Insertion-deletion marker of key gene acsl5 affecting goat growth traits and application thereof

Abstract

The present application relates to the technical field of goat molecular marker screening, and particularly relates to a goat ACSL5 associated with growth traits and application thereof. The present application amplifies fragments containing Indel1 site by using typing primers, and the amplification product is 216 bp for insertion type II, which contains a deletion marker sequence; the amplification product is 191 bp and 216 bp for hybrid type ID. The goat ACSL5 gene insertion-deletion variation detection method can be used for early selection of goats, and even selection can be performed as soon as lambs are born. The Indel1 site has a relatively obvious selection effect on Fuqing goats, and by selecting the ACSL5 advantageous alleles of the goat Indel1 site, the genetic progress of growth traits can be accelerated, the selection time can be shortened, and the economic benefits of effective goat individuals can be improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of goat molecular marker screening, and particularly relates to a goat ACSL5 gene molecular marker associated with growth traits and application thereof. BACKGROUND

[0002] The yield and quality of mutton are affected by factors such as genetics, postmortem processing, gender and age, nutritional level and their interactions. Breed is one of the most recognized factors, and the core of its influence is the difference in mutation, expression, regulation and epigenetic modification of key genes that dominate growth and development. Currently, there are three local goat breeds in Fujian included in the Chinese Livestock and Poultry Genetic Resources Record: Sheep Record, namely, Fuqing goat, Mindong goat and Daiyun goat. Fuqing goat is the largest local goat breed in Fujian in terms of current stock, and the main producing areas are located in Fuqing City and Luoyuan County. Fuqing goat has the advantages of roughage tolerance, strong environmental adaptability, early sexual maturity, tender meat and light off-flavor. Our previous studies found that the intermuscular fat content of Fuqing goat was significantly higher than that of Nubian goat (the largest introduced breed in Fujian), and it had higher meat quality traits, but the growth traits were significantly lower than those of Nubian goat. Therefore, Fuqing goat is an excellent genetic material for studying goat growth performance. However, compared with meat pigs and poultry, the basic theory of goat molecular breeding is still lagging behind, and the development and utilization of excellent local breeds are very insufficient, among which the potential of excellent production has not been fully tapped. Therefore, through the comparison of the transcriptome of Fuqing goat and Nubian goat in the previous stage, we found a batch of key candidate genes such as ACSL5, FGF7 and ITGAD that may affect goat growth traits [1] .

[0003] The ACSL5 gene is a member of the long-chain fatty acyl-CoA synthetase family (ACSLs), which is essential for the catalysis of fatty acid activation to form acyl-CoA. The ACSLs family contains five genes, namely ACSL1, ACSL3, ACSL4, ACSL5 and ACSL6. The human ACSL5 gene was first discovered in 1998 and is mapped to the q25.1-q25.2 region of chromosome 10. There are three isoforms of the human ACSL5 gene: a long isoform (739 amino acids), a short isoform (683 amino acids) and a less common shorter isoform (659 amino acids). The ACSL5 gene is widely expressed in mammalian liver, small intestine, fat, spleen, uterus, lung and skeletal muscle. Studies have found that the ACSL5 gene plays an important role in the synthesis of triglycerides, phospholipids and cholesterol and fatty acid metabolism. Overexpression of the gene can promote fatty acid oxidation and free radical formation and down-regulate insulin signaling in human skeletal muscle tubes. Knocking out the ACSL5 gene can reduce the synthesis of neutral lipids secreted by the liver. Studies have also found that the ACSL5 gene can activate dietary long-chain fatty acids, reduce the activation level of fatty acids in the human jejunum, and the activity of the ACSL5 gene may affect the relationship between intestinal microorganisms and further affect lipid metabolism. It is known that 80% of the energy of goats comes from volatile fatty acids, so the ACSL5 gene plays an important role in the growth and development of goats. However, there is little research on the effect of InDel mutation of the goat ACSL5 gene on the growth traits of livestock, and there is no relevant research on goats. SUMMARY

[0004] The purpose of the present application is to provide an InDel marker that significantly affects the growth traits of goats. The present application discovers an InDel marker associated with the growth traits of goats, and provides a new InDel marker for molecular marker-assisted breeding of goat growth traits.

[0005] The present application discloses a method for breeding excellent goats by using an insertion-deletion marker of a key gene ACSL5: using a typing primer to amplify a fragment containing an Indel1 site, and the amplification product is a 216bp band (SEQ.ID.NO.6) for insertion type II; the amplification product is two bands of 191bp and 216bp for hybrid type ID.

[0006] (1) A primer pair is designed for a new InDel variation Indel1 (del41712 T / CCTGATGGTCCTGTGGTTAAAACTC) in the fifth intron region of the goat ACSL5 gene (GenBank: NC_030833.1):

[0007] Upstream primer Indel1-F: 5'-CCTTTGTTTTATAGTTGTCTCGGTA-3' (SEQ. ID. NO. 2); downstream primer Indel1-R: 5'-TTTAGTAGTGGCATGTGAAGTCTAG-3' (SEQ. ID. NO. 3);

[0008] The sequence of the primer pair is 216bp in length, and there is a 26bp (CCTGATGGTCCTGTGGTTAAAACTC) insertion and deletion mutation at the 121st bp in the sequence.

[0009] (2) For each random individual of each goat breed, the genomic DNA is used as a template to perform PCR typing with the primer pair Indel1, and the PCR program is used, and after one PCR program, the amplified product is analyzed in the result of 3.5% agarose gel electrophoresis, so as to type the Indel1 site.

[0010] The amplification system for typing the site is 10uL, wherein: 50ng / uL template DNA 0.8uL, 10pmol of two pairs of upstream and downstream primers each 0.2uL, 2xPremix Taq Mix 5uL, deionized water 3.8uL.

[0011] The PCR program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, annealing for 30s, 72℃ extension, 40 cycles, and 72℃ extension for 5min.

[0012] (3) Indel1 has two genotypes: insertion type (II) and hybrid type (ID). The electrophoresis results of different genotypes are: II is a 216bp band, and ID is two bands of 216bp and 191bp.

[0013] (4) The Indel1 site of different individuals is typed by PCR and electrophoresis technology, the variation in three goat breeds (Fuqing goats, Nubian goats and Jianzhou big-eared goats) is analyzed, the insertion and deletion genotypes are associated with the body weight, body height and other growth traits of goats by using SPSS software, and the result shows that the detection method of the insertion and deletion marker provided by the application can be used for early molecular marker assisted selection, and the goat individual with excellent growth traits is selected.

[0014] The significant advantages of the application are:

[0015] (1) The goat ACSL5 gene insertion and deletion variation detection method provided by the application can be used for early selection of goats without age restriction, and even the selection can be performed as soon as the lamb is born.

[0016] (2) Only a small amount of blood from the lamb is needed to meet the detection conditions. The insertion-deletion variation Indel1 of the ACSL5 gene of the Fuzhou goat can be detected by PCR and electrophoresis, which is simple, fast, accurate, low-cost and not affected by factors such as breeding environment.

[0017] (3) The Indel1 site has a relatively obvious breeding effect on the Fuzhou goat. By selecting the dominant allele of the Indel1 site of the ACSL5 gene of the Fuzhou goat, the genetic progress of its growth traits can be accelerated, the breeding time can be shortened, and the economic benefits of the effective goat individuals can be improved. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Figure 1 is an electropherogram (a) and a sequencing peak comparison diagram (b) of the Indel1 (del41712) of the goat ACSL5 gene. In the figure, the triangle represents the insertion position, and the gray part represents the insertion sequence.

[0019] Figure 2 Temporal and spatial expression profile of the goat ACSL5 gene. DETAILED DESCRIPTION

[0020] Example 1: Establishment of a detection method for the insertion-deletion marker polymorphism site associated with the growth traits of the ACSL5 gene of the Fuzhou goat:

[0021] 1. Sample collection and DNA extraction

[0022] A total of 528 adult female goats were used in this study, including 123 Fujian White goats (labeled FQ), 286 Nubian Black goats (labeled NB), and 119 Jianzhou Large Eared goats (labeled JY). Blood samples (5 mL) were collected from the jugular vein of each goat and stored at -20 °C after being anticoagulated with anticoagulant citrate dextrose (ACD). All goats were fasted for 24 h before the body size data of all individuals were measured according to the method of Elbert et al. (1993), including body weight (BW), body height (BH), body length (BL), chest circumference (ChC), chest depth (ChD), chest width (ChW), hip width (HhW), and cannon circumference (ChC). The index data were calculated according to the method of the existing technology institute (Li WY, Liu Y, Gao CF, et al. A novel duplicated insertion / deletion (InDel) of the CPT1 gene and its effects on growth traits in goat [J]. Animal Biotechnology, 2021, 32(3):343-351.), including body length index (BLI), chest circumference index (ChCI), cannon circumference index (CaCI), chest width index (CWI), hip width index (HuWI), and body trunk index (TI). The DNA of individuals for trait association analysis was extracted by the conventional phenol-chloroform method. After the concentration and purity of all DNA samples were determined by Nanodrop 2000, they were diluted to 50 ng / μL for standby use.

[0023] 2. Genomic DNA and RNA extraction

[0024] The blood DNA of all the goats was extracted using the conventional phenol-chloroform method, and after the concentration and purity of all the DNA samples were determined by a nucleic acid concentration tester (Nanodrop, USA), they were diluted to 50 ng / ul and stored in a refrigerator at -20°C for standby use. The hearts, livers, spleens, lungs, kidneys, brains, fats, longissimus dorsi muscles and gluteus muscles of Fuqing goats at three stages of birth, 3 months and adulthood were collected. The total RNA of all the individual tissues was extracted by the Trizol method, the RNA concentration was detected by a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA), and the extracted RNA was reverse transcribed into cDNA by reverse transcription PCR (RT-PCR) using a PrimeScriptTM RT kit (TaKaRa). The reaction system was 0.5 ug RNA, 5 ul PrimeScriptTM buffer, 0.5 ul of universal upstream and downstream primers, 0.5 ul PrimeScriptTM RT Enzyme Mix I, 5 ul RNase-free water, and the reaction program was mixed and incubated at 37°C for 15 min and at 85°C for 5 s. After dilution and calibration, it was stored in a refrigerator at -80°C.

[0025] 3. Primer synthesis

[0026] Referring to the full-length sequence of the goat ACSL5 gene (NC_030833.1), the typing and qPCR primers were designed using the NCBI online primer design software (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome Primer) and Premier 5.0 software, and were synthesized by Fuzhou Bochang Biotechnology Co., Ltd. The primers are as follows:

[0027] The typing primer amplifies the fragment SEQ ID NO. 1 sequence containing the Indel1 (Del19008 TCCAT) site;

[0028] Upstream primer Indel1-F: 5'-CCTTTGTTTTATAGTTGTCTCGGTA-3' (SEQ.ID.NO.2)

[0029] Downstream primer Indel1-R: 5'-TTTAGTAGTGGCATGTGAAGTCTAG-3' (SEQ.ID.NO.3)

[0030] The qPCR primer is used as the primer for determining the relative expression amount of the goat ACSL5 gene;

[0031] Upstream primer Indel2-F: 5'-CCATCTCACCTCCCGTCTTG-3' (SEQ.ID.NO.4)

[0032] Downstream primer Indel2-R: 5'-GGCCTGATTTCCAATCCCCA-3' (SEQ.ID.NO.5)

[0033] 4. Target sequence amplification and typing

[0034] For each random individual of a goat breed, PCR typing of Indel1 was performed using genomic DNA as a template and primer pairs. Specifically, after one PCR cycle, the amplification system for typing this site was 10 μL, containing: 0.8 μL of 50 ng / μL template DNA, 0.2 μL each of two 10 pmol upstream and downstream primer pairs, 5 μL of 2×Premix Taq Mix, and 3.8 μL of deionized water. The PCR program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, annealing for 30 s, extension at 72℃, 45 cycles, followed by a final extension at 72℃ for 5 min.

[0035] 5. Agarose gel electrophoresis analysis of PCR products at the Indel1 site

[0036] (1) Prepare a 3.5% agarose gel (with ethidium bromide nucleic acid dye added), spot the sample and electrophoresis at 130V for 45min;

[0037] (2) When DNA fragments of different molecular weights are clearly separated, they are imaged using the BIO-RAD Gel Doc 2000 gel imaging system;

[0038] (3) Polymorphism was analyzed based on the agarose gel electrophoresis results. Referencing the genotyping electrophoresis results of the Indel1 locus of the goat ACSL5 gene, as shown below... Figure 1 As shown in figure a. Amplification and electrophoresis were performed on all individuals of each goat breed to complete PCR typing. Sequencing results are shown in figure a. Figure 1 b. Two genotypes exist at the Indel1 site: insertional (II) and heterozygous (ID). Electrophoresis results for different genotypes are as follows: II is a single band of 216 bp, and ID consists of two bands of 191 bp and 216 bp. These results indicate that simultaneous genotyping of the Indel1 site can be rapidly and accurately achieved by amplifying fragment SEQ ID NO.1 and performing electrophoretic analysis on the product.

[0039] 6. Genetic polymorphism analysis of the Indel1 locus of the ACSL5 gene in reference goats.

[0040] The genotype frequency and allele frequency of the goat ACSL5 gene insertion-deletion site were calculated using EXCEL software, and the polymorphism information content (PIC) was detected using GDIcall online calculator (http: / / www.msrcall.com / Gdicall.aspx). The χ 2 Hardy-Weinberg equilibrium (HWE) was tested to determine whether the ACSL5 gene site polymorphism was in Hardy-Weinberg equilibrium (HWE). The results of genetic polymorphism analysis of the Indel site are shown in Table 1. The correlation between genotype and goat population growth traits was calculated using independent variance t-test. The statistical software used was SPSS (version 18.0) (IBM Corporation, Armonk, NY, USA). The basic linear model was used to analyze the relationship between goat genotype and growth traits:

[0041] Y ijk = μ + α i + β j + ε ijk

[0042] where Y ijk is the measured data of each animal trait; u is the total average of each characteristic; α i is the age factor, β j is the genotype effect, and e is the random error.

[0043] Table 1 Genotype frequency and allele frequency of ACSL5 gene Indel1 site

[0044]

[0045] 6. Association analysis of goat ACSL5 gene Indel1 site and growth traits

[0046] Table 2 Association analysis table of goat ACSL5 gene Indel site and growth traits

[0047]

[0048]

[0049] Note: Different lowercase letters (a, b) indicate significant differences, and different capital letters (A, B) indicate extremely significant differences.

[0050] The results showed that: ACSL5 gene del41712 locus associated with three varieties of goat growth traits analysis results show that the site significantly affect the chest deep (P = 0.017) of Fuqing goat, and II genotype is the dominant genotype. In Nubian goat population, the site has a significant effect on body height (P = 0.012), body length index (P = 0.030), and has a very significant effect on chest circumference index (P = 0.007), and for body height traits, ID genotype is the dominant genotype; for body length index, chest circumference index, II genotype is the dominant genotype.

[0051] 7. Temporal and spatial expression of goat ACSL5 gene

[0052] The relative expression of ACSL5 gene in each tissue was detected by qPCR. The primers for mRNA expression analysis were designed according to the sequence of goat ACSL5 gene (NCBI: NC_030833.1) (SEQ. ID. NO. 4 and SEQ. ID. NO. 5). qPCR was performed using Roche LightCycler 96 Real-Time PCR system (Mannheim, Germany, Roche). The reaction system was 2x SYBR Premix Ex Taq (Takara, Dalian, China) 6 μL, 10 pmol of upstream and downstream primers 0.3 μL each, 10 ng / μL template cDNA 5 μL, 0.4 μL ddH2O. GAPDH was used as an internal reference gene. The amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 64℃ annealing and extension for 50 s, 40 cycles. The melting curve conditions were: 60-95℃, every 1℃ reading plate 15 times; the negative control used ddH2O instead of template.

[0053] The results of qPCR detection showed that ( Figure 2 ), ACSL5 gene was expressed in the three stages of birth, weaning and adulthood, and was a broad-spectrum expression gene, and the expression amount in spleen, lung, kidney and fat was very high, indicating that the gene played an important role in the growth of goats at each stage. As a key gene for fat differentiation and development, the expression of the gene in fat was significantly different (P < 0.05), which also indicated that ACSL5 gene was particularly important for the growth and development of lambs at birth. In addition, the expression of the gene in the brain showed a gradually decreasing trend, and the development of the goat brain was not complete at the birth stage, at which time the expression of ACSL5 gene was the highest, indicating that ACSL5 gene played an important role in the development of goat brain.

[0054] The above analysis results show that the Indel1 site of ACSL5 gene can be used as a candidate insertion-deletion marker for goat growth traits.

[0055] The above merely describes preferred embodiments of the present application, and any equivalent changes and modifications made within the scope of the present application should be included in the scope of the present application.

Claims

1. A method for marker assisted selection of Fuqing goats and Nubian goats having superior growth traits using insertion-deletion markers of ACSL5 gene, characterized in that, The fragment containing the Indel1 site is amplified by using the typing primer, and the amplification product is 216bp for the deletion type II; the amplification product includes two bands of 191bp and 216bp for the hybrid type ID; The sequence of the Indel1 site is shown as SEQ ID NO. 1; The typing primer is: an upstream primer Indel1-F: 5'-CCTTTGTTTTATAGTTGTCTCGGTA-3' (SEQ ID NO. 2); a downstream primer Indel1-R: 5'-TTTAGTAGTGGCATGTGAAGTCTAG-3' (SEQ ID NO. 3); wherein the deletion type II is the dominant genotype of the body length index and the chest circumference index of Fuqing goats and Nubian goats, and the hybrid type ID is the dominant genotype of the body height of Nubian goats.

Images