A molecular marker closely related to the purity of pepper seeds, a primer and application thereof in identifying the purity of hybrid seed

Abstract

This invention provides molecular markers and primers closely related to the purity of chili pepper seeds, and their application in identifying the purity of hybrid seeds. The molecular markers include molecular marker 1 and molecular marker 2. Molecular marker 1 is a C-to-T variation occurring at position 1150917 bp on chromosome 1 of the chili pepper genome (Capsicum annuum L); molecular marker 2 is a T-to-C variation occurring at position 30093662 bp on chromosome 6 of the chili pepper genome (Capsicum annuum L). This invention screened two SNP sites that differed between two parents, successfully developed SNP markers, and designed two pairs of KASP primers. These primers can be used directly for the identification of the commercial early-maturing chili pepper variety "Xingshu Zhoula No. 1" using fluorescence detection technology.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, and in particular relates to a molecular marker and primer that are closely related to the purity of chili seeds and their application in identifying the purity of hybrid seeds. Background Technology

[0002] Agriculture is the foundation of a nation, and seeds are the cornerstone of agriculture. Seed quality is the lifeblood and foundation of seed production and sales, and it is also key to controlling production risks. Cultivating and producing high-quality seeds is the core task of the planting industry. Generally, the four main indicators of seed quality are: seed purity, cleanliness, germination rate, and moisture content, with purity being the most crucial measure of seed quality. Therefore, seed purity testing is an important part of internal seed quality control and a primary quality indicator for market supervision.

[0003] Common methods for determining the purity of general varieties include seed morphology identification, seedling morphology identification, protein (isoenzyme) electrophoresis, DNA molecular marker identification, and field plot planting identification. Seed morphology identification relies on characteristics such as seed shape, color, size, embryo size, and endosperm starch content. This method requires standard samples or chromatograms of the variety and relevant data, resulting in low accuracy. Seedling morphology identification focuses on coleoptile color (green, red, purplish-red, purple), leaf color, leaf shape, and growth vigor. Coleoptile color is often used as the primary morphological characteristic for purity assessment. This method is time-consuming and inefficient. Protein (isoenzyme) electrophoresis identifies different varieties based on their genetic differences, resulting in variations in the types and quantities of synthesized proteins (isoenzymes). The resulting bands differ after electrophoresis, allowing for comparison with a control (standard) variety to determine seed quantity and purity. This method is time-consuming and complex. DNA molecular marker identification uses varietal DNA fragments as the detection target. Electrophoresis is used to detect the genomic DNA structure and composition of the variety, analyzing DNA polymorphisms (differences in DNA base sequences) to identify different varieties. Currently, the DNA molecular markers used for identifying variety authenticity and purity mainly include SSR, AFLP, and RAPD techniques based on PCR amplification, and RFLP techniques based on molecular hybridization. These methods all require electrophoretic band differentiation to distinguish genuine from counterfeit varieties, making them unsuitable for large-scale operations. Field plot planting identification is currently the most reliable method for identifying variety authenticity and purity, especially suitable for identifying hybrids. The results are accurate and reliable, making it the most legally binding testing method for resolving seed quality disputes. This method can observe and compare a wide range of traits. However, its disadvantages include being labor-intensive, time-consuming, having a long identification cycle, and high costs. Furthermore, this method is greatly affected by environmental and human factors, and the accuracy is also limited by the observer's experience. All existing variety identification methods have their shortcomings.

[0004] With the development of genome sequencing technology, researchers have developed methods to detect SNP marker sites in both parents. Currently, SNP detection, as the latest molecular marker detection method, has been recommended by numerous international organizations, such as the International Seed Testing Association (ISTA), the International Union for the Protection of New Varieties of Plants (UPOV), and the International Seed Federation (ISF), as a method for variety identification at the DNA level. These methods mainly include SNP microarray platforms, high-throughput in situ scanning platforms (LGC's KASP technology, Life Sciences' Taqman technology), and high-throughput targeted sequencing technologies for both sites and samples. These technologies are relatively expensive, resulting in high identification costs.

[0005] Xingshu Wrinkled Chili No. 1 is a representative variety of high-quality chili peppers with excellent taste. Its cumulative annual planting area exceeds 50,000 mu in provinces such as Hunan and Jiangxi. Variety identification is crucial for its promotion and application. However, currently, the purity identification of Xingshu Wrinkled Chili No. 1 mainly relies on field phenotypic identification, and a simple, efficient, and low-cost testing method is lacking for determining the purity of this variety. Summary of the Invention

[0006] The technical problem to be solved by this invention is the lack of a simple, efficient and low-cost detection method for detecting the purity of chili variety hybridization. This invention overcomes the deficiencies and defects mentioned in the background art and provides a chili molecular marker, its KASP primer combination and its application in identifying the authenticity of the Xingshu Zhoula No. 1 early-maturing chili variety.

[0007] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0008] A molecular marker closely related to the purity of chili seeds, comprising molecular marker 1 and molecular marker 2, wherein molecular marker 1 is a C-to-T mutation occurring at position 1150917 bp on chromosome 1 of the chili genome Capsicum annuum L; and molecular marker 2 is a T-to-C mutation occurring at position 30093662 bp on chromosome 6 of the chili genome Capsicum annuum L.

[0009] Under the same technical concept, the present invention also provides primers that are closely related to the purity of chili seeds, the primers including Chr01-1150917 and Chr06-30093662, the nucleotide sequences of which are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively;

[0010] The Chr01-1150917 includes an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer C with a nucleotide sequence as shown in SEQ ID NO: 3;

[0011] The Chr06-30093662 includes an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO: 4, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO: 5, and a downstream primer C with a nucleotide sequence as shown in SEQ ID NO: 6.

[0012] Preferably, the 5' ends of upstream primer F1 of Chr01-1150917 and Chr06-30093662 are respectively connected to FAM fluorescent adapters, and the 5' ends of upstream primer F2 are respectively connected to HEX fluorescent adapters. The nucleotide sequences of FAM and HEX fluorescent adapters are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0013] Under the same technical concept, the present invention also provides the application of the molecular marker or primer that is closely related to the purity of chili seeds in identifying the purity of hybrid seeds.

[0014] Preferably, the purity of the chili seeds includes the authenticity of the Xingshuzhoula No. 1 early-maturing chili variety.

[0015] Preferably, the specific steps for identifying the authenticity of the Xingshuzhoula No. 1 early-maturing chili pepper variety include:

[0016] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the KASP primer combination of the pepper molecular marker to obtain the amplification product;

[0017] (2) Fluorescence detection was performed on the amplified products. If the HEX fluorescence signal corresponding to the primer set Chr01-1150917 or Chr06-30093662 was detected, the corresponding detection site was A:A or C:C genotype, and it was determined to be a paternal pseudohybrid. If the FAM fluorescence signal corresponding to the primer set Chr01-1150917 or Chr06-30093662 was detected, the corresponding detection site was G:G or T:T genotype, and it was determined to be a maternal pseudohybrid. If both FAM and HEX fluorescence signals were detected, the detection site was G:A or T:C genotype, and it was determined to be a true hybrid. If no fluorescence signal was detected, it was another genotype combination, and it was determined to be another type of hybrid.

[0018] Preferably, the method for identifying the authenticity of the early-maturing chili variety "Xingshuzhoula No. 1" by using the chili molecular markers involves statistically analyzing the proportion of true hybrids in the total tested samples and calculating the purity of the chili hybrid seeds.

[0019] Preferably, the PCR amplification method specifically includes:

[0020] Touchdown PCR was used for amplification; the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] (1) This invention uses whole-genome chip sequencing variation detection method to screen two SNP sites that are different between two parents, successfully develop SNP markers, and design two pairs of KASP primer combinations. It can use fluorescence detection technology to quickly distinguish the male parent, female parent and hybrid of the early-maturing pepper variety "Xingshuzhoula No. 1". It can be directly used for the identification of the commercial early-maturing pepper variety "Xingshuzhoula No. 1".

[0023] (2) By using parental microarray sequencing data, we developed polymorphic KASP primers for rapid seed germination of F1, followed by DNA extraction and laboratory fluorescence quantitative detection to quickly and accurately complete purity identification. We also rely on this molecular marker to evaluate the true and false hybrids of commercial varieties and effectively protect the rights and interests of the varieties.

[0024] (3) By identifying the early-maturing chili variety “Xingshuzhoula No. 1”, the purity of the variety can be further calculated, effectively reducing the losses caused by false hybrids, reducing possible disputes, improving identification efficiency and accuracy, and providing evidence for the protection of the variety. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 These are phenotypic diagrams of the female parent (left), male parent (middle), and hybrid (right) of "Xingshu Zhoula No. 1";

[0027] Figure 2This is a diagram illustrating the differences between the parent and parent chili peppers detected by the chip detection system.

[0028] Figure 3 This is the genotyping diagram of the molecular markers Chr01-1150917 and Chr06-30093662 from Example 1 in identifying the true and false hybrids of "Xingshu Zhoula No. 1". Detailed Implementation

[0029] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0030] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0031] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0032] Example 1

[0033] Obtaining molecular markers and designing corresponding KASPs for varietal purity identification of the early-maturing chili variety "Xingshu Zhoula No. 1"

[0034] 1. Whole-genome microarray sequencing variant detection

[0035] Variation detection refers to the sequencing and differential analysis of the genome of an individual or population of a species using high-throughput sequencing technology to obtain a large number of single nucleotide polymorphism (SNP) sites, insertion / deletion sites (InDel), structural variation sites (SV), and copy number variation sites (CNV). With the significant reduction in sequencing costs and the improvement in sequencing efficiency, whole-genome microarray sequencing variation detection has become one of the fastest and most effective methods for studying human diseases and molecular breeding of plants and animals. After the sequencing data is processed, bioinformatics analysis is performed according to the following procedure:

[0036] (1) Perform quality control on the raw sequencing data to obtain clean data for analysis; the raw data is RAW data to obtain high-quality clean reads for subsequent analysis. The sequencing data filtering steps are as follows: (1) Remove reads containing adapters; (2) Remove reads with more than 3 N; (3) Remove low-quality reads (the number of bases with quality value Q < 5 accounts for more than 20% of the entire read).

[0037] (2) Align the Clean Data with the Reference Genome; After obtaining the clean reads, use BWA software to align the clean reads with the reference genome. The initial alignment results are in SAM format, and then use SAMtools software to convert the results to BAM format and sort them. If the results of a sample contain multiple libraries, use SAMtools to merge the BAM results of multiple libraries, use picard to label repetitive sequences, and perform basic data information statistics;

[0038] (3) SNP mutation detection was performed; GATK software (v3.8 second-generation chip sequencing mutation detection software https: / / software.broadinstitute.org / gatk / ) was used to detect SNPs;

[0039] (4) SNP screening: filter out sites with QUAL value (base quality value) less than 30, MQ value less than 30, and DP value less than 2, and select SNP sites that are homozygous and differential between the parents as candidate sites.

[0040] 2. Molecular marker development

[0041] Based on the differences in sequencing sequences between the parents of the early-maturing chili variety "Xingshu Zhoula 1", candidate SNP sites were selected. KASP primers (as shown in Table 1) were designed using the online primer design software SNP Primer (www.snpway.com). These primers consisted of a pair of specific primers (Primer A and Primer B) containing different fluorescent linkers for the SNP alleles, and a reverse common primer (Primer C). Primer A contained a FAM fluorescent linker (GAAGGTGACCAAGTTCATGCT), and Primer B contained a HEX fluorescent linker (GAAGGTCGGAGTCAACGGATT). Primer pairs with suitable specificity and annealing temperatures were selected. The primers were synthesized by Beijing Qingke Company.

[0042] Table 1 Molecular marker primers and sequences

[0043]

[0044] 3. The application of molecular markers specifically includes the following steps:

[0045] (1) Using the genomic DNA of the sample to be tested as a template, Touchdown PCR was performed using molecular marker amplification primers to obtain the amplification product. The Touchdown PCR program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles. The components and amounts used in the PCR amplification are shown in Table 2.

[0046] Table 2. Components and dosages used in PCR amplification

[0047]

[0048] (2) The amplification products are detected and analyzed. If the HEX fluorescence signal corresponding to primer Chr01-1150917 or Chr06-30093662 is detected in the PCR product of the sample, the corresponding detection site is A:A, C:C genotype, and it is determined to be a paternal type pseudo-hybrid. If the FAM fluorescence signal corresponding to primer Chr01-1150917 or Chr06-30093662 is detected in the PCR product of the sample, the corresponding detection site is G:G, T:T genotype, and it is determined to be a maternal type pseudo-hybrid. If both FAM and HEX fluorescence signals are detected at the same time, the detection site is G:A, T:C genotype, and it is determined to be a true hybrid. If no fluorescence signal is detected, it is another genotype combination and is determined to be another type of hybrid.

[0049] The purity of chili hybrid seeds can be calculated by statistically analyzing the percentage of true hybrids in the total tested samples.

[0050] 4. Specific Application Examples

[0051] Two SNP markers were used, including molecular marker 1 and molecular marker 2. Molecular marker 1 is a C-to-T variation occurring at position 1150917 bp on chromosome 1 of the pepper genome Capsicum annuum L; molecular marker 2 is a T-to-C variation occurring at position 30093662 bp on chromosome 6 of the pepper genome Capsicum annuum L.

[0052] 188 samples of "Xingshu Wrinkled Chili No. 1" were tested. Figure 1 Phenotypic diagrams of the female parent (left), male parent (middle), and hybrid (right) of "Xingshu Zhoula No. 1"; Figure 2 Chip detection technology was used to identify differences between the maternal and paternal parents of chili peppers.

[0053] Figure 3Genotyping diagram of the molecular markers Chr01-1150917 and Chr06-30093662 in this embodiment for identifying true and false hybrids of "Xingshu Zhoula No. 1";

[0054] In the figure, point A indicates that the PCR product is the fluorescence signal corresponding to primers Chr01-1150917 and Chr06-30093662, which represents the paternal parent and the paternal pseudohybrid.

[0055] Section B indicates that the PCR product is the fluorescence signal corresponding to primers Chr01-1150917 and Chr06-30093662, which is a pseudohybrid of the maternal and paternal types.

[0056] Section C indicates that the PCR product has two fluorescent signals from primers Chr01-1150917 and Chr06-30093662, and is a hybrid F1.

[0057] The proportion of true hybrids in the submitted samples was calculated based on the SNP marker detection results. Primers were cross-corrected, and a true hybrid was determined when both primer pairs showed heterozygotes during F1 testing. The number of hybrid plants was defined as the number of individual plants with identical genotypes at both marker loci, belonging to either the male or female parent. Seed purity was then calculated (Tables 3 and 4). Field validation experiments showed good primer stability and good agreement with field test results, with a purity of 98.4% for chili hybrid varieties. The detection method of this invention can complete seed purity identification within 2 hours, offering advantages such as speed, low cost, and ease of operation.

[0058] Table 3. Genotypes and determination of true and false hybrids based on Chr01-1150917 and Chr06-30093662 marker detection.

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067] Table 4 Purity Identification Results

[0068]

[0069] In summary, molecular marker identification and screening in breeding can identify maternal pseudohybrids by retaining the FAM fluorescence signal corresponding to primers Chr01-1150917 and Chr06-30093662; paternal pseudohybrids are identified by retaining the HEX fluorescence signal corresponding to primers Chr01-1150917 and Chr06-30093662; and true hybrids are identified if both fluorescence signals are detected simultaneously, indicating a G:A, T:C genotype. Early molecular marker screening can identify the purity of commercial products and protect varieties. This method is simple and easy to operate, greatly improving efficiency for breeders.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. The application of a primer closely related to the purity of chili pepper seeds in identifying the purity of Xingshu Wrinkled Chili No. 1 hybrid seeds, characterized in that, The primers are the Chr01-1150917 primer set and the Chr06-30093662 primer set; The Chr01-1150917 primer set includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO: 1, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO: 2, and downstream primer C with nucleotide sequence as shown in SEQ ID NO: 3; The Chr06-30093662 primer set includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO: 4, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO: 5, and downstream primer C with nucleotide sequence as shown in SEQ ID NO:

6.

2. The application as described in claim 1, characterized in that, The upstream primer F1 in the Chr01-1150917 primer set and the Chr06-30093662 primer set are respectively connected to the FAM fluorescent adapter at the 5' end, and the upstream primer F2 is respectively connected to the HEX fluorescent adapter at the 5' end. The nucleotide sequences of the FAM and HEX fluorescent adapters are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

3. The application as described in claim 1, characterized in that, The specific steps used in determining the purity of Xingshuzhoula No. 1 hybrid seeds include: (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers of the chili molecular marker to obtain the amplification product; (2) Perform fluorescence detection on the amplification products. If the HEX fluorescence signal corresponding to the primer set of Chr01-1150917 or Chr06-30093662 is detected, the corresponding detection site is A:A or C:C genotype, and it is determined to be a paternal type pseudo-hybrid. If the FAM fluorescence signal corresponding to the primer set of Chr01-1150917 or Chr06-30093662 is detected, the corresponding detection site is G:G or T:T genotype, and it is determined to be a maternal type pseudo-hybrid. If both FAM and HEX fluorescence signals are detected at the same time, the detection site is G:A or T:C genotype, and it is determined to be a true hybrid. If no fluorescence signal is detected, it is another genotype combination, and it is determined to be another type hybrid.

4. The application as described in claim 3, characterized in that, The method for identifying the authenticity of the early-maturing chili variety "Xingshuzhoula No. 1" using the chili molecular markers was used to statistically analyze the proportion of true hybrids in the total tested samples and calculate the purity of chili hybrid seeds.

5. The application as described in claim 3, characterized in that, The PCR amplification method specifically includes: Touchdown PCR was used for amplification; the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

Images