Application of the jujube transcription factor ZjSVP3 gene in regulating plant pistil morphology and fertility

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the jujube transcription factor ZjSVP3 gene in regulating pistil fertility. Through heterologous transformation, it was identified that jujube ZjSVP3 inhibits pistil morphogenesis, reduces seed quantity and germination rate, and confirmed that ZjSVP3 directly binds to and downregulates the expression of the key pistil development gene ZjSHP1. The function of the jujube MADS-box gene ZjSVP3 in inhibiting pistil morphogenesis and inducing plant sterility was clarified. As an important gene resource for inhibiting reproductive growth and promoting vegetative growth, jujube ZjSVP3 can be applied to the molecular improvement of crops and forest trees whose collection targets are buds, leaves, and wood, such as tea trees and poplar trees, which can both increase yield and improve the ecological environment.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the jujube transcription factor ZjSVP3 gene in regulating pistil morphology and fertility. Background Technology

[0002] A flower consists of four different types of floral organs, from the outside in: sepals, petals, stamens, and carpels. The female reproductive organs of a flower consist of one or more carpels, each enclosing an ovule. Ovules form within the pistil, and the female gametophyte develops and differentiates into a female gamete within each ovule. After fertilization, the seed begins to develop, and in most plants, the pistil transforms into a fruit. Over the past 20 years, the model plant Arabidopsis thaliana has been used to study the gene regulatory network of pistil morphogenesis and tissue differentiation. Based on 20 stages of Arabidopsis flower development, pistil development in Arabidopsis can be roughly divided into six stages: from floral meristem to pistil initiation (stages 1–6); pistil regions, inner and outer (stages 7 and 8); ovule initiation and formation (stages 9 and 10); pistil formation (stages 11 and 12); pollination and fertilization (stage 13); and seed and fruit development (stages 14–20).

[0003] The carpel is defined by class C genes AG and SHP1, SHP2, and STK genes, as well as the SEP gene. AG is first detected in the central domain of the flower in stage 3, subsequently developing into stamens and carpels. AG accumulates uniformly throughout the stamens and carpel primordia in stages 4 through 7, but in more mature flowers, it localizes to specific cell types within these organs. In stage 9, only low levels of AG are detected in developing carpel valves, while high levels accumulate in ovule primordia. In stage 12, AG is detected in all cells, septa, and stigma of developing ovules, but expression is not detected in the style and valves. This specific localization of AG in these additional tissues within the carpel suggests that AG may play an additional role in later pistil development, and in fact, AG is involved in designating ovule identity. SHP gene expression is initially widely detected in developing pistils, but in stage 12 its expression is limited to the valve margins and ovules. Post-fertilization, SHP gene expression at the valve margins persists until stage 17. The SHP gene is also expressed in the nectary, ovule, septum, and style.

[0004] The key factor regulating flowering time, SVP, can directly bind to the regulatory regions of class C genes, indicating its fundamental role in floral meristem formation. Previous studies have found that jujube flowers infected with *Ziziphus jujuba* phytoplasma exhibit symptoms of pistil degeneration into vegetative branches, with significantly higher expression of the jujube SVP gene compared to healthy pistils during flowering, while the expression of its downstream gene, SHP1, is significantly reduced (Deng et al., 2021). Therefore, exploring the function of the jujube SVP gene not only provides a theoretical basis for elucidating the mechanism of floral organ degeneration in diseased jujube flowers but also provides genetic resources for breeding plants with pistil abortion and non-fruiting characteristics.

[0005] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0006] The purpose of this invention is to solve the problem of how to regulate pistil abortion and non-fruiting through the jujube ZjSVP3 gene, and to provide the application of the jujube transcription factor ZjSVP3 gene in regulating pistil morphology and fertility.

[0007] To achieve the above objectives, this invention discloses the application of the jujube transcription factor ZjSVP3 gene in regulating pistil morphology and fertility, the base sequence of which is shown in SEQ ID NO.1.

[0008] The ZjSVP3 gene negatively regulates the ZjSHP1 gene.

[0009] The amino acid sequence of the expressed protein of the ZjSVP3 gene is as shown in SEQ ID NO.2, or is a derivative sequence with equivalent function formed by substitution, deletion or addition of one or more amino acid residues.

[0010] The plant in question is either Arabidopsis thaliana or tobacco.

[0011] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0012] This invention is the first to study the role of the ZjSVP3 gene in regulating pistil development. Compared with the 35S:GFP transgenic line, the ZjSVP3 transgenic Arabidopsis and Nicotiana benthamiana exhibited pistil abortion and failure to produce fruit. qRT-PCR and dual-luciferase assays demonstrated that the ZjSVP3 gene negatively regulates ZjSHP1 expression.

[0013] The ZjSVP3 gene in jujube trees, through negative regulation of ZjSHP1, modulates pistil fertility, representing a novel and widely applicable application. As an important gene resource for regulating pistil fertility, it can increase yields in crops where buds and leaves are harvested, such as tea; and in timber species like poplar, it can increase timber biomass, inhibit pistil development, prevent fluff formation, and improve the ecological environment. It holds broad application prospects in both production and scientific research.

[0014] This invention, through observation and statistical analysis of the pistil morphology and fertility of ZjSVP3 transgenic Arabidopsis thaliana and Nicotiana benthamiana, found that compared with control lines, ZjSVP3 affected flower development in both plants, leading to flower abortion. Analysis of the effect of the ZjSVP3 gene on the expression of the pistil development gene SHP1 using qRT-PCR and dual-luciferase assays revealed that the ZjSVP3 gene negatively regulates SHP1. The ZjSVP3 gene can be used for plants requiring pistil abortion and non-fruiting, demonstrating broad application value. Attached Figure Description

[0015] Figure 1 Phenotypic diagram of a single flower of the jujube ZjSVP3 transgenic Arabidopsis thaliana;

[0016] Figure 2 Statistical graph of pod phenotype and length of transgenic Arabidopsis thaliana ZjSVP3 (jujube);

[0017] Figure 3 Observations on the pod anatomy and seed morphology of the jujube ZjSVP3 transgenic Arabidopsis thaliana, as well as statistical charts of seed quantity and germination rate.

[0018] Figure 4 Image of the ZjSVP3 transgenic tobacco plant and its identification.

[0019] Figure 5 Statistical graphs of pistil phenotype, style and embryo frame length in ZjSVP3 transgenic tobacco;

[0020] Figure 6 Morphological observation and germination rate statistics of ZjSVP3 transgenic tobacco seeds;

[0021] Figure 7 This diagram illustrates the expression of the downstream pistil development gene SHP1 in ZjSVP3 transgenic tobacco and the regulation of the downstream pistil development gene ZjSHP1 by ZjSVP3. Detailed Implementation

[0022] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0023] Example 1

[0024] Phenotypic observation and trait statistics of the ZjSVP3 transgenic Arabidopsis thaliana

[0025] (1) Genetic transformation of Arabidopsis thaliana using ZjSVP3 jujube seedlings

[0026] ① Agrobacterium GV3101 containing the ZjSVP3-GFP recombinant plasmid was inoculated into liquid LB medium containing 25 mg / L Rif and 50 mg / L Kan, and cultured overnight at 200 rpm and 28°C using a shaker. 50 μL of the bacterial culture was then inoculated into 50 mL of liquid LB medium for expansion culture to OD. 600 =0.6-0.8. Take 50ml of bacterial culture, centrifuge at 6000g for 5min, discard the supernatant, add an equal volume of resuspension [2.2g / L MS, 50g / L sucrose, 0.5g / L MES pH 5.7-5.8, 300μL / L (V / V)silent-77] to the bacterial cells, and let stand in the dark for 1-2h before use for infection;

[0027] ② Select unopened Arabidopsis inflorescences (remove open flowers and pods beforehand), immerse the inflorescences in the Agrobacterium resuspension solution from ① for 15 seconds to remove excess bacterial solution, and treat in the dark for 12 hours. Infect once every 5 days, for a total of 3 times. Collect T0 generation seeds after maturity;

[0028] ③ 35S-GFP and T0 seeds were washed three times with sterile water and then surface-sterilized once with 75% ethanol (1 min).

[0029] ④ Add an appropriate amount of 10% sodium hypochlorite for disinfection once (1 min), and rinse three times with sterile water;

[0030] ⑤ Seeds were evenly sown on MS medium containing 50 mg / L kan; after vernalization at 4℃ for 2-3 days, they were placed in an artificial climate chamber at 22℃ for 12-15 days with 16 / 8h (light / dark) conditions;

[0031] ⑥ Transplant the healthy, positive seedlings into nutrient pots and continue to cultivate them in an artificial climate chamber with 16 / 8h (light / dark) and 22℃.

[0032] (2) Phenotypic analysis of the ZjSVP3 transgenic Arabidopsis thaliana

[0033] Observation of single flowers of T1 generation jujube ZjSVP3 transgenic Arabidopsis thaliana ( Figure 1 The results showed that, compared with the control line, the jujube ZjSVP3 transgenic Arabidopsis thaliana exhibited pistil degeneration. Figure 1 ), shortened pods ( Figure 2 A) Surface covered with hair-like structures ( Figure 2 B), and statistical results on pod length showed that the pods of the transgenic lines were significantly shorter than those of the control lines, consistent with the phenotype. Figure 2 C). Dissection of the pods ( Figure 3 A) It was found that the transgenic lines exhibited seed or ovule abortion, and even the formation of carpel-like structures within the ovules. Mature seeds were observed (…). Figure 3 B) It was found that the seeds of the transgenic lines were shriveled, and the number of shriveled seeds was significantly lower than that of the control lines. Figure 3 C). Germination rate analysis was conducted by continuing sowing and culture on MS, and it was found that the germination rate of transgenic lines was significantly lower than that of control lines. Figure 3 D).

[0034] Example 2

[0035] Phenotypic observation and trait statistics of ZjSVP3 transgenic tobacco Benedictine jujube

[0036] (1) Genetic transformation of ZjSVP3 into Tobacco Benedictine jujube

[0037] ① Agrobacterium GV3101 containing the ZjSVP3-GFP recombinant plasmid was inoculated into liquid LB medium containing 25 mg / L Rif and 50 mg / L Kan, and cultured overnight at 200 rpm and 28°C using a shaker. 50 μL of the bacterial culture was then inoculated into 50 mL of liquid LB medium for expansion culture to OD. 600 =0.6-0.8. Centrifuge 50 ml of bacterial culture at 6000 g for 5 min, discard the supernatant, and add an equal volume of sterile MS liquid medium (containing 200 μM AS) to resuspend the bacterial cells. Incubate in the dark for 2-3 h before use for the next transformation step;

[0038] ② Cut the leaves of sterile wild-type tobacco tissue culture seedlings into small cubes, add the infection solution prepared in ①, shake manually for 10 minutes, then wipe the bacterial solution on the surface of the leaf disc dry and place it in a co-culture medium for dark incubation for 2-3 days;

[0039] ③ After co-culture, gently agitate the leaf discs in sterile water containing 250 mg / L Cef and 200 mg / L Tim for 15 minutes. Remove the leaves and place them in a sterile tissue culture bottle. Wash the leaf discs with sterile water 3-5 times, 2 minutes each time. After blotting the surface moisture with sterile filter paper, place them on a selection medium and culture. Subculture every two weeks until adventitious buds appear.

[0040] ④ Cut off adventitious buds and place them on rooting medium for cultivation until the roots grow to about 2-3 cm. After hardening off the seedlings, transplant them into a sterile substrate for cultivation.

[0041] (2) Identification of ZjSVP3 transgenic tobacco

[0042] RNA was extracted from 100 mg of tobacco leaves cultured in the substrate, reverse transcribed into cDNA, and analyzed by qRT-PCR. The results showed that ZjSVP3 expression was detected in the ZjSVP3#3 and #5 transgenic lines. Figure 4B) ZjSVP3 expression was not detected in the empty vector control 35S-GFP. Further protein extraction was performed from 100 mg of tobacco leaves cultured in the substrate using Western blot analysis. The results showed that the ZjSVP3-GFP fusion protein band was detected in the ZjSVP3#3 and #5 transgenic lines, while the ZjSVP3-GFP fusion protein band was not detected in the empty vector control 35S-GFP. These results indicate that ZjSVP3 transformation into tobacco can be used for subsequent phenotypic observation and analysis.

[0043] (3) Phenotypic analysis of ZjSVP3 transgenic tobacco

[0044] The phenotype of the ZjSVP3 transgenic tobacco after transplanting was observed. Figure 4 A). The results showed that, compared with the control line, the jujube ZjSVP3 transgenic tobacco showed ovary shrinkage (A). Figure 5 A) The style becomes shorter ( Figure 5 A) and surface-borne hair-like structures ( Figure 5 C), and the statistical results of style length showed that the style length of the transgenic lines was significantly smaller than that of the control lines, consistent with the phenotype. Figure 5 B). Dissection of the ovary of the transgenic line ( Figure 5 C) A stem-like structure was found to emerge from the base of the embryo frame. Statistical analysis of the embryo frame length showed that the length of the embryo frame in the transgenic line was significantly greater than that in the control line, consistent with the phenotype. Figure 5 D). Observation and germination rate statistics of transgenic lines' seeds showed that, compared with the plump seed morphology of the control lines, the seeds of ZjSVP3 transgenic tobacco were small and wrinkled, and almost did not germinate. Figure 6 ).

[0045] Example 3

[0046] The regulatory effect of ZjSVP3 on the pistil development gene SHP1

[0047] (1) Analysis of NbSHP1 expression in ZjSVP3 transgenic tobacco

[0048] Total RNA was extracted from flower buds in the early developmental stage of ZjSVP3 transgenic tobacco, reverse transcribed into cDNA, and analyzed by qRT-PCR. The NbEF1 gene (AY206004) was used as an internal reference gene. Results showed that NbSHP1 expression was significantly reduced in ZjSVP3 transgenic tobacco compared to the control line. Figure 7 A).

[0049] (2) Dual-luciferase assay to analyze the regulatory effect of ZjSVP3 on the pistil development gene ZjSHP1.

[0050] Using the ZjSHP1 promoter as a template, specific primers were designed for amplification, and homologous recombination was used to insert them between the HindIII and BamHI restriction sites on pGreenII 0800-LUC.

[0051] The specific amplification primers for jujube ZjSVP3 are as follows (underlined are vector primer adapters):

[0052] LUC-pZjSHP1-F

[0053] 5'- TCGACGGTATCGATAAGCTT TCCAAACTCAAAATCCAAGAAGC-3'

[0054] LUC-pZjSHP1-R

[0055] 5'- CGCTCTAGAACTAGTGGATCC ATCCCCCTTTCTCTCTTTCCC-3'

[0056] The constructed recombinant plasmid was transformed into competent Agrobacterium GV3101 (pSoup-p19) cells. After expanding the positive bacterial culture to 50 mL, the liquid culture medium was removed by centrifugation at 5000 r / min for 5 min. The cells were resuspended in injection buffer (10 mM MgCl2, 10 mM MES, 200 μM AS) and diluted to approximately OD600 1. The cells were then activated in the dark at room temperature for 3 h for transient transformation of tobacco leaves.

[0057] Agrobacterium GV3101 strains carrying 35S::GFP, ZjSVP3-GFP, and LUC-pZjSHP1 were mixed at a ratio of 9:1 (effectant:reporter) and injected into tobacco leaves. Figure 7 B) Slowly inject 1 mL of the luciferase into both sides of the midrib of the leaf using a disposable syringe. After culturing the injected tobacco for 2 days, luciferase activity was detected using a NightShade LB 985 plant in vivo imaging system (Berthold Technologies). 30 min before detection, 0.2 mM luciferase was infiltrated into the same location infiltrated by Agrobacterium. All images were analyzed using a 3×3 frequency division with an exposure time of 2 min. The results showed that, compared to the empty control, the fluorescence intensity was reduced in the presence of ZjSVP3-GFP (…). Figure 7 C).

[0058] Firefly luciferase (LUC) and Renilla luciferase (REN) activities were determined using a dual-luciferase reporter gene assay kit. Promoter activity was calculated as the LUC / REN ratio, with a control group LUC / REN value set to 1. Results showed that, compared to the empty vector control, the LUC / REN ratio was significantly decreased in the presence of ZjSVP3-GFP. Figure 7 D), consistent with the fluorescence results ( Figure 7 C) ZjSVP3 has the function of negatively regulating the ZjSHP1 gene.

[0059] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. Jujube transcription factors ZjSVP3 The application of genes in regulating plant pistil morphology and fertility is characterized by, By overexpressing the above ZjSVP3 Genes that cause pistil abortion and non-fertility in plants, the aforementioned ZjSVP3 The gene's base sequence is shown in SEQ ID NO. 1, and the plant is tobacco or jujube.

Images