A primer probe set and kit for detecting rifampicin-resistant gene of mycobacterium tuberculosis
By combining RT-RAA and qPCR technologies with docosane separators, the rpoB gene locus in Mycobacterium tuberculosis can be rapidly detected. This solves the problems of long detection time and low sensitivity in existing technologies, and achieves highly sensitive and specific detection of rifampicin resistance genes in Mycobacterium tuberculosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-16
- Publication Date
- 2026-03-31
AI Technical Summary
Existing nucleic acid amplification technologies, such as LNA probe fluorescent PCR detection, are time-consuming and have low sensitivity, making it difficult to quickly and accurately detect the heterogeneous drug resistance of rifampicin resistance genes in Mycobacterium tuberculosis.
The detection method employs a combination of RT-RAA and qPCR. By designing RAA primers and qPCR primers and probes targeting the rpoB gene, and using n-dodecane as a separator, two amplifications are achieved within a single closed tube, enabling rapid detection of sites 516, 526, 531, and 533 of the Mycobacterium tuberculosis rpoB gene.
The detection sensitivity has been improved to 5 copies/ul, which is 20 times higher than qPCR. The reaction can be completed within 1 hour. It has good specificity and is suitable for tuberculosis detection nationwide.
Smart Images

Figure CN116254355B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to a primer and probe set and kit for detecting the rifampicin resistance gene in Mycobacterium tuberculosis. Background Technology
[0002] The World Health Organization (WHO) 2020 Global Tuberculosis Report shows that China had approximately 842,000 new tuberculosis cases, accounting for about 8.4% of the global total, ranking third in the world. Of these, only 47% were pathogenically confirmed, lower than the global detection rate of 57%. In areas with high prevalence of drug-resistant tuberculosis, rapid, reliable, and inexpensive technologies and methods are needed to identify drug-resistant tuberculosis patients.
[0003] As research deepens, the issue of heterogeneous rifampicin resistance in Mycobacterium tuberculosis has become increasingly prominent in clinical practice. Heterogeneous drug resistance in Mycobacterium tuberculosis refers to the coexistence of susceptible and drug-resistant bacteria in a single tuberculosis patient sample, with varying ratios. The emergence of drug-resistant bacteria is related to their inherent resistance, natural mutations, and acquired resistance. During treatment, not every bacterial gene mutation leads to a decrease in overall efficacy; a certain number of drug-resistant bacteria are required for selective elimination of susceptible bacteria by the drug. The remaining drug-resistant bacteria then amplify and become the dominant flora. Exceeding a certain proportion of drug-resistant bacteria can cause a decrease in clinical responsiveness; this proportion is called the critical proportion of drug-resistant bacteria, currently generally accepted as 1%. That is, when the proportion of drug-resistant bacteria in a heterogeneous drug-resistant sample exceeds 1%, clinical chemotherapy is likely to fail to achieve the desired effect. Therefore, detecting a small number of drug-resistant bacteria against a background of a large number of susceptible bacteria has significant clinical implications.
[0004] Currently, traditional culture-based drug susceptibility testing requires at least four weeks to identify slow-growing drug-resistant tuberculosis (MTB). Nucleic acid amplification techniques (NAATs) can determine resistance to corresponding anti-tuberculosis drugs by detecting mutations or wild-type deletions in resistance-related genes, and have been increasingly used to diagnose rifampicin-resistant tuberculosis. Among NAATs, locked nucleic acid (LNA) probe fluorescent PCR detection is one of the most reliable and sensitive methods. LNA probes can easily distinguish a single base mutation through amplification curves without requiring interpretation based on differences in Ct values between probes or additional Tm analysis. However, LNA probe-based fluorescent PCR detection is time-consuming and has relatively low sensitivity. Summary of the Invention
[0005] This invention provides a primer and probe set and kit for detecting the rifampicin resistance gene in Mycobacterium tuberculosis. The primer and probe set can simultaneously and rapidly detect sites 516, 526, 531 and 533 of the rpoB gene in Mycobacterium tuberculosis. It has higher sensitivity than ordinary qPCR, a significantly shorter reaction time, and good specificity.
[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:
[0007] This invention provides a primer and probe set for detecting the rifampicin resistance gene in Mycobacterium tuberculosis, comprising RAA primers and qPCR primers targeting the rpoB gene, probe primers targeting the wild-type rpoB gene, and probe primers targeting the mutant rpoB gene; the RAA primers and qPCR primers targeting the rpoB gene include: RAA-F, RAA-R, qPCR-F, and qPCR-R; the nucleotide sequences of RAA-F, RAA-R, qPCR-F, and qPCR-R are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively. The probe primers targeting the wild-type rpoB gene include: WT1-P, WT2-P, and WT3-P; the nucleotide sequences of WT1-P, WT2-P, and WT3-P are shown in SEQ ID NO.5 to SEQ ID NO.7, respectively; the probe primers targeting the mutant rpoB gene include: MUT1-P, MUT2A-P, MUT2B-P, and MUT3-P; the nucleotide sequences of MUT1-P, MUT2A-P, MUT2B-P, and MUT3-P are shown in SEQ ID NO.8 to SEQ ID NO.11, respectively.
[0008] This invention provides a kit for detecting the rifampicin resistance gene in Mycobacterium tuberculosis, comprising the aforementioned primer and probe set, RAA reaction reagent, and qPCR reaction reagent.
[0009] Preferably, the kit further includes n-dodecane.
[0010] Preferably, the reagents for the qPCR reaction include buffer, Taq hot-start enzyme, MgCl2, dNTPs, and nuclease-free water; the reagents for the RAA reaction include A buffer, B buffer, and nuclease-free water.
[0011] This invention provides a method for detecting rifampicin resistance genes in Mycobacterium tuberculosis for non-disease diagnostic purposes, comprising the following steps: 1) extracting nucleic acid from the sample to be tested; 2) using the nucleic acid as a template, performing RAA amplification and qPCR amplification sequentially using the primer and probe set, and collecting fluorescence signals; the amplification systems for RAA amplification and qPCR amplification are separated by n-dodecane; both RAA amplification and qPCR amplification are performed in sensitive tubes and drug-resistant tubes; 3) determining the drug resistance status of the sample to be tested based on the fluorescence amplification curves of the sensitive tubes and drug-resistant tubes.
[0012] Preferably, the RAA amplification reaction system, in 40 μl units, comprises the following components: 25 μl reaction buffer, 11 μl nuclease-free water, 2 μl RAA-F, and 2 μl RAA-R; the RAA amplification reaction program includes 39 °C for 10 min.
[0013] Preferably, the qPCR amplification reaction system in the sensitive tube, in 40 μl increments, comprises the following components: 12.5 μl Buffer, 10.7 μl nuclease-free water, 0.5 μl Taq hot-start enzyme, 0.6 μl dNTPs, 1.2 μl MgCl2, 5 μl qPCR-F, 5 μl qPCR-R, 1.5 μl WT1-P, 1 μl WT2-P, and 2 μl WT3-P; the qPCR amplification reaction system in the drug-resistant tube, in 40 μl increments, comprises the following components: 12.5 μl Buffer, 6.7 μl nuclease-free water, 0.5 μl Taq hot-start enzyme, 0.6 μl dNTPs, 1.2 μl MgCl2, 5 μl qPCR-F, 5 μl qPCR-R, 1.5 μl MUT1-P, 3 μl MUT2A-P, and 3 μl MUT2B-P. 1 μl and 3 μl of MUT3-P; the reaction program for qPCR amplification in both the sensitive tube and the drug-resistant tube includes: 95℃, 5 min; 95℃, 15 s, 60℃, 30 s, 72℃, 30 s, 24 cycles.
[0014] Preferably, the amplification systems for RAA amplification and qPCR amplification in the sensitive tube and the drug-resistant tube are separated by n-dodecane, including: adding molten n-dodecane to the qPCR amplification system and letting it stand, with the n-dodecane floating on top of the qPCR amplification system, and after the n-dodecane solidifies, adding the RAA amplification system on top of the solidified n-dodecane.
[0015] Preferably, the RAA amplification and qPCR amplification are performed in a capped tube; adding RAA amplification to solidified n-dodecane includes adding the RAA amplification system and template to solidified n-dodecane, adding magnesium acetate to the cap, and using magnesium acetate to initiate the RAA reaction.
[0016] This invention provides the application of the primer-probe set or the kit in the preparation of products for detecting rifampicin resistance genes in Mycobacterium tuberculosis.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] This invention is the first to use a combination of RT-RAA and qPCR to simultaneously detect sites 516, 526, 531, and 533 of the Mycobacterium tuberculosis rpoB gene. The detection sensitivity can reach 5 copies / µl, which is 20 times higher than that of qPCR (100 copies / µl), and the detection capability for heterogeneous drug resistance mutations is 5%.
[0019] The primer and probe set designed in this invention has high sensitivity and good specificity, and can achieve the purpose of simultaneously detecting the 516, 526, 531 and 533 sites of the Mycobacterium tuberculosis rpoB gene.
[0020] The detection method of this invention significantly shortens the reaction time; the reaction can be completed within one hour when placed in a real-time PCR instrument. During the COVID-19 pandemic, various provinces and cities have already acquired real-time PCR instruments and basic testing capabilities, therefore this invention has the potential for nationwide application and can alleviate the burden of tuberculosis testing. Attached Figure Description
[0021] Figure 1 MLP-RAP principle diagram.
[0022] Figure 2 Schematic diagram of the MLP-RAP method for detecting rifampicin resistance mutations in Mycobacterium tuberculosis.
[0023] Figure 3 MLP-RAP sensitivity detection results for wild-type plasmids.
[0024] Figure 4 MLP-RAP sensitivity detection results of mutant D516V plasmid.
[0025] Figure 5 MLP-RAP sensitivity detection results of mutant H526D plasmid.
[0026] Figure 6 MLP-RAP sensitivity detection results of mutant H526Y plasmid.
[0027] Figure 7 MLP-RAP sensitivity detection results of mutant S531L plasmid.
[0028] Figure 8 Results of sensitivity detection of each plasmid by real-time PCR.
[0029] Figure 9 Results of MLP-RAP heterogeneity drug resistance testing for each plasmid.
[0030] Figure 10 Results of MLP-RAP heterogeneous drug resistance assay for mutant S531L plasmid at different concentrations.
[0031] Figure 11 The results of first-generation sequencing of MLP-RAP and nested PCR products of clinical isolates with heterogeneous drug resistance of the 526-TAC mutation type. Detailed Implementation
[0032] This invention provides a primer and probe set for detecting the rifampicin resistance gene in Mycobacterium tuberculosis, including RAA primers and qPCR primers targeting the rpoB gene, probe primers targeting the wild-type rpoB gene, and probe primers targeting the mutant rpoB gene. The primer and probe set described in this invention is shown in Table 1.
[0033] Table 1 Primer and LNA probe information
[0034] Primer / Probe Name Serial Number Sequence (5'-3') length RAA-F SEQ ID NO.1 AGGACGTGGAGGCGATCACACCGCAGACGTT 31bp RAA-R SEQ ID NO.2 CAGGGGTTTCTATCGGGCACATCCGGCCGTA 31bp qPCR-F SEQ ID NO.3 TGGTCGCCGCGATCAAGGA 19bp qPCR-R SEQ ID NO.4 CTCACGTGACAGACCGC 17bp WT1-P SEQ ID NO.5 HEX-ATGG+A+CCAGAA+CAAC-BHQ1 15bp WT2-P SEQ ID NO.6 Cy5-ACCC+ACAAGCG+C+CGA-BHQ2 15bp WT3-P SEQ ID NO.7 FAM-ACT+GT+CGGCGCTG-BHQ1 13bp MUT1-P SEQ ID NO.8 HEX-ATGG+T+CCAGAA+CAAC-BHQ1 15bp MUT2A-P SEQ ID NO.9 Cy5-ACCG+ACAAGCG+C+CGA-BHQ2 15bp MUT2B-P SEQ ID NO.10 ROX-ACCT+ACAAGCG+C+CGA-BHQ2 15bp MUT3-P SEQ ID NO.11 FAM-ACT+GT+TGGCGCTG-BHQ1 13bp
[0035] Note: The bases after the "+" sign are locked nucleic acid modified probes; the sequence listings of SEQ ID NO.5 to SEQ ID NO.11 do not contain fluorescent groups or "+" signs.
[0036] In this invention, WT1-P, WT2-P, and WT3-P are strictly matched with the wild-type rpoB gene sequence and have single-base resolution, respectively covering three different positions of the rpoB gene (e.g., Figure 2 As shown, WT1-P covers codon 516, WT2-P covers codon 526, and WT3-P covers codons 531 and 533. The MUT1-P, MUT2A-P, MUT2B-P, and MUT3-P are strictly matched with the four mutant rpoB gene sequences (D516V, H526Y, H526D, and S531L), respectively, and can accurately identify the presence of mutation types, covering the base mutation positions in the mutant rpoB gene sequences.
[0037] This invention provides a kit for detecting rifampicin resistance genes in Mycobacterium tuberculosis, comprising the aforementioned primer and probe set, RAA reaction reagents, and qPCR reaction reagents. In this invention, the kit further comprises n-dodecane. In this invention, the qPCR reaction reagents comprise buffer, Taq hot-start enzyme, MgCl2, dNTPs, and nuclease-free water; the RAA reaction reagents comprise A Buffer, B Buffer, and nuclease-free water.
[0038] This invention provides a method for detecting rifampicin resistance genes in Mycobacterium tuberculosis, comprising the following steps: 1) extracting nucleic acid from the sample to be tested; 2) using the nucleic acid as a template, and employing the primer and probe set, sequentially performing RAA amplification and qPCR amplification, and collecting fluorescence signals; the amplification systems for RAA amplification and qPCR amplification are separated by n-dodecane; both RAA amplification and qPCR amplification are performed in sensitive tubes and drug-resistant tubes; 3) determining the drug resistance status of the sample to be tested based on the fluorescence amplification curves of the sensitive tubes and drug-resistant tubes. The RAA amplification and qPCR amplification combination technique described in this invention is called RAP technology (Recombinase-aided PCR), which combines the rapid and efficient amplification advantages of RAA with the advantages of qPCR multiplex probes, achieving two amplifications in a single closed tube, first isothermal and then temperature-controlled, resulting in at least 10 times higher sensitivity than qPCR. In this invention, n-dodecane is added between the RAA system and the qPCR system. The RAA reaction occurs at 39°C, where the n-dodecane is solid, effectively isolating the two systems. Within a short time (10-15 minutes), the RAA reaction enriches a large amount of template. When the temperature rises to 95°C, the wax layer melts and moves to the upper liquid layer. The higher density of the RAA system causes it to fall into the lower qPCR system, where it serves as the template for the qPCR reaction. The RAP technology described in this invention allows for result interpretation within one hour in a quantitative PCR instrument, and features simple probe design, high amplification efficiency, speed, and high sensitivity.
[0039] In this invention, the RAA amplification reaction system, in 40 μl units, comprises the following components: 25 μl reaction buffer, 11 μl nuclease-free water, 2 μl RAA-F, and 2 μl RAA-R; the RAA amplification reaction program includes 39 °C for 10 min.
[0040] In this invention, the qPCR amplification reaction system in the sensitive tube, calculated in 40 μl units, comprises the following components: 12.5 μl Buffer, 10.7 μl nuclease-free water, 0.5 μl Taq hot-start enzyme, 0.6 μl dNTPs, 1.2 μl MgCl2, 5 μl qPCR-F, 5 μl qPCR-R, 1.5 μl WT1-P, 1 μl WT2-P, and 2 μl WT3-P; the qPCR amplification reaction system in the drug-resistant tube, calculated in 40 μl units, comprises the following components: 12.5 μl Buffer, 6.7 μl nuclease-free water, 0.5 μl Taq hot-start enzyme, 0.6 μl dNTPs, 1.2 μl MgCl2, 5 μl qPCR-F, 5 μl qPCR-R, 1.5 μl MUT1-P, 3 μl MUT2A-P, and 3 μl MUT2B-P. 1 μl and 3 μl of MUT3-P. The reaction program for qPCR amplification in both sensitive and resistant tubes includes: 95℃, 5 min; 95℃, 15 s, 60℃, 30 s, 72℃, 30 s, 24 cycles.
[0041] In this invention, the preferred concentration of each primer or probe in the primer-probe set is 0.1 to 100 μmol / L.
[0042] In this invention, the amplification systems for RAA amplification and qPCR amplification in the sensitive and drug-resistant tubes are separated by n-dodecane. The process includes: adding molten n-dodecane to the qPCR amplification system and allowing it to stand; the n-dodecane floats on top of the qPCR amplification system; and after the n-dodecane solidifies, adding the RAA amplification system onto the solidified n-dodecane. The n-dodecane used in this invention is a white crystalline solid with a melting point of 44°C, solid at room temperature, and a density of 0.7944 g / mL. It disintegrates with temperature changes and does not affect the nucleic acid amplification reaction. Because the RAA and qPCR reactions require different temperatures, this invention uses n-dodecane to separate the two reaction systems. This invention achieves rapid, accurate, and highly sensitive detection of the rifampicin rpoB gene in Mycobacterium tuberculosis using a single-tube, closed-tube, two-stage, one-step two-tube process by adding n-dodecane as a special material to separate the two systems.
[0043] In this invention, the RAA amplification and qPCR amplification are performed in a capped tube. The step of adding the RAA amplification system to solidified n-dodecane includes: adding the RAA amplification system and template to solidified n-dodecane, adding magnesium acetate to the cap, and initiating the RAA reaction using magnesium acetate. The amount of RAA amplification system added in this invention is 8–12 μL, preferably 10 μL; the amount of template added is 0.5–2.5 μL, preferably 1 μL or 2 μL; and the amount of magnesium acetate added is 0.5–1.5 μL, preferably 1 μL.
[0044] In this invention, as one possible embodiment, the qPCR amplification system is dispensed into eight-tube strips. Liquid n-dodecane is added, and the strips are then treated at 60°C for 1 min and 4°C for 30 s to allow the n-dodecane to remelt and solidify uniformly on the qPCR system (the n-dodecane rapidly cools and solidifies at room temperature, floating on top of the qPCR system). The RAA amplification system is dispensed onto the solidified n-dodecane layer, allowing the RAA reaction to occur first in the same tube. In the second stage, the tube is heated to 95°C to inactivate the recombinase, and the n-dodecane melts and floats to the top. This allows the large amount of target product from the first stage RAA reaction to be mixed with the qPCR system for the next qPCR reaction and detection. In the first stage (RAA reaction), the template can be enriched in large quantities within a short time (within 10 min) before the second stage qPCR. In this embodiment of the invention, the entire amplification process can be completed within 60 min, achieving rapid amplification.
[0045] In this invention, the interpretation method requires a combination of results from sensitive tubes (WT) and drug-resistant tubes (MUT). The interpretation method is as follows: 1) Negative: If none of the channels in the WT and MUT tubes show an amplification curve, the interpretation result is negative; 2) If at least one channel in the WT and MUT tubes shows an amplification curve, the interpretation result is determined according to the interpretation criteria described in Table 2. For the interpretation in part 2), there are two possible results: ① No indication of drug resistance (sensitive): All three channels in the WT tube show an amplification curve, while none of the four channels in the MUT tube show an amplification curve, as shown in Table 2; ② Drug resistance: A specific drug resistance type appears at codons 516, 526, 531, or 533. Specific result interpretations are shown in Table 2. Figure 11 Taking the MLP-RAP results of a clinical isolate with heterogeneous drug resistance of the 526-TAC mutation type as an example, according to the curve results comparison table 2, the conclusions of sensitivity at site 516, sensitivity at site 526, heterogeneous drug resistance of 526-TAC, and sensitivity at site 531 or 533 are first drawn. In principle, the interpretation of the results takes priority for drug resistance, so the final MLP-RAP interpretation result is heterogeneous drug resistance of 526-TAC.
[0046] Table 2. Interpretation Criteria for MLP-RAP Results
[0047]
[0048]
[0049] Note: When all four conclusions in Table 2—resistance at site 516, site 526, site 526, and site 531 or 533—appear simultaneously, it indicates that there are no amplification curves in any channel of the WT tube and MUT tube, which is a negative result.
[0050] This invention also provides the application of the primer-probe set or the kit described herein in the preparation of products for detecting rifampicin resistance genes in Mycobacterium tuberculosis. The kit described in this invention has ultra-high sensitivity, reaching 5 copies / reaction, which is 20 times higher than the sensitivity of qPCR (100 copies / µL); and its detection capability for heterogeneous drug resistance mutations is 5%. The primer-probe set described in this invention also has the advantage of high specificity. During the COVID-19 pandemic, various provinces and cities have already acquired quantitative PCR instruments and basic detection capabilities; therefore, this invention has the prospect of nationwide application and can alleviate the burden of tuberculosis testing.
[0051] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.
[0052] The technical solutions of this invention will be clearly and completely described below with reference to the embodiments thereof. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.
[0053] Example 1: Establishment of an MLP-RAP method for detecting rifampicin resistance genes in Mycobacterium tuberculosis
[0054] 1. DNA template preparation
[0055] Mycobacterium tuberculosis strains and rifampicin-resistant or sensitive Mycobacterium tuberculosis strains were extracted using the boiling method: 100 μL of bacterial suspension was heated at 100 °C for 15 min, sonicated for 15 min, and centrifuged at 13000 × g for 5 min. The supernatant was used as the DNA template for specificity evaluation.
[0056] 2. Design and synthesis of primers and LNA probes
[0057] The target gene for this invention is the rpoB gene. The rpoB gene sequence (760647nt to 761606nt) of the Mycobacterium tuberculosis H37Rv standard strain (AL123456.3) was downloaded from the NCBI website. Secondly, rpoB gene mutations mainly occur at codons 516, 526, 531, and 533. This invention designs two probes (a sensitive (wild-type) probe and a drug-resistant (mutant) probe) to detect mutations in each codon region. Primers and LNA probes were then designed using Oligo 7.0 software with appropriate parameters. The designed primers and probes are shown in Table 1. This invention designs two tubes (a sensitive tube and a drug-resistant tube) to simultaneously detect the rifampicin resistance mutant gene in Mycobacterium tuberculosis. The RAA primers (RAA-F and RAA-R) and PCR primers (PCR-F and PCR-R) for both the sensitive and resistant tubes were the same. The difference was that the sensitive tube contained three LNA probes labeled with different fluorescent groups, which perfectly matched the wild-type template and covered three different positions of the rpoB gene (WT1-P covers codon 516, WT2-P covers codon 526, and WT3-P covers codons 531 and 533). The resistant tube contained four LNA probes labeled with different fluorescent groups, which perfectly matched the templates of the four mutation types. MUT1-P, MUT2A-P, MUT2B-P, and MUT3-P strictly matched the four mutant rpoB gene sequences (D516V, H526Y, H526D, and S531L), as shown in Table 1.
[0058] 3. Detection of Mycobacterium tuberculosis drug resistance genes using the primers and probes listed in Table 1 using the MLP-RAP method.
[0059] The amplification systems were prepared according to Tables 3, 4, and 5. Primer and probe concentrations were 10 μmol / L. The RAA kit was the basic RAA amplification kit (Jiangsu Qitian Co., Ltd.), the qPCR kit was the Entrans qPCR Probe Set V2 kit (ABclonal), and the amplification instrument was the Kunpeng Archimed X6 real-time PCR instrument. DNA template extracted from each bacterial strain sample was placed in one sensitive well and one resistant well, and the results were interpreted by combining the curves from both wells. The qPCR systems (as shown in Table 3) were aliquoted into eight-tube sets, and 25 μL of n-dodecane was added. The sets were then placed in a LongGene A300 (60℃ for 1 min, 4℃ for 30 s) to ensure the n-dodecane was evenly floated on top of the qPCR system. The RAA reaction system was prepared according to Table 2. 40 μL of RAA reaction system was added to each RAA (basic method) reaction unit tube to dissolve the dry powder, and the unit tube was mixed twice in a Qitian B6100 mixer. 10 μL of the RAA system was aliquoted onto solidified n-dodecane, and 2 μL of sample DNA template (prepared according to step 1 of this example) was added. 1 μL of magnesium acetate was added to the cap of an eight-tube strip, and the cap was sealed. The strip was briefly centrifuged in an Eastwin handheld centrifuge to allow the magnesium acetate to fall into the RAA system, thus initiating the RAA reaction. The strip was then placed in a quantitative real-time PCR instrument, and the reaction program was performed according to Table 6. The detection principle diagram is shown below. Figure 1 .
[0060] Judgment of Results: The interpretation method requires a combination of results from sensitive tubes (WT) and drug-resistant tubes (MUT). The interpretation method is as follows: 1) Negative: If no amplification curve is observed in any channel of the WT tube or MUT tube, the interpretation result is negative; 2) If at least one channel of the WT tube or MUT tube shows an amplification curve, the result is interpreted according to the interpretation criteria described in Table 2. For the interpretation of part 2), there are two possible results: ① No indication of drug resistance (sensitive): All three channels of the WT tube show amplification curves, while all four channels of the MUT tube show no amplification curves, as shown in Table 2; ② Drug resistance: A specific type of drug resistance appears at codons 516, 526, 531, or 533. The specific interpretation results are shown in Table 2. It should be noted that for the interpretation of the result at codon 526, if both drug resistance and sensitive results appear, the drug resistance result takes precedence.
[0061] Table 3. Reaction system of RAA (basic method) kit
[0062]
[0063] Table 4. qPCR kit reaction system for sensitive tubes
[0064]
[0065] Table 5. qPCR kit reaction system for drug-resistant tubes
[0066]
[0067] Table 6 Reaction Procedure
[0068]
[0069] Example 2: Specificity evaluation of the method for detecting the rifampicin resistance gene MLP-RAP in Mycobacterium tuberculosis.
[0070] One known drug-resistant Mycobacterium tuberculosis H37Rv standard strain, ten rifampicin-sensitive Mycobacterium tuberculosis strains, and ten rifampicin-resistant Mycobacterium tuberculosis strains were selected. All strains were provided by the National Tuberculosis Reference Laboratory. The MLP-RAP detection method established in Example 1 was used to identify the above strains, and the results are shown in Table 7.
[0071] Table 7 Results of MLP-RAP method for detecting rifampicin-resistant or sensitive Mycobacterium tuberculosis
[0072]
[0073] As shown in Table 7, the bioassay results of the MLP-RAP method for rifampicin-resistant or rifampicin-sensitive Mycobacterium tuberculosis strains are consistent with those of the selected strains, and can accurately detect mutual resistance sites and the mutation status of resistance sites. The detection method and the set primers and probes have good specificity.
[0074] Example 3: Sensitivity evaluation of the detection method for the rifampicin resistance gene MLP-RAP in Mycobacterium tuberculosis.
[0075] 1. Sensitivity of the MLP-RAP detection method for the rifampicin resistance gene in Mycobacterium tuberculosis
[0076] (1) Construction of recombinant plasmid vectors carrying wild-type rpoB gene and drug-resistant mutant rpoB gene respectively: Plasmid synthesis was completed by Beijing Qingke Biotechnology Co., Ltd., with the inserted fragment of rpoB gene being 960 bp in length, located at 760647 nt to 761606 nt of the MTBH37Rv reference strain (AL123456.3), including an 81 bp RRDR, and the vector being pUC57. Five types of plasmids were included: one wild-type (MTB-W), and four single-point mutants (D516V (GAC→GTC), H526D (CAC→GAC), H526Y (CAC→TAC), and S531L (TCG→TTG)). The nucleotide sequences of the MTB-W, D516V, H526D, H526Y, and S531L plasmids are shown in SEQ ID NO.12 to SEQ ID NO.16, respectively. Then each recombinant plasmid was diluted 10-fold, from 10 8 Copy / ul to 10 0 Copy / ul is used as an evaluation criterion for MLP-RAP analysis performance.
[0077] (2) Sensitivity detection
[0078] The plasmids described above were detected using the method constructed in Example 1 of this invention and by conventional qPCR. The plasmids for wild type and four mutant types (D516V, H526D, H526Y, and S531L) were added in 10 μL amounts for each quality control test. 6 10 5 10 4 10 3 10 2 10 and 5 copies / ul, see the test results. Figure 3 , Figure 4 , Figure 5 , Figure 6 and Figure 7 .
[0079] Depend on Figure 3 The above describes the use of wild-type plasmids with different concentration gradients (10). 6 10 5 10 4 10 3 10 2 MLP-RAP detection was performed using channels WT1 (10 copies / µl) and WT2 (5 copies / µl). In WT tube (a), channels WT1 (c), WT2 (d), and WT3 (e) showed amplification curves. In MUT tube (b), none of the four channels showed amplification curves. The sensitivity of channels WT1, WT2, and WT3 reached 5 copies / µl. In conclusion, the sensitivity of MLP-RAP for detecting wild-type plasmids can reach 5 copies / µl.
[0080] Depend on Figure 4 The mutant D516V plasmid with different concentration gradients (10) was used. 6 10 5 10 4 10 3 10 2 MLP-RAP detection was performed using channels WT2 (10 copies / µl) and WT3 (5 copies / µl). In the WT tube (a), amplification curves were observed in channels WT2 (b) and WT3 (c). In the MUT tube (d), amplification curves were observed in channel MUT1 (e). The sensitivity of channels WT2, WT3, and MUT1 reached 5 copies / µl. In conclusion, the sensitivity of MLP-RAP for detecting the mutant D516V plasmid can reach 5 copies / µl.
[0081] Depend on Figure 5 The mutant H526D plasmid with different concentration gradients (10) was used. 6 10 5 10 4 10 3 10 2 MLP-RAP detection was performed using channels WT1 (10 copies / µl) and WT3 (5 copies / µl). In the WT tube (a), amplification curves were observed in channels WT1 (b) and WT3 (c). In the MUT tube (d), amplification curves were observed in channel MUT2A (e). The sensitivity of channels WT1, WT3, and MUT2A reached 5 copies / µl. In conclusion, the sensitivity of MLP-RAP for detecting the mutant H526D plasmid can reach 5 copies / µl.
[0082] Depend on Figure 6 The mutant H526Y plasmid (10) with different concentration gradients was used. 6 10 5 10 4 10 3 10 2 MLP-RAP detection was performed using channels WT1 (10 copies / µl) and WT3 (5 copies / µl). In the WT tube (a), amplification curves were observed in channels WT1 (b) and WT3 (c). In the MUT tube (d), amplification curves were observed in channel MUT2B (e). The sensitivity of channels WT1, WT3, and MUT2B reached 5 copies / µl. In conclusion, the sensitivity of MLP-RAP for detecting the mutant H526Y plasmid can reach 5 copies / µl.
[0083] Depend on Figure 7 The mutant S531L plasmid with different concentration gradients (10) was used. 6 105 10 4 10 3 10 2 MLP-RAP detection was performed using channels WT1 (10 copies / µl) and WT2 (5 copies / µl). In the WT tube (a), amplification curves were observed in channels WT1 (b) and WT2 (c). In the MUT tube (d), amplification curves were observed in channel MUT3 (e). The sensitivity of channels WT1, WT2, and MUT3 reached 5 copies / µl. In conclusion, the sensitivity of MLP-RAP for detecting the mutant S531L plasmid can reach 5 copies / µl.
[0084] 2. Sensitivity of qPCR detection method for rifampicin resistance gene in Mycobacterium tuberculosis
[0085] Real-time PCR method: This method uses PCR primers and 7 LNA probes from the MLP-RAP method, utilizing wild-type and 4 mutant recombinant plasmids synthesized in step 1 of this example. The MLP-RAP PCR primers, combined with WT1-P, WT2-P, and WT3-P respectively, form a real-time PCR system to detect wild-type plasmids (10... 5 10 4 10 3 10 2 And 10 copies / ul). MLP-RAP PCR primers and WUT1-P were used to form a real-time PCR system for detecting the mutant D516V plasmid (10 copies / ul). 5 10 4 10 3 10 2 And 10 copies / ul). The PCR primers of MLP-RAP and WUT2A-P were used to form a real-time PCR system to detect the mutant H526D plasmid (10 copies / ul). 5 10 4 10 3 10 2 And 10 copies / ul). MLP-RAP PCR primers and WUT2B-P were used to form a real-time PCR system for detecting the mutant H526Y plasmid (10 copies / ul). 5 10 4 10 3 10 2 And 10 copies / ul). MLP-RAP PCR primers and WUT3-P were used to form a real-time PCR system for detecting the mutant S531L plasmid (10 copies / ul). 5 10 4 10 3 10 2The concentrations of primers and probes were 10 μmol / L. Amplification was performed using the Entrans qPCR Probe Set V2 kit (ABI). The quantitative PCR amplification system is shown in Table 8, and the amplification program is shown in Table 9. The amplification instrument used was the Kunpeng Archimed X6 quantitative PCR instrument.
[0086] Table 8. Real-time PCR reaction system
[0087]
[0088]
[0089] Table 9. Quantitative PCR Reaction Procedure
[0090]
[0091] like Figure 8 As shown, the sensitivity of qPCR detection for the above five plasmids is 100 copies / ul. (Combined) Figures 3-7 In conclusion, the MLP-RAP method achieves a sensitivity of 5 copies / µL for detecting the aforementioned five plasmids. Comparing the experimental results of quantitative real-time PCR and the MLP-RAP method, the MLP-RAP method demonstrates a sensitivity 20 times that of quantitative real-time PCR.
[0092] Example 4: Evaluation of Heterogeneous Drug Resistance in Mycobacterium tuberculosis by Detection Method of Rifampicin Resistance Gene MLP-RAP
[0093] 1. Template preparation with different drug resistance ratios
[0094] Wild-type plasmid (10) was synthesized in Example 3. 4 (copies / ul) and four mutant plasmids (10 copies / ul) respectively, namely D516V (GAC→GTC), H526D (CAC→GAC), H526Y (CAC→TAC) and S531L (TCG→TTG) 4 Heterogeneous drug resistance references containing four different mutation types were prepared by mixing copies / ul in different proportions. Each mutation type of heterogeneous drug resistance reference contained 0%, 5%, 10%, 15%, 25%, 50%, 75%, and 100% mutation percentages.
[0095] Furthermore, to investigate the relationship between heterogeneous drug resistance detection capability and total genomic DNA concentration, S531L (TCG→TTG) was used as the research object, and 5×10⁻⁶ samples were prepared. 3 and 5×10 2Templates of two total DNA concentrations in copies / ul, with each concentration containing 0%, 5%, 10%, 15%, 25%, 50%, 75%, and 100% mutation percentages.
[0096] 2. Evaluation of heterogeneous drug resistance detection capability
[0097] The plasmid described above was tested using the method constructed in Example 1 of this invention to evaluate the heterogeneity resistance detection capability of MLP-RAP. The results are shown in [Figure 1]. Figure 4 .
[0098] Depend on Figure 9 As shown, MLP-RAP detection is effective for a total concentration of 10 4 The mutation detection capability of mixed templates containing four mutation types (D516V(A), H526D(B), H526Y(C), and S531L(D)) in copies / ul is 5%. Figure 10 As shown, taking S531L (TCG→TTG) as the research object, for a total concentration of 5×10 3 copies / ul(A) and 5×10 2 The mutation detection capability of the copies / ul(B) mixed template remains at 5%.
[0099] Example 5: Clinical sample evaluation of the method for detecting the rifampicin resistance gene MLP-RAP in Mycobacterium tuberculosis.
[0100] 1. Sample source and nucleic acid extraction
[0101] Specimens used for clinical evaluation included 118 clinical isolates and 78 sputum samples, all of which were obtained from the National Tuberculosis Reference Laboratory. All 118 clinical isolates had results from drug susceptibility testing and next-generation sequencing.
[0102] Clinical isolates and sputum samples were extracted using the boiling method: 100 μL of bacterial suspension was heated at 100°C for 15 min, sonicated for 15 min, and centrifuged at 13000 × g for 5 min. The supernatant was used as the DNA template for MLP-RAP and nested PCR product sequencing.
[0103] 2. Evaluation of Sample Test Results
[0104] The above samples were tested using the MLP-RAP method, GeneXpert method, and nested PCR product first-generation sequencing method constructed in Example 1 of this invention. The results are shown in Tables 14-15.
[0105] GeneXpert method: Take 1 ml of sputum and add 2 times the volume of sample processing solution. Vortex for about 20 seconds until no visible lumps of sputum remain. Let stand at room temperature for later use. Use a disposable sterile pipette to draw 2 ml of clinical isolate suspension (118 samples) or 2 ml of the above-prepared sputum processing solution (78 samples) and add it to the test kit for testing. The instrument will automatically interpret the results after 2 hours.
[0106] The primers used for the first round of nested PCR detection were TB-F and TB-R, and the primers used for the second round of nested PCR detection were RAA-F and RAA-R from Example 1. The specific sequences are shown in Table 10. The primer concentration was 10 μmol / L. The nucleic acids of the 118 clinical isolates and 78 sputum samples were detected using both pairs of PCR primers. Both rounds of reactions were amplified using the ABI EntransqPCRProbe SetV2 kit. The amplification system for the first round of nested PCR is shown in Table 11, and the amplification system for the second round of nested PCR is shown in Table 12. The amplification procedures for both rounds of nested PCR were the same, as shown in Table 13. The amplification instrument used was the A300 gene amplifier from Hangzhou Langji Scientific Instruments Co., Ltd. The nested PCR products were sent to Beijing Sangon Biotech Co., Ltd. for first-generation sequencing.
[0107] Table 10 Primer Information
[0108]
[0109] Table 11 Nested PCR First Round Amplification System
[0110]
[0111] Table 12 Nested PCR Second Round Amplification System
[0112]
[0113]
[0114] Table 13 Amplification Procedure
[0115]
[0116] Table 14. MLP-RAP results of 118 clinical isolates
[0117]
[0118] Table 15 MLP-RAP results of 78 sputum specimens
[0119]
[0120]
[0121] As shown in Table 14, one sample showed discrepancy between MLP-RAP and phenotypic drug susceptibility testing: MLP-RAP detected resistance to 516-GTC, while the phenotypic drug susceptibility test showed sensitivity. The results for the remaining 117 samples were consistent between the two methods. It is important to note that the reason why the resistance results determined by resistance genes are not entirely consistent with the phenotypic drug susceptibility test results obtained through traditional methods is due to the inherent uncertainty in the detection results of traditional methods. The MLP-RAP method has been verified to be accurate at the level of resistance gene detection. Table 14 shows that a total of 118 nucleic acids from clinical isolates were collected. MLP-RAP results showed that 39 samples did not indicate drug resistance, while 79 samples were drug-resistant. Among the 79 drug-resistant samples, 5 samples showed heterogeneous resistance at the 526-TAC site. The GeneXpert method did not detect these 5 samples with heterogeneous resistance at the 526-TAC site. The nested PCR product, when sequenced by first-generation sequencing, showed an overlapping peak (T / C) at the first base of site 526, confirming that the five mutations detected by MLP-RAP were all heterogeneous drug resistance to 526-TAC (rpoB_H445Y). Taking one of the five samples as an example, the results of the two methods are as follows: Figure 11 As shown. Clinical sample evaluation of this invention shows that it can cover mutation types at sites 516, 526, 531 and 533, and can also detect heterogeneous drug resistance of the 526-TAC(rpoB_H445Y) mutation type.
[0122] As shown in Table 15, a total of 78 boiled sputum samples were tested for nucleic acid, of which 41 samples showed no indication of drug resistance (susceptibility) and 37 samples were negative; the MLP-RAP results were consistent with the GeneXpert results and the first-generation sequencing results of nested PCR products, with 100% consistency.
[0123] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for detecting a rifampin resistance gene of Mycobacterium tuberculosis for non-diagnostic purposes of disease, characterized by, Comprising the following steps: 1) extracting nucleic acid of the sample to be tested; 2) using primer probe set, sequentially performing RAA amplification and qPCR amplification with the nucleic acid as template, and collecting fluorescence signal; the amplification system of the RAA amplification and the qPCR amplification uses n-dodecane for interval; the RAA amplification and the qPCR amplification are both performed in sensitive tube and drug-resistant tube; 3) determining the drug resistance of the sample to be tested according to the fluorescence amplification curve results of the sensitive tube and the drug-resistant tube; The primer probe set comprises RAA primer and qPCR primer targeting rpoB gene, probe primer targeting wild-type rpoB gene and probe primer targeting mutant rpoB gene; The RAA primer and the qPCR primer targeting rpoB gene comprise RAA-F, RAA-R, qPCR-F and qPCR-R; the nucleotide sequences of the RAA-F, the RAA-R, the qPCR-F and the qPCR-R are shown in SEQ ID NO. 1~SEQ ID NO. 4 in turn; The probe primer targeting wild-type rpoB gene comprises WT1-P, WT2-P and WT3-P; the nucleotide sequence of the WT1-P is ATGG+A+CCAGAA+CAAC, the nucleotide sequence of the WT2-P is ACCC+ACAAGCG+C+CGA and the nucleotide sequence of the WT3-P is ACT+GT+CGGCGCTG; the probe primer targeting mutant rpoB gene comprises MUT1-P, MUT2A-P, MUT2B-P and MUT3-P; the nucleotide sequence of the MUT1-P is ATGG+T+CCAGAA+CAAC, the nucleotide sequence of the MUT2A-P is ACCG+ACAAGCG+C+CGA, the nucleotide sequence of the MUT2B-P is ACCT+ACAAGCG+C+CGA and the nucleotide sequence of the MUT3-P is ACT+GT+TGGCGCTG; wherein the bases after the + sign are locked nucleic acid modified probes; The reaction system of the qPCR amplification in the sensitive tube comprises the following components in an amount of 40 μl: Buffer 12.5 μl, no ribozyme water 10.7 μl, Taq hot start enzyme 0.5 μl, dNTPs 0.6 μl, MgCl2 1.2 μl, qPCR-F 5 μl, qPCR-R 5 μl, WT1-P 1.5 μl, WT2-P 1 μl and WT3-P 2 μl; the reaction system of the qPCR amplification in the drug-resistant tube comprises the following components in an amount of 40 μl: Buffer 12.5 μl, no ribozyme water 6.7 μl, Taq hot start enzyme 0.5 μl, dNTP 0.6 μl, MgCl2 1.2 μl, qPCR-F 5 μl, qPCR-R 5 μl, MUT1-P 1.5 μl, MUT2A-P 3 μl, MUT2B-P 1 μl and MUT3-P 3 μl; The amplification system of RAA amplification and qPCR amplification in the sensitive tube and the drug-resistant tube is spaced by n-dodecane.
2. The method of claim 1, wherein, The reaction system of RAA amplification, 40 μl in total, comprises the following components: reaction buffer 25 μl, RNase-free water 11 μl, RAA-F 2 μl and RAA-R 2 μl; the reaction procedure of RAA amplification comprises 39 ℃, 10 min.
3. The method of claim 1, wherein, The reaction procedure of qPCR amplification of the sensitive tube and the drug-resistant tube both comprises: 95 ℃, 5 min; 95 ℃, 15 s, 60 ℃, 30 s, 72 ℃, 30 s, 24 cycles.
4. The method of claim 1, wherein, The spacing by n-dodecane comprises: adding melted n-dodecane to the amplification system of qPCR amplification and standing, the n-dodecane floats on the amplification system of qPCR amplification, after the n-dodecane solidifies, adding the amplification system of RAA amplification on the solidified n-dodecane.
5. The method of claim 1, wherein, The RAA amplification and qPCR amplification are carried out in a tube with a cover; the step of adding the amplification system of RAA amplification on the solidified n-dodecane comprises: adding the amplification system of RAA and the template on the solidified n-dodecane, adding magnesium acetate into the cover, and starting the RAA reaction by using the magnesium acetate.
Citation Information
Patent Citations
RAP gene detection kit, detection method and application thereof, and RAP virus detection kit
CN112760417A
Digital PCR (Polymerase Chain Reaction) detection kit for mycobacterium tuberculosis and drug resistance thereof
CN114540524A