Application of Miscanthus sinensis MsWRKY23 gene in improving crop resistance to abiotic stress

Abstract

The invention discloses Miscanthus sinensis <h2 style=";text-align:left;direction:ltr">MsWRKY23 The application of genes in improving the ability of crops to resist abiotic stress belongs to the field of genetic engineering technology. <h2 style=";text-align:left;direction:ltr"> MsWRKY23 Role of genes in improving crop resistance to abiotic stress, Miscanthus sinensis <h2 style=";text-align:left;direction:ltr"> MsWRKY23 The CDS sequence of the gene is shown in SEQ ID NO.1, and the abiotic stress is salinity stress and drought stress. <h2 style=";text-align:left;direction:ltr"> MsWRKY23 The gene can significantly increase the activity of the plant's SOD, CAT, and POD antioxidant enzymes, significantly reduce the MDA content, and thus significantly improve the plant's drought, salt, and alkali tolerance; <h2 style=";text-align:left;direction:ltr"> MsWRKY23 The genes can be used to cultivate new crop germplasm with greater tolerance to abiotic stresses and for ecological restoration of saline-alkali land.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic engineering, in particular to Miscanthus sinensis MsWRKY23 Application of genes in improving crop resistance to abiotic stress. Background Art

[0002] As a C4 plant of the Poaceae family, Miscanthus sinensis has strong adaptability to extreme environments and is a pioneer plant with certain economic value for soil and water conservation and ecological environment improvement. Studies have shown that Miscanthus sinensis can survive on saline-alkali land and can improve the degree of soil salinization. Using genetic engineering to obtain Miscanthus sinensis varieties with higher stress resistance will have important practical significance for improving the soil state, farming environment and overall ecological environment in the Yellow River Delta region. The grown Miscanthus sinensis can also be used as silage. Summary of the invention

[0003] The present invention aims to provide Miscanthus sinensis MsWRKY23 The application of genes in improving the ability of crops to resist abiotic stresses, to provide a gene sensitive to abiotic stresses, to provide a functional gene for creating new crop germplasm with stronger tolerance to abiotic stresses, and to contribute to the ecological restoration of saline-alkali land in my country.

[0004] To achieve the above object, the present invention provides Miscanthus sinensis MsWRKY23 Application of genes in improving the ability of crops to resist abiotic stress, the Miscanthus sinensis MsWRKY23 The CDS sequence of the gene is shown in SEQ ID NO. 1, and the abiotic stress is saline-alkali stress and drought stress.

[0005] Preferably, the overexpression of Miscanthus sinensis MsWRKY23 Genes can significantly improve the plant's tolerance to drought, salt and alkali.

[0006] Preferably, the overexpression of Miscanthus sinensis MsWRKY23 The gene can significantly increase the activity of SOD, CAT, and POD antioxidant enzymes in plants and significantly reduce the MDA content.

[0007] Contains the above-mentioned Miscanthus MsWRKY23 The application of gene vectors and strains is used in improving the ability of crops to resist abiotic stress. The vectors include overexpression vectors, knockout vectors, and silencing vectors. The strains include Escherichia coli and Agrobacterium.

[0008] A kind of Miscanthus MsWRKY23 Genetically engineered new Miscanthus germplasm, the new germplasm has strong tolerance to abiotic stress, and its yield is not affected or is slightly affected, and the new germplasm is an overexpressed Miscanthus obtained by genetic engineering MsWRKY23 Genetic plants.

[0009] Therefore, the Miscanthus provided by the present invention MsWRKY23 The specific technical effects of the application of genes in improving the resistance of crops to abiotic stress are as follows:

[0010] (1) Overexpression of Miscanthus sinensis MsWRKY23 Genes can significantly improve the plant's tolerance to drought, salt and alkali;

[0011] (2) Overexpression of Miscanthus sinensis MsWRKY23 The gene can significantly increase the activity of SOD, CAT, and POD antioxidant enzymes in plants and significantly reduce the MDA content;

[0012] (3) MsWRKY23 The genes can be used to cultivate new crop germplasm with greater tolerance to abiotic stresses and for ecological restoration of saline-alkali land.

[0013] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0015] Figure 1 is the result of identifying transgenic plants in Example 3 of the present invention, wherein M is a marker, WT is a wild-type plant, and 1-8 are plants of different T3 generations;

[0016] Figure 2 In the fourth embodiment of the present invention MsWRKY23 Semi-quantitative results of overexpressed Arabidopsis and WT, where M is a marker, WT is a wild-type plant, and 3-5 and 7-8 are different T3 generation plants;

[0017] Figure 3 In the fifth embodiment of the present invention MsWRKY23 Photos of overexpressing Arabidopsis and WT before and on the 12th day of salt stress treatment;

[0018] Figure 4 In the fifth embodiment of the present invention MsWRKY23 Results of CAT (A), POD (B), SOD (C), and MDA (D) activity tests of overexpression plants and wild type before and on the 12th day after salt stress treatment. express P <0.05, express P <0.01;

[0019] Figure 5 In the sixth embodiment of the present invention MsWRKY23 Photos of overexpressing Arabidopsis and WT before and on the 12th day of alkaline stress treatment;

[0020] Figure 6 In the sixth embodiment of the present invention MsWRKY23 Results of CAT (A), POD (B), SOD (C), and MDA (D) activity tests of overexpression plants and wild type before and on the 12th day after alkaline stress treatment. express P <0.05, express P <0.01;

[0021] Figure 7 In the seventh embodiment of the present invention MsWRKY23 Photos of overexpressing Arabidopsis and WT before drought treatment, on the 12th day of drought treatment, and after rehydration;

[0022] Figure 8 In the seventh embodiment of the present invention MsWRKY23 Results of CAT (A), POD (B), SOD (C), and MDA (D) activity tests of overexpression plants and wild type before and on the 12th day after drought treatment. express P <0.05, express P <0.01. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0024] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0025] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0026] Embodiment 1

[0027] Build MsWRKY23 Gene expression vectors, MsWRKY23 The coding sequence of the gene (Misin03G167600.1) is shown in SEQ ID NO.1. The specific steps are as follows:

[0028] (1) RNA was extracted from Miscanthus sinensis leaves using the SPARKeasy Improved Plant RNA Kit (Shandong Spark Biotechnology Co., Ltd.) according to the instructions provided in the kit. The RNA was reverse transcribed into cDNA using TransScript® One-Step gDNA Removaland cDNA Synthesis SuperMix (Beijing Quanshijin Biotechnology Co., Ltd.).

[0029] According to the phytozome (https: / / phytozome-next.jgi.doe.gov / ) website MsWRKY23 The primers were designed based on the gene sequence, the upstream primer sequence was shown in SEQ ID NO.2, and the downstream primer sequence was shown in SEQ ID NO.3. The obtained cDNA was used as a template, and PCR was performed using the 2xTaq Master Mix system of Nanjing Novozyme Biotechnology Co., Ltd. to obtain MsWRKY23 Amplification of fragments. The amplification program was: 95 °C, 5 min; 95 °C, 15 sec, 58 °C, 15 sec, 72 °C, 2 min 30 sec, 35 cycles; 72 °C, 5 min.

[0030] (2) Use E.coRI restriction endonuclease (New England Biotechnology (Beijing) Co., Ltd.) to digest the 35S::MYC vector according to the system and conditions specified in the instructions for use of the enzyme.

[0031] (3) The obtained fragments in step (1) were cloned into the 5′-(4-nitro-1-nitro-2-yl) -1-nitro-1-nitro-2-yl ... MsWRKY23 The amplified fragment was inserted between the E.coRI restriction sites of the 35S::MYC vector to obtain the 35S::MYC recombinant vector.

[0032] (4) Transform the 35S::MYC recombinant vector into the competent E. coli TSach1-T1 according to the instructions attached to the competent cell. Spread the transformed E. coli TSach1-T1 competent cell on an LB plate and invert it at 37°C. When a single colony grows, pick a single clone and add it to LB liquid culture medium containing 50 mg / L Kan. Cultivate at 37°C with shaking until the bacterial solution becomes turbid. Use the bacterial solution as a template and use the 2×Taq Master Mix system to perform PCR identification of the bacterial solution. The primers and amplification procedures are the same as those in step (1).

[0033] At the same time, the bacterial liquid of different monoclones was sent to the company for sequencing. The bacterial liquid with bands on PCR product electrophoresis and correct sequencing was considered positive. After expansion, the plasmid was extracted using a kit.

[0034] (5) According to the instructions attached to the competent Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd.), the 35s::MYC recombinant vector obtained in step (4) was transformed into the competent Agrobacterium GV3101, and the successfully transformed bacterial solution was stored in a -80°C refrigerator.

[0035] SEQ ID NO.1:ATGCTGCTCATGGACTCGGCGCGCCGCGCCGGCTGCTCCCCGGTCTGCTTGGACCTCAGCGTCGGCCTTTCGCCGTCGTCGCCGGGGAGCAGCCCGGAAACGACAGCTGACACCGAGAGGCTTGACCGTCCGCCCGCCGCTGGCTGCAGGGTGGCATCGTCCCTGTCTGAGGAGCAGGCCAAGACTCTGGAGGCCAGGCTCACCCAGGTCAGCGAGGAGAACCGGCGGCTCACCGAGATGATCGCCTACCTCTACGCCAGCCAGGTCGCGCGGCAGAGCCCCGACAGCAGCAGGAAGAGGAGCAGGGACAGCCTGGAGCCGTCAAATTCGAGCGACGCCAACGGCAACGGCAACGGCAGCGGCAACACCAAGGCCGAGCCCGACCATGCCGTCGAGAGCGCCCTCAGCGACGAGGGCACGTGCAGGCGGATCAAGGTCACCAGGGTCTGCACCCGGATCGACCCCGCCGACACCACGCTCACCGTCAAAGACGGCTACCAATGGCGAAAGTACGGCCAGAAGGTGACCCGCGACAACCCGTCCCCGAGAGCCTACTTCCGCTGCGCATACGCGCCCTCCTGCCCCGTCAAGAAGAAGGTGCAGAGGAGCGCGGAGGACAGCACCTTGCTGGTGGCCACGTACGAGGGCGAGCACAACCACCCGAGCCCGACCCGCGCCGGCGAGCTTCCCATCGCCGCCTCCGCCACGGCGAGCGGGCCAGTGCCGTGCTCCATCTCCATGAACTCCTCCGGCCCGACCATCACGCTGGACCTCACCAAGAACGGAGGGGGCGGCGTGCGGGTGCTCGACGCCGCCGAGGCGCCCGACCTCAAGAAGCTGTGCCAGGAGATCGCATCGCCGGATTTCCGGACGGCGCTGGTGGGTCAGATGGCGCGCTCGCTGACCAAGGATCCCAAGTTCACCGACGCGCTGGCTGCCGCGATCCTGCAACAGCTGCCGGACTACTAG

[0036] SEQ ID NO.2: AATTCCCGGGGATCCCCATGCTGCTCATGGACTCGGC

[0037] SEQ ID NO.3: AGTGTCGACGAATTCCTAGTAGTCCCGGCAGCTGTT

[0038] Embodiment 2

[0039] The transfer obtained by using Example 1 MsWRKY23 The Agrobacterium GV3101 containing the gene expression vector was used for genetic transformation of Arabidopsis thaliana. The specific steps are as follows:

[0040] (1) Plant wild-type Arabidopsis thaliana two weeks in advance, cut off the fruit pods after they bolt, and water them one day before transformation.

[0041] (2) Take out the stored bacterial solution from the -80 ℃ refrigerator, aspirate 200 μL and add it to 50 mL of liquid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture at 28 ℃ and 220 rpm until the OD reaches 600 It is 0.6-0.8.

[0042] (3) Collect the cells by centrifugation at 5000 rpm for 10 min, resuspend the cells in 50 mL of 1 / 2MS liquid culture medium, and add 10 μL of Silwet to prepare the infection solution.

[0043] (4) Soak the Arabidopsis inflorescence to be transformed in step (1) in the infection solution prepared in step (3) for 25 seconds, and cover the infected plants with plastic wrap to maintain humidity. After culturing in the dark for 1 day, transfer to normal culture conditions.

[0044] (5) Repeat steps (2) to (4) one week later. When the seeds are fully mature, collect them and dry them in a 37°C oven for 2 days before proceeding to subsequent screening.

[0045] Embodiment 3

[0046] The Arabidopsis seeds harvested in Example 2 were subjected to positive plant identification and screening, and the specific steps were as follows:

[0047] (1) The seeds harvested in Example 2 were added to a 2 mL centrifuge tube, and then 75% ethanol was added. The tube was shaken vigorously for 3 min. After the supernatant was aspirated in a clean bench, the seeds were sterilized with 10% sodium hypochlorite solution for 5 min, centrifuged at 4000 rpm for 1 min, the solution was aspirated, and the seeds were rinsed twice with sterile water. The seeds were then spread on 1 / 2MS medium containing 50 mg / L Kan, cultured in the dark at 4°C for 2 d for vernalization, and then cultured under the conditions of 21°C, 55% relative humidity, and 16 h light / 8 h dark for two weeks.

[0048] (2) Transfer the plants that are growing normally to nutrient soil for further cultivation until the seeds mature, and harvest the seeds from each plant to obtain T1 generation seeds.

[0049] (3) Repeat step (1) for the seeds harvested from a single plant, and transfer the plants with normal growth to nutrient soil for further cultivation. During this period, ensure that the plants are in good growth condition to facilitate subsequent identification. Cultivate until the seeds are mature, and harvest the seeds from a single plant to obtain T2 generation seeds.

[0050] (4) Repeat steps (1) and (2) with the T2 generation seeds to obtain T3 generation plants. Transplant the T3 generation plants into nutrient soil for about two weeks and extract Arabidopsis leaf DNA using the CTAB method.

[0051] (5) The obtained DNA was used as a template, and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were used as primers. The 2xTaq Master Mix system of Nanjing Novozyme Biotechnology Co., Ltd. was used for PCR. The amplification program was: 95°C, 5 min; 95°C, 15 sec, 58°C, 15 sec, 72°C, 2 min 30 sec, 35 cycles; 72°C, 5 min. The results are shown in Figure 5. Figure 1 As shown, the plants that amplified bright bands were transgenic plants, where M was a marker, WT was a wild-type plant, and 1-8 were plants of different T3 generations.

[0052] Embodiment 4

[0053] The expression level of the positive T3 generation Arabidopsis plants obtained in Example 3 was analyzed, and the specific steps were as follows:

[0054] (1) Use SPARKeasy Improved Plant RNA Kit (Shandong Sparkeasy Biotechnology Co., Ltd.) to extract RNA from wild-type and positive seedling leaves according to the instructions.

[0055] (2) The obtained RNA was reverse transcribed into cDNA using TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Beijing Quanshijin Biotechnology Co., Ltd.).

[0056] (3) Semi-quantitative fluorescence quantitative PCR analysis was performed using the ACTIN2 gene as an internal reference. Figure 2 As shown, the two strains with the highest expression levels (OX-3 and OX-5) were selected for subsequent experiments.

[0057] Embodiment 5

[0058] The salt tolerance of the overexpression transgenic positive plants obtained in Example 4 was investigated, and the specific steps were as follows:

[0059] (1) The cells were grown in culture for 7 days. MsWRKY23 The overexpression plants and WT were transplanted into nutrient soil for cultivation. When they grew to 14 days old, they were watered with 150 mM NaCl. They were watered once every four days for a total of three times. Photos were taken after the third watering. The results are as follows: Figure 3 As shown, most leaves of the wild-type plants were yellowed to varying degrees, and the bolting period was earlier than that of the overexpression lines. The leaves of the two overexpression plants were only slightly yellowed, and the leaves were slightly bent toward the back.

[0060] (2) The salt-treated wild-type and overexpressed Arabidopsis leaves were cut and ground under liquid nitrogen. The catalase (CAT) activity detection kit (Beijing Solebow Technology Co., Ltd.) was used to determine the catalase of each Arabidopsis plant. The superoxide dismutase (SOD) activity detection kit (Beijing Solebow Technology Co., Ltd.) was used to determine the superoxide dismutase of each Arabidopsis plant. The peroxidase (POD) activity detection kit (Beijing Solebow Technology Co., Ltd.) was used to determine the activity of antioxidant enzymes such as peroxidase of each Arabidopsis plant. At the same time, the malondialdehyde (MDA) content detection kit (Beijing Solebow Technology Co., Ltd.) was used to determine the content of malondialdehyde, an indicator of the degree of peroxidation of each Arabidopsis plant. The results are as follows: Figure 4 As shown, after salt treatment, MsWRKY23 The enzyme activity of overexpressed Arabidopsis thaliana increased more than that of the wild type, and the MDA content was lower than that of the wild type.

[0061] Embodiment 6

[0062] The alkaline resistance of the overexpression transgenic positive plants obtained in Example 4 was investigated, and the specific steps were as follows:

[0063] (1) The cells were grown in culture for 7 days. MsWRKY23The overexpression plants and WT were transplanted into nutrient soil for cultivation. On the 14th day of growth, 125 mM NaHCO3 was watered every four days for a total of three times. Photos were taken after the third watering. The results are shown in the figure. Figure 5 As shown, compared with the wild type, the leaves of the two overexpression plants were slightly yellowed, and the number of plants with bolting was less, while after watering with alkaline water, most leaves of the wild type plants were yellowed to varying degrees, and the bolting period was earlier than that of the overexpression line.

[0064] (2) The wild-type and overexpressed Arabidopsis leaves after alkali treatment were cut and ground under liquid nitrogen, and the activities of MDA, CAT, SOD, and POD were measured using kits. The results are as follows: Figure 6 As shown, after alkali treatment MsWRKY23 The enzyme activity of overexpressed Arabidopsis thaliana increased to a higher degree, and the MDA content was lower than that of the wild type.

[0065] Embodiment 7

[0066] The drought tolerance of the overexpression transgenic positive plants obtained in Example 4 was investigated, and the specific steps were as follows:

[0067] (1) The cells were grown in culture for 7 days. MsWRKY23 The overexpression plants and WT were transplanted into nutrient soil for cultivation. Watering was stopped after 21 days of growth. The photos taken on the 12th day of drought were as follows: Figure 7 As shown in Figure 2, WT plants began to wilt and die. MsWRKY23 Only some leaves of the overexpressing plants withered slightly, and no phenotype of death appeared. After three days of rehydration, about 60% of the WT plants resumed growth, while MsWRKY23 All overexpressing plants recovered and grew well.

[0068] (2) The leaves of wild-type and overexpressed Arabidopsis thaliana after drought treatment were cut, ground under liquid nitrogen, and then the activities of MDA, CAT, SOD, and POD were measured using kits. The results are as follows: Figure 8 As shown, MsWRKY23 The enzyme activity of overexpressed Arabidopsis thaliana increased more than that of the wild type, and the MDA content was lower than that of the wild type. The increase in antioxidant enzyme activity can enhance MsWRKY23 The reactive oxygen scavenging ability in the overexpressing plants is improved, thereby improving the drought resistance of the overexpressing plants.

[0069] Therefore, Miscanthus MsWRKY23 The CDS sequence of the gene is shown in SEQ ID NO.1, and the overexpression of Miscanthus sinensis MsWRKY23 The gene can significantly increase the activity of the plant's SOD, CAT, and POD antioxidant enzymes, significantly reduce the MDA content, and thus significantly improve the plant's drought, salt, and alkali tolerance; MsWRKY23The genes can be used to cultivate new crop germplasm with greater tolerance to abiotic stresses and for ecological restoration of saline-alkali land.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Miscanthus MsWRKY23 The application of genes in improving the resistance of crops to abiotic stress is characterized by: Miscanthus sinensis MsWRKY23 The CDS sequence of the gene is shown in SEQ ID NO.1, the abiotic stress is saline-alkali stress and drought stress, and the crops are Arabidopsis thaliana and Miscanthus sinensis.

2. The Miscanthus sinensis according to claim 1 MsWRKY23 The application of genes in improving the resistance of crops to abiotic stress is characterized by: Miscanthus sinensis MsWRKY23 Genes can significantly improve the plant's tolerance to drought, salt and alkali.

3. The Miscanthus sinensis according to claim 1 MsWRKY23 The application of genes in improving the resistance of crops to abiotic stress is characterized by: Miscanthus sinensis MsWRKY23 The gene can significantly increase the activity of SOD, CAT, and POD antioxidant enzymes in plants and significantly reduce the MDA content.

4. The Miscanthus sinensis according to claim 1 MsWRKY23 The application of gene vectors and strains is characterized by: The application is for improving the ability of crops to resist abiotic stress, the vector is an overexpression vector, the strains include Escherichia coli and Agrobacterium, the abiotic stress is saline-alkali stress and drought stress, and the crops are Arabidopsis thaliana and Miscanthus sinensis.

Images