A dsRNA for inhibiting Aspergillus flavus, an Aspergillus flavus inhibitor, a biological pesticide, a fungicide and application thereof

Abstract

The invention provides a dsRNA for inhibiting Aspergillus flavus, an Aspergillus flavus inhibitor, a biological pesticide, a fungicide and applications thereof, belonging to the technical field of biological control of Aspergillus flavus, and specifically provides a dsRNA for inhibiting Aspergillus flavus, wherein the sense strand of the dsRNA sequence is shown as SEQ ID NO.5, and the antisense strand is shown as SEQ ID NO.6; further provided are an Aspergillus flavus inhibitor, a biological pesticide, and a fungicide; and applications of the dsRNA and the Aspergillus flavus inhibitor; the dsRNA provided by the invention can be used for inhibiting and removing Aspergillus flavus, has obvious inhibitory effect on Aspergillus flavus, can be used for the preservation of grains, feeds and the like, and can also be used for the planting of crops, thereby reducing the harmful effects of Aspergillus flavus on crops such as corn and peanuts.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control of Aspergillus flavus, and specifically relates to a dsRNA for inhibiting Aspergillus flavus, an Aspergillus flavus inhibitor, a biological pesticide, a fungicide and applications thereof. Background Art

[0002] Aspergillus flavus is a common saprophytic fungus widely distributed throughout the world. It belongs to the Fungi, Deuteromycetes, Combretaceae, and Aspergillus genus. It can have harmful effects on crops such as corn, peanuts, and nuts, and is an important food contaminant. The growth and expansion of Aspergillus flavus is mainly affected by factors such as climate, environment, and management measures. Aspergillus flavus can infect the seeds, roots, stems, and leaves of crops, resulting in stunted crop growth, yellowing of leaves, and reduced yields. What's more serious is that Aspergillus flavus can also produce toxic metabolites, aflatoxin, which is extremely harmful to human health.

[0003] At present, physical prevention and control and chemical prevention and control are important means of aflatoxin prevention and control. Physical means mainly keep farmland dry through scientific irrigation, drainage and ventilation measures to inhibit the growth of aflatoxin. Chemical means mainly include the use of hypochlorous acid, hydrogen peroxide, sodium hypochlorite, ozone, ammonia, sodium hydroxide and other chemicals to destroy the structure of aflatoxin and inactivate it. In addition, the use of microorganisms such as lactic acid bacteria and acetic acid bacteria is also an effective means of inhibiting aflatoxin. However, these methods often have problems such as environmental risks or high costs, which limit their wide application.

[0004] There are many advantages to using dsRNA to control harmful microorganisms. First, dsRNA is highly specific and can specifically target specific genes of harmful microorganisms and interfere with their expression. This high specificity can reduce the impact on non-target organisms and avoid damage to beneficial organisms in the ecosystem. Second, as a biological molecule, dsRNA is easily degraded by the environment and does not produce persistent pollution, making it more environmentally friendly than traditional chemical pesticides. At the same time, dsRNA inhibits microorganisms through the mechanism of gene silencing, which helps to deal with the increasingly serious resistance of harmful microorganisms to traditional pesticides and antibiotics. It is a novel and effective means of controlling crop diseases. In addition, the design of dsRNA is highly flexible and can be quickly customized according to the genomic information of the target microorganism, which has significant advantages in dealing with emerging pathogens and pests. It can also be used in compatibility with other biological control methods to provide multi-level protection. Compared with many chemical pesticides, dsRNA is less toxic to humans and other mammals, so it poses less health risks to agricultural workers and consumers. dsRNA can be used not only for plant disease control, but also for the treatment and prevention of animal and human diseases. Its application range is wide, covering many fields such as agriculture, medicine and environmental protection. In recent years, the research on RNA interference (RNAi) technology has made significant progress, and a large number of basic and applied research have provided a solid theoretical basis and technical guarantee for the promotion of dsRNA technology. Through these advantages, dsRNA technology provides an efficient, safe and sustainable solution for modern agriculture and disease prevention and control.

[0005] There have been relevant reports on the use of dsRNA to control fungi in the prior art. For example, Chinese patent document CN113462691 A (application number: 202110812801.8) discloses a dsRNA for inhibiting Rhizopus stolonifer and its application; Chinese patent document CN 116970623A (application number: 202310977744.8) discloses a gene fragment for preventing and controlling wheat stem rot and its application.

[0006] In existing scientific research and literature, some preliminary research and exploration have been conducted on the use of dsRNA technology to inhibit the production of aflatoxin by Aspergillus flavus. For example, some studies have used dsRNA to target certain key genes in Aspergillus flavus, such as genes responsible for toxin production, and inhibited the expression of these genes through RNA interference (RNAi) technology, thereby reducing the production of aflatoxin. However, there are very few reports on the use of dsRNA technology to inhibit Aspergillus flavus. Summary of the invention

[0007] In view of the deficiencies of the prior art, the present invention provides a dsRNA for inhibiting Aspergillus flavus, an Aspergillus flavus inhibitor, a biological pesticide, a fungicide and applications thereof.

[0008] The technical solution of the present invention is as follows:

[0009] A dsRNA for inhibiting Aspergillus flavus, wherein the sense strand of the dsRNA sequence is shown as SEQ ID NO.5, and the antisense strand is shown as SEQ ID NO.6.

[0010] The use of the above dsRNA in the preparation of aflatoxin inhibitors.

[0011] A flavus inhibitor comprises the above dsRNA.

[0012] The use of the above dsRNA or aflatoxin inhibitor in inhibiting aflatoxin.

[0013] Preferably according to the present invention, the above-mentioned dsRNA or aflatoxin inhibitor is used to inhibit aflatoxin in food, feed or crops.

[0014] The use of the above dsRNA in the preparation of biological pesticides.

[0015] A biological pesticide comprising the above-mentioned dsRNA.

[0016] Use of the above dsRNA in the preparation of fungicides.

[0017] A fungicide comprising the above-mentioned dsRNA.

[0018] The beneficial effects of the present invention include at least the following:

[0019] 1. The dsRNA provided by the present invention can be used to inhibit and eliminate Aspergillus flavus, has a significant inhibitory effect on Aspergillus flavus, can be used for the preservation of food, feed, etc., and can also be used for the cultivation of crops, reducing the harmful effects of Aspergillus flavus on crops such as corn and peanuts.

[0020] 2. The dsRNA provided by the present invention is highly specific. This sequence is designed according to the specificity of Aspergillus flavus DNA and can inhibit the growth and proliferation of Aspergillus flavus, but has no inhibitory effect on other non-target organisms, effectively reducing non-target effects and biological risks; it is highly environmentally friendly. Unlike chemical pesticides, this sequence can be used as the main component of RNA biological pesticides, which can be degraded by organisms and will not accumulate in soil, water or food chains, reducing environmental risks; it is highly safe. Due to the high specificity of dsRNA, it is highly safe for humans, animals and the environment, reducing the risk of accidental injuries. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of agarose gel electrophoresis;

[0022] In the figure: the first lane is a DNA marker, which is 100, 200, 300, 400, 500, and 600 bp from bottom to top; the second and third lanes are bright spots showing DNA fragments cloned from the Aspergillus flavus strain JXZS-3 preserved in the laboratory, which are about 200 bp in size.

[0023] Figure 2 This is a diagram showing the effect of dsRNA inhibiting the Aspergillus flavus strain JXZS-3;

[0024] In the figure: the PDA plate on the left in A shows the growth of Aspergillus flavus that was not treated with dsRNA in step (4) after 5 days; the PDA plate on the right shows the growth of Aspergillus flavus that was treated with dsRNA in step (4) after 5 days;

[0025] The left PDA plate in B shows the growth of Aspergillus flavus that was not treated with dsRNA in step (5) after 5 days; the right PDA plate shows the growth of Aspergillus flavus that was treated with dsRNA in step (5) after 5 days. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below in conjunction with embodiments, but the scope of protection of the present invention is not limited thereto.

[0027] The contents not described in detail in the embodiments are based on the prior art in the art.

[0028] Example 1

[0029] The present invention uses the sequence of Aspergillus flavus NCBI storage strain (GCA_014117465.1) as a template to design a specific sRNA library for Aspergillus flavus. Through sRNA scoring, a fragment with high-scoring sRNA density in the Aspergillus flavus DNA sequence is screened out, which is the sense strand of the specific dsRNA of the present invention. According to the principle of base complementarity, an antisense strand is formed, and this sequence includes a total of 201 base pairs.

[0030] The specific experiments are as follows:

[0031] (1) sRNA library design: Through literature research and laboratory verification, target genes such as aflR, norA, pksA, gpdA, laeA, tor, and mdr1, which play an important role in the metabolism and survival of Aspergillus flavus, were screened out; online or offline software such as RNA22, siDirect, and OliglWalk were used to design sRNA sequences using the above gene sequences in the strain (GCA_014117465.1) as templates and score them. The obtained sRNA library was sorted from high to low according to the score, and the sRNA sequences with higher scores were included in the scope of further experimental verification;

[0032] (2) dsRNA segment selection: The sRNAs screened in step (1) are combined according to their positions on the DNA of Aspergillus flavus, and segments with high sRNA scores and concentrated positions on the DNA are selected as candidate dsRNA segments;

[0033] (3) Obtaining the target gene of dsRNA sequence: Based on the candidate dsRNA fragments, primers (SEQ ID NO.1 and SEQ ID NO.2) were designed. The high-scoring sRNA concentrated fragments obtained in step (2) were used as templates to amplify the target gene by PCR. The target gene was verified by agarose nucleic acid electrophoresis to obtain the DNA sequence corresponding to the target dsRNA sequence. After comparison with the strain (GCA_014117465.1), it was found to be located in the tor gene. The specific sequence is as follows:

[0034] The primer sequences are as follows:

[0035] Primer 1: 5'-GCTGTCAGCTATTTGTCCACG-3' SEQ ID NO. 1;

[0036] Primer 2: 5′-TCTGAATCAGGATCGCCGAC-3′ SEQ ID NO.2.

[0037] Sense strand of the DNA sequence corresponding to the target dsRNA:

[0038] 5'-ACATGCTGTCAGCTATTTGTCCACGATCCAATTATCAATCAGACTAGTAGTCACTC AATACAGGTTGTTAGTGAAGTCATTGACAAGCTTCTGACGGTTGGTGTCGGCGATCCTG ATTCAGAGATCCGGCGCACAGTTTTGTGGTCATTGGATCGCAAATTCGACCGCCATCTTG CACGGCCAGAGAATATTCGTTGTTTG-3'SEQ IDNO.3;

[0039] Antisense strand of the DNA sequence corresponding to the target dsRNA:

[0040] 5'-CAAACAACGAATATTCTCTGGCCGTGCAAGATGGCGGTCGAATTTGCGATCCAAT GACCACAAAACTGTGCGCCGGATCTCTGAATCAGGATCGCCGACACCAACCGTCAGAA GCTTGTCAATGACTTCACTAACAACCTGTATTGAGTGACTACTAGTCTGATTGATAATTGG ATCGTGGACAAATAGCTGACAGCATGT-3'SEQ IDNO.4.

[0041] (4) Synthesis of dsRNA fragments: Add an XhoI restriction site to the 5'-end of primer 1, and add a BglII restriction site to the 5'-end of primer 2. Use the DNA sequence corresponding to the target dsRNA sequence obtained in step (3) as a template to perform PCR amplification to obtain a gene fragment containing the restriction sites. Perform double restriction digestion and enzyme ligation reaction on the gene fragment containing the restriction sites and the pL14440 plasmid, screen for positive plasmids, and perform in vitro transcription using T7 RNA polymerase to synthesize a dsRNA fragment whose sense chain sequence is shown in SEQ ID NO.5 and whose antisense chain sequence is shown in SEQ ID NO.6.

[0042] The dsRNA sequence is as follows:

[0043] Sense chain sequence:

[0044] 5'-ACAUGCUGUCAGCUAUUUGUCCACGAUCCAAUUAUCAAUCAGACUAGUAGUC ACUCAAUACAGGUUGUUAGUGAAGUCAUUGACAAGCUUCUGACGGUUGGUGUCGGC GAUCCUGAUUCAGAGAUCCGGCGCACAGUUUUGUGGUCAUUGGAUCGCAAAUUCGA CCGCCAUCUUGCACGGCCAGAGAAUUCGUUGUUUG-3'SEQ IDNO.5;

[0045] Antisense strand sequence:

[0046] 5'-CAAACAACGAATAUUCUCUGGCCGUGCAAGAUGGCGGUCGAAUUUGCGAUCC AAUGACCACAAAACUGUGCGCCGGAUCUCUGAAUCAGGAUCGCCGACACCAACCGUC AGAAGCUUGUCAAUGACUUCACUAACAACCUGUAUUGAGUGACUACUAGUCUGAUU GAUAAUUGGAUCGUGGACAAAUAGCUGACAGCAUGU-3'SEQ ID NO.6.

[0047] Example 2

[0048] The inventors used primers 1 and 2 in Example 1 to perform PCR amplification using the genome of the Aspergillus flavus strain JXZS-3 preserved in the laboratory as a template, and subjected the amplified gene sequence to agarose gel electrophoresis. Figure 1 , and sequence verification was performed, and positive clones were obtained, that is, the amplified Aspergillus flavus strains all contained the DNA sequence corresponding to the target dsRNA sequence in Example 1. The experimental results show that the DNA sequence corresponding to the target dsRNA sequence provided by the present invention is contained in a variety of Aspergillus flavus strains, and the dsRNA provided by the present invention is also applicable to Aspergillus flavus strains other than strain (GCA_014117465.1). The Aspergillus flavus strains preserved in the laboratory were isolated and obtained from peanut and corn plants in many places in Shandong Province; Aspergillus flavus strains JXZS-3, LNZW-1, and HuBzhx-33 can be obtained from the Microbiology Laboratory of the Institute of Quality Standards and Detection Technology of Shandong Academy of Agricultural Sciences.

[0049] The PCR reaction conditions are as follows:

[0050] (1) The reaction system is shown in Table 1:

[0051] Table 1

[0052]

[0053]

[0054] (2) Reaction conditions:

[0055] Initial denaturation: 95°C for 3 min;

[0056] Cycle: denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 30 s, 35 times;

[0057] Final extension: 72°C for 5 min;

[0058] Insulation: 4℃.

[0059] Example 3

[0060] The effects of the above dsRNA sequence on Aspergillus flavus are as follows:

[0061] (1) performing agarose gel electrophoresis on the synthesized dsRNA, cutting the dsRNA band and extracting it using a gel extraction kit to obtain dsRNA dissolved in an elution buffer, and measuring and calculating the dsRNA content at 260 nm using a micro-spectrophotometer (NanoDrop);

[0062] (2) Prepare 2 portions of 50 ng / μL dsRNA solution using RNase-free water;

[0063] (3) Freshly obtained Aspergillus flavus spores were prepared into a suspension; the Aspergillus flavus strains used were JXZS-3, LNZW-1, and HuBzhx-33.

[0064] (4) 20 μL of one of the dsRNA solutions was taken, 15 μL of Aspergillus flavus spore suspension was added and mixed evenly, enzyme-free sterile water was used as a control of the dsRNA solution, 15 μL of Aspergillus flavus spore suspension was added and mixed evenly, and the plate was coated with PDA medium and cultured at 28° C. for 5 days;

[0065] (5) Two other PDA plates were taken, 15 μL of Aspergillus flavus spore suspension was added to each plate for coating, and the plates were incubated at 28°C for 3 days. Then, 20 μL of dsRNA solution was dripped into one of the PDA plates, and 20 μL of enzyme-free sterile water was dripped into the other PDA plate, and the plates were continued to be incubated at 28°C for 2 days.

[0066] (6) The growth of Aspergillus flavus under the two different treatment methods in step (4) and step (5) were compared respectively. The results showed that dsRNA had an inhibitory effect on Aspergillus flavus strains. The effect diagram of dsRNA inhibiting Aspergillus flavus strain JXZS-3 is shown in FIG. Figure 2 As shown in A and B;

[0067] (7) The dry weight of Aspergillus flavus under different treatment conditions was determined by dry weight determination method. Calculation showed that the dry weight of Aspergillus flavus treated with dsRNA was reduced by about 50%.

[0068] It can be concluded from the above experimental data that the dsRNA provided by the present invention has a significant inhibitory effect on Aspergillus flavus. When the dsRNA sequence is applied to Aspergillus flavus spores or Aspergillus flavus strains by seed dressing or spraying, the abundance of Aspergillus flavus can be reduced by about 50%.

[0069] The dsRNA provided by the present invention has an obvious inhibitory effect on Aspergillus flavus, can be used for the preservation of food, feed, etc., and can also be used for the planting of crops to reduce the harmful effects of Aspergillus flavus on crops such as corn and peanuts.

Claims

1. A dsRNA for inhibiting Aspergillus flavus, wherein the sense strand of the dsRNA sequence is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.

6.

2. Use of the dsRNA according to claim 1 in the preparation of aflatoxin inhibitors.

3. A flavus inhibitor, characterized in that: Comprising the dsRNA of claim 1.

4. Use of the dsRNA according to claim 1 or the aflatoxin inhibitor according to claim 3 in inhibiting aflatoxin.

5. The use according to claim 4, characterized in that Use of the dsRNA according to claim 1 or the aflatoxin inhibitor according to claim 3 in inhibiting aflatoxin in food, feed or crops.

6. Use of the dsRNA according to claim 1 in the preparation of biological pesticides.

7. A biological pesticide, characterized in that: Comprising the dsRNA of claim 1.

8. Use of the dsRNA according to claim 1 in the preparation of a fungicide.

9. A bactericide, characterized in that: Comprising the dsRNA of claim 1.

Images