistant gene PA3514 of pseudomonas aeruginosa and application thereof

By knocking out the PA3514 gene in Pseudomonas aeruginosa strain PAS56 and regulating its ABC efflux system, the resistance of Pseudomonas aeruginosa to ceftazidime was solved, and its sensitivity to antibiotics was significantly improved.

CN118620921BActive Publication Date: 2026-03-10GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-17
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

The antibiotic resistance of Pseudomonas aeruginosa, especially resistance to ceftazidime, seriously affects the clinical treatment of infections.

Method used

By knocking out the PA3514 gene in Pseudomonas aeruginosa strain PAS56, its ABC efflux system was regulated, thereby increasing its sensitivity to ceftazidime.

Benefits of technology

The resistance level of Pseudomonas aeruginosa to ceftazidime increased by 8 times, significantly reducing its resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004895058510000041
    Figure BDA0004895058510000041
  • Figure BDA0004895058510000042
    Figure BDA0004895058510000042
  • Figure BDA0004895058510000043
    Figure BDA0004895058510000043
Patent Text Reader

Abstract

The application discloses a drug-resistant gene PA3514 of pseudomonas aeruginosa and application of the drug-resistant gene PA3514. The nucleotide sequence of the PA3514 gene is shown as SEQ ID NO. 1. The application finds that the drug resistance level of a pseudomonas aeruginosa PAS56 strain to ceftazidime is improved by 8 times after knocking out the PA3514 gene. Therefore, the PA3514 gene is related to the ceftazidime drug resistance of the pseudomonas aeruginosa.
Need to check novelty before this filing date? Find Prior Art

Description

Technical fields:

[0001] This invention belongs to the field of microbiology, specifically relating to a drug resistance gene PA3514 of Pseudomonas aeruginosa and its application. Background technology:

[0002] Pseudomonas aeruginosa (PA) is a Gram-negative bacterium and a major opportunistic pathogen causing chronic and nosocomial infections. It can adapt to harsh environments and is widely distributed in the environment. Statistical data shows that from 2005 to 2020, the clinical isolation rate of Pseudomonas aeruginosa was consistently among the highest, posing a significant challenge to the treatment of nosocomial infections. Drug resistance has long been the biggest obstacle to the clinical treatment of Pseudomonas aeruginosa infections.

[0003] The drug resistance mechanisms of *Pseudomonas aeruginosa* are complex, including intrinsic resistance, adaptive resistance, and acquired resistance. Low outer membrane permeability is one of the intrinsic mechanisms of resistance to multiple antibiotics. Secondly, the multidrug efflux system and various types of porins in *P. aeruginosa* also contribute to its intrinsic resistance to multiple antibiotics. Currently, the known Pseudomonas aeruginosa efflux pump system mainly consists of seven protein families: the ATP-binding cassette superfamily (ABC), the major facilitator superfamily (MFS), the multidrug and toxin extrusion family (MATE), the small multidrug resistance family (SMR), the resistance nodulation cell division superfamily (RND), the p-aminobenzoyl-glutamate transporter family (AbgT), and the Ptoteobacterial antimicrobial compound efflux family (PACE). Summary of the Invention:

[0004] The purpose of this invention is to provide a gene PA3514 associated with drug resistance in Pseudomonas aeruginosa.

[0005] This invention demonstrates through experiments that knocking out the PA3514 gene in the P. aeruginosa PAS56 genome increases the minimum inhibitory concentration (MIC) of ceftazidime against the bacterium by 8 times.

[0006] Therefore, the object of the present invention is to provide a gene PA3514 associated with drug resistance in Pseudomonas aeruginosa, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] A second objective of this invention is to provide the application of the aforementioned gene PA3514 in regulating antibiotic resistance in Pseudomonas aeruginosa.

[0008] Preferably, the application of gene knockout PA3514 in reducing antibiotic resistance in Pseudomonas aeruginosa.

[0009] The preferred Pseudomonas aeruginosa strain is Pseudomonas aeruginosa PAS56.

[0010] The third objective of this invention is to provide a method for reducing antibiotic resistance in Pseudomonas aeruginosa by knocking out the PA3514 gene in Pseudomonas aeruginosa.

[0011] The antibiotic in question is ceftazidime.

[0012] This invention reveals that the MIC of ceftazidime against Pseudomonas aeruginosa PAS56 is 2 μg / mL. Knocking out the PA3514 gene in this strain increases the MIC of ceftazidime against the knockout strain to 16 μg / mL. In other words, knocking out the PA3514 gene in the PAS56 genome increases the strain's resistance to ceftazidime by 8-fold. The PA3514 gene is involved in the regulation of the ABC efflux system. Detailed implementation method:

[0013] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0014] Example 1:

[0015] Preparation of PAS56 bacterial suspension [Pseudomonas aeruginosa PAS56, disclosed in NCBI, accession number PP882821.1, which the applicant also holds and guarantees to make available to the public for 20 years from the date of application]: A sample of Pseudomonas aeruginosa PAS56 culture in the exponential growth phase was taken, centrifuged, washed once with PBS buffer, resuspended in PBS, and diluted to 10⁻⁶. 8 CFU / mL was used to obtain a PAS56 bacterial suspension.

[0016] 1. PAS3514 gene knockout experiment

[0017] Based on the complete genome sequence of strain PAS56 (as shown in SEQ ID NO.1) and the selection of restriction enzyme sites on the pK18-GM plasmid vector (purchase information: http: / / www.biovector.net / product / 2100123.html), primer sequences for the upstream and downstream homologous arms of the PA3514 gene were designed using Premier 5.0 software. The primers were synthesized by Qingke Biotechnology Co., Ltd., as shown in Table 1. Using the genomic DNA of strain PAS56 as a template, PCR amplification was performed on the upstream and downstream homologous arm fragments of the PA3514 gene (PA3514-UF and PA3514-UR are a pair of forward and reverse primers for the upstream homologous arm of the PA3514 gene, respectively; PA3514-DF and PA3514-DR are the forward and reverse primers for the downstream homologous arm of the PA3514 gene, respectively). The PCR reaction system and reaction conditions are shown in Tables 2 and 3. The pK18-GM vector plasmid was double-digested with QuickCutHind III and QuickCutBamHI and then recovered via gel extraction. The Ultra One Step Cloning Kit allows for seamless splicing of the upstream and downstream homologous arms of the PA3514 gene with the pK18-GM gel-recovered vector. The mixture is then incubated at 50°C for 30 minutes (temperature controlled by a PCR instrument) to construct a recombinant vector. The successfully constructed recombinant vector is then transformed into Escherichia coli s17-1 to obtain a recombinant Escherichia coli strain. The PAS56 strain was conjugated with a recombinant Escherichia coli strain. Two rounds of screening were conducted: (First round: double antibody plate screening; several colonies were selected, and PCR verification was performed using primers on the outer homologous arm; colonies without a target band were considered single-crossover strains with plasmid insertion into the target gene region; Second round: high-concentration sucrose medium screening; several single colonies were selected, and PCR verification was performed using primers on the outer homologous arm; a small band was initially identified as a double-crossover strain. The PCR-verified knockout strains were sent for sequencing; the sequencing results were consistent with the PCR results, indicating successful screening of the double-crossover PA3514 gene knockout strain). This resulted in the identification of the double-crossover PA3514 gene knockout strain – Pseudomonas aeruginosa PAS56-ΔPA3514.

[0018] Table 1 Primer sequences of upstream and downstream homologous arms of gene PA3514 in Pseudomonas aeruginosa strain PAS56

[0019]

[0020] Table 2 PCR reaction system

[0021]

[0022] Table 3 PCR reaction conditions

[0023]

[0024] 2. MIC assay of ceftazidime against PAS56 strain and its PA3514 gene knockout strain

[0025] The MIC of ceftazidime against P. aeruginosa PAS56 and its PA3514 knockout strain—P. aeruginosa PAS56-ΔPA3514—was determined using the standard micro-broth dilution method. 100 μL of CAMHB medium was added to each well of a 12 × 8 well plate, with ceftazidime concentration gradients of 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 μg / mL. Bacterial suspensions were prepared using P. aeruginosa cells in the exponential growth phase, and the final concentration of the experimental strain was 2 × 10⁻⁶. 5 CFU / mL. The positive control wells contained no ceftazidime, and the negative control wells contained sterile solution. The experiment was conducted in triplicate. The plates with samples were incubated at 37°C for 16-20 hours before the results were read. The quality control strain used was *Pseudomonas aeruginosa* ATCC27853. Results were interpreted according to CLSI (2020), and the lowest ceftazidime concentration at which no obvious bacterial growth was observed visually was determined as the MIC. Normal bacterial growth was observed in the positive control wells, and no bacterial growth was observed in the negative control wells. The antibiotic MIC results of the reference quality control strain were within the guideline requirements.

[0026] Experimental results:

[0027] The MICs of ceftazidime against P. aeruginosa PAS56 and its PA3514 gene knockout strain, P. aeruginosa PAS56-ΔPA3514, are shown in Table 4. The MICs of ceftazidime against PAS56 and its PA3514 gene knockout strain, P. aeruginosa PAS56-ΔPA3514, were 2 μg / mL and 16 μg / mL, respectively. Knocking out the PA3514 gene in P. aeruginosa PAS56 increased the strain's resistance to ceftazidime by 8-fold. The experimental results indicate that the PA3514 gene is associated with ceftazidime resistance. The PA3514 gene is involved in the regulation of the ABC efflux system in P. aeruginosa. An important function of the ABC efflux system is the intracellular transport of compounds and proteins. The deletion of this gene may restrict the entry of ceftazidime into the cell, thus increasing the strain's resistance level.

[0028] Table 4. Minimum inhibitory concentrations of ceftazidime against Pseudomonas aeruginosa PAS56 and its gene knockout strains.

[0029]

[0030] The experimental results in summary indicate that the PA3514 gene of Pseudomonas aeruginosa is associated with the bacterium's resistance to ceftazidime, and knocking out this gene will increase the strain's resistance to ceftazidime.

[0031] SEQ ID NO.1

[0032] ATGAGAGCGACGTCGTTGAGCATCCTCACTTCCGAGCATTCGCTACCTGTAGCCGCTCCTGCGGATAGCCGTCTCGAAATCGAATTCCGCGGCGTCGCCAAGCATTTTCCGGGCCGCGGCAAAAGCGCGGCGACCCTCGCGGTGCAGGGGCTCGACCTGGCCATCCGCCGCGGCGAGGTGGTGTCCATCATCGGGCCGTCCGGTTGCGGCAAG AGCACCCTGCTGAACATGGGGGCGGGTCTTCACGCACCCAGCGAAGGCGAGGTGCGGGTCGGCGGCGAGCGGGTCAGCGGCCCGGTACGCAAGGTCTCCTTCATGTTGCAGAAGGACCTGCTGATGCCCTGGCGCAGCATTCGCCGCAACATCGAACTGGGCCTGGAGATCGACGGTCGCGCGGCCGGCGAACGGCGCGCCATCGCCGAGGAA ATGCTGGAGAAGTGTCACCTCGCCGGTTTCGCCGAGCACTATCCGTTCCAGCTTTCCGGCGGCATGCGCCAACGCGCCGCCCTGGCCCGAACCCTGGCCACCGACCCGCAGGTGCTGTTCCTCGACGAGCCGTTCTCGGCCCTCGACGCGCAGACCAAGATGATCCTCCAGCAGGACCTGGCGCGGATGCTCTGCGAGCAACGCAAGACCGCG CTGTTCATTACCCACGACCTGGTCGAGGCGATCGCCATGTCCGATCGCATCCTGGTGATGAGCGCGCGGCCGGGCACCATCGTCGAGGAGATCGAGGTCGGCCTGCCGCTGCGACAACCCGCTGGAGCGCCGCAAGCTGCCGGAGATCGGGCCGCTGGTCGGGCGCCTGATGACCCTGCTGAAAGTGGGCGAGAGCGCCGAGCTGCACTGA

Claims

1. A gene PA3514 application in regulating the antibiotic resistance of Pseudomonas aeruginosa, said regulation is to knock out the gene PA3514 application in improving the resistance of Pseudomonas aeruginosa to ceftazidime, the nucleotide sequence of said gene PA3514 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The Pseudomonas aeruginosa is Pseudomonas aeruginosa (ATCC 27853) Pseudomonas aeruginosa ) PAS56.

3. A method of increasing antibiotic resistance of Pseudomonas aeruginosa, characterized by, Pseudomonas aeruginosa of claim 1 PA3514 , said antibiotic is ceftazidime.

4. The method of claim 3, wherein, The Pseudomonas aeruginosa is Pseudomonas aeruginosa (ATCC 27853) Pseudomonas aeruginosa ) PAS56.