All-in-one POCT test kit, test tube and test system for 15 diarrhea pathogens

Abstract

The present invention "integrated POCT test kit, test tube and test system for detecting 15 diarrhea pathogens" belongs to the field of biomedical testing. The test kit includes: fecal sample pretreatment reagents and pathogen detection reagents; the fecal sample pretreatment reagents include: 1~4M guanidine salt, 20~200mM sodium citrate, 1~10% SDS by volume, 2~10% polidocanol by volume, 25~50% isopropanol by volume, etc., 10~30mg / mL nanocarbon, 10~30mg / mL zeolite powder; pathogen detection reagents include system A, system B, system C, and system D reagents. The present invention also provides a test tube and a test system based on the test kit. The present invention can not only detect 15 pathogens at the same time, but also achieve the purpose of integrated POCT detection with good repeatability of test results, large test sample size, high sensitivity, good specificity, good test timeliness, and sample-in and result-out.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical testing, and specifically relates to a kit, a test tube and a test system for detecting 15 diarrheal pathogens using an integrated POCT. Background Art

[0002] Diarrhea is a common gastrointestinal infectious disease that is prevalent around the world. Infectious diarrhea is a common disease, especially among children, causing a huge disease burden. In recent years, large-scale epidemics have occurred from time to time around the world, which has caused serious harm to public health security worldwide. Therefore, it is urgent to establish a method for real-time, multiple, simple and rapid detection of common diarrhea pathogens. At present, the traditional detection methods for diarrhea pathogens in clinical practice mainly include the following: (1) serological examination; (2) pathogen culture examination; (3) molecular biology detection. Serological examination, although simple and rapid, has low sensitivity and high false positive rate; pathogen culture requires professional personnel to operate and takes a long time to culture. Molecular biology mainly detects pathogen nucleic acid, and the mainstream detection method is PCR detection. PCR nucleic acid detection can take into account both sensitivity and specificity, but the detection process is complicated, the experimental site and instrument costs are high, and the requirements for detection personnel are high. Most of them are suitable for intensive detection in central hospitals.

[0003] At present, most of the fluorescent probe methods for nucleic acid detection of diarrhea pathogens used in clinics are kits for detecting a single pathogen, and cannot perform nucleic acid detection on multiple common diarrhea pathogens at the same time. In addition, the existing methods require different nucleic acid extraction methods for different types of pathogens such as viruses, bacteria, and parasites, which greatly increases the complexity of detection and the workload of operators.

[0004] Although the culture method for detecting diarrheal pathogens is the gold standard in clinical practice, it has problems such as long culture time, inability to provide timely diagnosis and treatment, or missed detection due to difficulty in culture. The establishment and operation costs of traditional molecular diagnostic laboratories are high, and professional laboratory personnel are required to perform experimental operations. The test samples need to be transported to the PCR laboratory for experimental analysis, and the test data cannot be provided immediately, with poor timeliness.

[0005] During an epidemic outbreak or in basic medical institutions, it is necessary for the market to have fast, simple, high-throughput, and instant detection reagents for multiple diarrheal pathogens. Not only can it provide diagnostic reference information to clinical medical personnel quickly and immediately, but it can also provide testing information to basic related institutions such as food safety and customs, allowing relevant epidemic prevention personnel to make immediate judgments.

[0006] Although there are existing technologies for multiplex PCR detection of multiple diarrheal pathogens, there are still the following problems to be solved:

[0007] 1. Because stool samples are special and contain more impurities, if they are not handled properly, the final test results may have problems such as low detection rate, insufficient sensitivity, and false positives.

[0008] 2. The original stool sample needs to be extracted for DNA and then transferred to the PCR system for testing. The intermediate transfer process will not only increase the operation time, but also increase the risk of sample contamination, resulting in inaccurate final test results.

[0009] 3. The original stool samples need to undergo pre-processing and DNA extraction, which are cumbersome, time-consuming and labor-intensive, and cannot be used for point-of-care testing (POCT).

[0010] 4. If there are multiple pathogens in the same stool sample, under the same detection system, due to the difference in the abundance of each pathogen, some pathogens may not be detected, the detection rate may be low, and the test results may be inaccurate.

[0011] Therefore, there is an urgent need in the art to develop a new product that can detect multiple diarrheal pathogens using an integrated POCT system that does not require an intermediate transfer process and has sample-in and result-out capabilities. Summary of the invention

[0012] In order to solve the problems existing in the prior art such as low detection rate, insufficient sensitivity, easy sample contamination, inaccurate test results, etc. caused by improper stool sample handling and intermediate transfer operations, the present invention provides an integrated POCT kit, a test tube and a detection system for detecting 15 diarrheal pathogens.

[0013] The technical solution of the present invention is as follows:

[0014] An integrated POCT kit for detecting 15 diarrhea pathogens, characterized in that it comprises: a stool sample pretreatment reagent and a pathogen detection reagent; the stool sample pretreatment reagent comprises: 1~4M guanidine salt, 20~200 mM sodium citrate, 1~10% SDS by volume, 2~10% polidocanol by volume, 25~50% isopropanol by volume, 10~30 mg / mL nanocarbon, and 10~30 mg / mL zeolite powder;

[0015] The pathogen detection reagents for the 15 diarrheal pathogens include system A reagents, system B reagents, system C reagents, and system D reagents;

[0016] System A reagents include:

[0017] Primers and probes for amplifying Salmonella whose sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 3,

[0018] Primers and probes for amplifying Campylobacter with sequences as shown in SEQ ID NO. 4 to SEQ ID NO. 6,

[0019] Primers and probes for amplifying Escherichia coli O157 whose sequences are shown in SEQ ID NO. 7 to SEQ ID NO. 9;

[0020] System B reagents include:

[0021] Primers and probes for amplifying Yersinia enterocolitica having sequences as shown in SEQ ID NO. 10 to SEQ ID NO. 12,

[0022] Primers and probes for amplifying the gene encoding Clostridium difficile toxin A in Clostridium difficile, whose sequences are shown in SEQ ID NO. 13-SEQ ID NO. 15,

[0023] Primers and probes for amplifying the gene encoding Clostridium difficile toxin B in Clostridium difficile, whose sequences are shown in SEQ ID NO. 16-SEQ ID NO. 18,

[0024] Primers and probes for amplifying enterotoxigenic Escherichia coli with sequences as shown in SEQ ID NO. 19 to SEQ ID NO. 24;

[0025] System C reagents include:

[0026] Primers and probes for amplifying toxin-producing Escherichia coli with sequences as shown in SEQ ID NO. 25-SEQ ID NO. 27,

[0027] Primers and probes for amplifying enteroinvasive Escherichia coli having sequences as shown in SEQ ID NO. 28 to SEQ ID NO. 30,

[0028] Primers and probes for amplifying Vibrio cholerae whose sequences are shown in SEQ ID NO. 31-SEQ ID NO. 33,

[0029] Primers and probes for amplifying Vibrio parahaemolyticus having sequences as shown in SEQ ID NO. 34 to SEQ ID NO. 36,

[0030] Primers and probes for amplifying Vibrio vulnificus having sequences as shown in SEQ ID NO. 37-SEQ ID NO. 39,

[0031] System D reagents include:

[0032] Primers and probes for amplifying adenovirus 40 / 41 whose sequences are shown in SEQ ID NO. 40-SEQ ID NO. 42,

[0033] Primers and probes for amplifying rotavirus whose sequences are shown in SEQ ID NO. 43-SEQ ID NO. 45,

[0034] Primers and probes for amplifying Norovirus GI whose sequences are shown in SEQ ID NO. 46-SEQ ID NO. 48,

[0035] Primers and probes for amplifying norovirus GII whose sequences are shown in SEQ ID NO. 49-SEQ ID NO. 51,

[0036] The sequences of primers and probes for amplifying Shigella are shown in SEQ ID NO. 52 to SEQ ID NO. 54.

[0037] The stool sample pretreatment reagents include: 3M guanidine salt, 50 mM sodium citrate, 5% SDS by volume, 5% polidocanol by volume, 30% isopropanol by volume, 10 mg / mL nanocarbon, and 10 mg / mL zeolite powder;

[0038] Preferably, the diameter of the nanocarbon is 20-50 nm; the diameter of the zeolite powder is 20-50 nm.

[0039] The integrated POCT kit for detecting 15 diarrheal pathogens further comprises: an internal standard reagent; the internal standard reagent refers to: primers and probes for amplifying bacteriophage MS2 with sequences as shown in SEQ ID NO. 55-SEQ ID NO. 57;

[0040] Preferably, the reagents of system A, system B, system C and system D all contain the internal standard reagent; the internal standard reagent is used to monitor extraction and amplification;

[0041] Preferably, the pathogen detection reagent also includes: RNase inhibitor, sodium chloride, tris(hydroxymethyl)aminomethane (Tris)-pH buffer, deoxyribonucleoside triphosphate, hot start DNA polymerase, hot start reverse transcriptase, uracil-DNA glycosylase, bovine serum albumin, DMSO, glycerol, formamide, and ammonium sulfate.

[0042] The integrated POCT kit for detecting 15 diarrheal pathogens further comprises: a nucleic acid extraction reagent; the nucleic acid extraction reagent comprises: 4M guanidine isothiocyanate, 50mM sodium citrate, 2% Tween-20 by volume, 5% Triton X-100 by volume, 50% isopropanol by volume, 5000 copies / mL of MS2 bacteriophage and 50 mg / mL silicon hydroxy magnetic beads;

[0043] Preferably, the 5' end of the probe is connected to a fluorescent marker, and the 3' end is connected to a fluorescent quencher;

[0044] Preferably, the fluorescent marker is selected from: FAM, HEX, ROX, CY5;

[0045] Preferably, the fluorescence quencher is selected from: BHQ1, BHQ2, BHQ3.

[0046] An integrated POCT detection tube for detecting 15 diarrhea pathogens, wherein the detection tube is provided with, from top to bottom: a sample pretreatment area, a nucleic acid cleavage binding area and an intra-tube channel; the sample pretreatment area and the nucleic acid cleavage binding area are located in the upper part of the internal cavity of the tube body of the detection tube; 4 mutually independent intra-tube channels are provided at the lower part of the nucleic acid cleavage binding area; each intra-tube channel is provided with, from top to bottom: a nucleic acid magnetic bead cleaning area, a reagent pre-embedded area, and a nucleic acid elution and amplification area; a first plug body is provided at the top of the nucleic acid magnetic bead cleaning area; a gap is provided between the outer wall of the periphery of the first plug body and the inner wall of the intra-tube channel for the magnetic beads to pass through; the angle between the outer wall of the gap and the inner wall of the intra-tube channel is 6°-8°; the pathogen detection reagent of the test kit is pre-embedded in the reagent pre-embedded area.

[0047] In some embodiments, a nucleic acid extraction reagent is pre-buried in the nucleic acid cleavage binding region 2;

[0048] The sample pretreatment area and the nucleic acid lysis and binding area are separated by a filter membrane;

[0049] Preferably, a second plug body is provided at the top of the reagent pre-embedded area, and a gap is provided between the outer wall of the second plug body and the inner wall of the tube channel for the magnetic beads to pass through; the angle between the outer wall of the gap and the inner wall of the tube channel is 6°-8°.

[0050] The angle between the outer wall of the gap and the inner wall of the channel in the tube is 7°;

[0051] In the present invention, the setting of the above two angles is a key means to ensure that the magnetic beads pass smoothly with optimal efficiency and ensure the final detection effect.

[0052] Preferably, the first plug body is arranged at the upper part of each inner channel of the tube; the second plug body is arranged at the middle part of each inner channel of the tube;

[0053] The cleavage and binding area is pre-buried with the nucleic acid extraction reagent of the kit;

[0054] Preferably, the nucleic acid magnetic bead cleaning area is pre-buried with a cleaning reagent; the cleaning reagent comprises: 30mM Tis-HCl, 20mM EDTA, 200mM NaCl, 1% ammonium aluminum sulfate, 50% PEG6000;

[0055] Preferably, the cleaning reagent has a pH of 5.5;

[0056] Preferably, the reagent pre-embedded area is also pre-embedded with an elution reagent; the elution reagent includes: 10mM Tis-HCl, 50mM KCl, 15mM MgSO4, 0.1% Triton-100, 0.1% tetramethylammonium chloride;

[0057] Preferably, the elution reagent has a pH of 8.5.

[0058] An integrated POCT detection system for detecting 15 diarrheal pathogens comprises: the detection tube and the PCR analyzer.

[0059] The PCR analyzer comprises: a temperature adjustment component, a main circuit, and a cover detection sensor, a control unit, a magnetic bead drag component, and a fluorescent channel component arranged in sequence on the main circuit; the magnetic bead drag component comprises a magnetic steel arm that can move along the axial direction of the detection tube; the control unit monitors the cover flip signal input by the cover detection sensor and outputs a first branch after monitoring the timing ≥ pre-processing time; the first branch is connected to the temperature adjustment component;

[0060] The control unit monitors the temperature signal input by the temperature sensor to be lower than the pyrolysis temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the pyrolysis temperature and outputs it to the downstream magnetic bead dragging component after the monitoring timing is greater than or equal to the pyrolysis time;

[0061] The control unit monitors the magnetic steel arm movement time input by the magnetic bead dragging component, and when the magnetic steel arm movement time is ≥ the magnetic bead dragging threshold time I and 0 mm ≤ the magnetic steel arm movement distance and ≤ 50 mm, the output is returned to the magnetic bead dragging component;

[0062] The control unit monitors the magnetic steel arm movement time input by the magnetic bead dragging component, and outputs the first branch when the magnetic steel arm movement time is ≥ the magnetic bead dragging threshold time II and 30 mm ≤ the magnetic steel arm movement distance and ≤ 44 mm;

[0063] The control unit monitors the temperature signal input by the temperature sensor to be lower than the pre-denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the pre-denaturation temperature and outputs the first branch after the monitoring timing is greater than or equal to the pre-denaturation time;

[0064] The control unit monitors the temperature signal input by the temperature sensor to be lower than the denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the denaturation temperature and outputs the first branch after the monitoring timing is greater than or equal to the denaturation time;

[0065] The control unit monitors the temperature signal input by the temperature sensor to be higher than the annealing extension temperature and controls the temperature of the refrigeration zone of the temperature regulating component to drop to the annealing temperature and outputs the second branch after the monitoring timing is greater than or equal to the annealing time; the second branch is connected to the counting device;

[0066] The counting device returns the counting signal to the control unit on the main line;

[0067] The control unit monitors that the count signal is less than the cycle threshold and the temperature signal input by the monitoring temperature sensor is lower than the denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the denaturation temperature and the monitoring timing is greater than the denaturation time, and then outputs the first branch;

[0068] The control unit monitors the counting signal ≥ cycle number threshold and outputs it to the fluorescent channel component downstream of the main path.

[0069] Preferably, the PCR analyzer further comprises: a housing and a flip cover assembly;

[0070] Preferably, the flip cover assembly comprises: a flip cover base, a flip cover, a flip cover detection sensor and a flip cover indicator light;

[0071] Preferably, the temperature adjustment component comprises: a temperature sensor, a detection cavity, and a heating area and a cooling area arranged outside the detection cavity;

[0072] Preferably, the temperature sensor is connected to the detection cavity, the heating area, and the cooling area respectively via a data path;

[0073] Preferably, the shape and size of the internal space of the detection cavity are compatible with the shape and size of the exterior of the detection tube;

[0074] Preferably, the temperature adjustment component, the main circuit, and the flip detection sensor, the control unit, the magnetic bead dragging component, and the fluorescent channel component sequentially arranged on the main circuit are arranged inside the housing;

[0075] Preferably, the cycle number threshold is ≥23 and ≤45;

[0076] Preferably, the pre-treatment time is ≤5min;

[0077] Preferably, the lysis time is ≤10 min,

[0078] Preferably, the magnetic bead dragging threshold time I≤5min;

[0079] Preferably, the magnetic bead dragging threshold time II is ≤3 min;

[0080] Preferably, the pre-denaturation temperature is 95°C and the pre-denaturation time is ≤15s;

[0081] Preferably, the denaturation temperature is 95°C and the denaturation time is ≤30s;

[0082] Preferably, the annealing temperature is 60° C. and the annealing time is ≤30 s.

[0083] The beneficial effects of the present invention are:

[0084] According to the particularity of fecal samples, the present invention develops a pretreatment reagent specifically for fecal samples, which can pre-treat fecal samples well and retain the pathogens therein intact, and at the same time cooperate with the filter membrane to remove most of the insoluble particles in the feces and filter the pathogens to the nucleic acid cleavage and binding area of ​​the detection tube. In this area, the pathogen nucleic acid can be cleaved and released and enter the nucleic acid magnetic bead cleaning area of ​​the detection tube. In the reagent pre-embedded area of ​​the detection tube, enzymes and 15 diarrhea pathogen detection probe primers and other reaction reagents are pre-fixed in this area by freeze-drying process. The detection reagent tube of the present invention is provided with four channels, namely A, B, C, and D channels, for different detection systems. Multiple hydrophobic separation layers isolate the lysate, cleaning solution and reaction solution. At the same time, combined with the fully automatic medical PCR analyzer recorded in Chinese patent application 202210601588.0, and on this basis, the control unit is optimized to form an accurate and scientific POCT detection system, which can heat the detection tube in the corresponding step, and the extract in the cleavage area cleaves the sample at high temperature and releases the nucleic acid. Through the magnetic guide of the analyzer, the sample nucleic acid passes through different liquid layers, and after the steps of enrichment, cleaning, storage and elution, it undergoes an amplification reaction with the pre-buried amplification reagent at the bottom. The present invention realizes "one-tube" nucleic acid analysis, and seals the steps of sample processing, lysis, cleaning, elution and amplification in the same closed tube, thereby realizing efficient and complete nucleic acid detection and analysis, and achieving the goal of integrated and automated sample detection to result presentation.

[0085] According to the summary of clinical experiments at Peking Union Medical College Hospital, the present invention covers 15 pathogens, all of which are common clinical detection targets. In addition, the present invention is applicable to a wide range of sample types, and with a special sample pretreatment solution, it can cover various stool types, including solid and liquid. This diversity can fully meet the needs of clinical testing. It only takes 53 minutes from the test to the result. Its high detection sensitivity and excellent specificity allow medical professionals to quickly obtain test result reports.

[0086] The present invention designs several sets of primer probes with high accuracy, specificity (uniqueness), sensitivity, stability and repeatability for 15 common pathogens in clinical testing practice, and combines the control of the detection tube with a new structure and the detection system to realize the integrated POCT detection of 15 common clinical pathogens, truly achieving sample in, result out, and greatly saving the detection time while ensuring the detection rate, accuracy, specificity (uniqueness), sensitivity, stability and repeatability, and overcoming the difficulty of detection system integration;

[0087] The test reagent tube can simultaneously process and detect 15 pathogens, including bacteria, viruses (DNA, RNA) and other pathogens. The present invention divides bacteria into three channels and viruses into one channel. The RNA degradation problem is overcome between different pathogens in the stages of sample processing, lysis, washing area, elution and amplification;

[0088] Accuracy tests were performed on the 15 pathogens before and after integration. After amplification of each pathogen using a single system and comparison with the integrated system, it was found that the integration system did not affect the amplification of the strain nucleic acid. Under the same conditions, the detection rate and detection accuracy of each pathogen single system amplification and integrated system were consistent, and the experimental repeatability was good.

[0089] 15 pathogens plus internal standard bacteriophage MS-2 nucleic acid (pathogen concentration 1×10 6 The specificity of the test tubes was verified by using 41 intestinal bacteria, and the results of the cross-test showed that the specificity of each detection system was good. The test tubes of the present invention have good stability, accelerated stability, and can be stored for at least 3 months. The temperature storage conditions are low, and more application scenarios can be provided.

[0090] The integrated POCT test kit and test tube for detecting 15 diarrhea pathogens provided by the present invention adopts the design of an integrated test tube, and functions such as sample processing, nucleic acid extraction, and nucleic acid amplification detection are all performed in a closed test tube. By dividing the 15 intestinal diarrhea pathogens into four channels for detection, while achieving simultaneous detection of 15 pathogens, the experimental test results have good repeatability, large test sample volume, high sensitivity, good specificity, good test timeliness, and sample-in, result-out, and have excellent market value. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 is a schematic structural diagram of a detection tube provided by an embodiment of the present invention;

[0092] Figure 2 is a schematic side view of the structure of a detection tube provided by another embodiment of the present invention;

[0093] The meanings of the marks in the figure are listed as follows: 1-sample pre-treatment area, 2-nucleic acid lysis and binding area, 3-nucleic acid magnetic bead cleaning area, 4-reagent pre-embedding area, 5-nucleic acid elution and amplification area. DETAILED DESCRIPTION

[0094] The present invention is described in detail below with reference to the accompanying drawings, specific embodiments and experimental examples, but the protection scope of the present invention is not limited thereto.

[0095] Sources of biological materials

[0096] 1. The 15 pathogen plasmid DNA templates used in Experimental Example 1 were synthesized by Shanghai Bioengineering. Bacteriophage MS2 was purchased from Beina Biotechnology.

[0097] 2. The stool samples used in Experimental Examples 2 and 3 were from Peking Union Medical College Hospital.

[0098] 3. The Escherichia coli O157, Salmonella, Campylobacter, enterotoxigenic Escherichia coli, Yersinia enterocolitica, Clostridium difficile toxin A, Clostridium difficile toxin B, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, toxin-producing Escherichia coli, Shigella, enteroinvasive Escherichia coli, Norovirus GI, Norovirus GII, adenovirus 40 / 41, and rotavirus used in Experimental Examples 4, 5, 7, 8, and 9 were purchased from ATCC or BeinaBio.

[0099] 4. Experimental Example 6 used Acinetobacter baumannii, Anaerobic Coccus prevotii, Bacteroides fragilis, Citrobacter freundii, Clostridium sordellii, Eggertella tarda, Enterobacter cloacae, Enterococcus foetida, Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Escherichia coli, Fusobacterium necroticum, Helicobacter pylori, Klebsiella pneumoniae, Lactobacillus jensenii, Listeria monocytogenes, Micrococcus luteus, Morganella morganii, Anaerobic Peptostreptococcus, Shigella-like Oligomonas, Common oral bacteria The sources of Proteus, Proteus mirabilis, Proteus vulgaris, Providencia alcaligenes, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida, Serratia marcescens, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus pyogenes, astrovirus, coxsackievirus, echovirus, double echovirus, Zaruvirus, and Candida albicans are shown in Table 13, all of which are commercially available.

[0100] 5. The stool samples of Experimental Example 10 were from Peking Union Medical College Hospital.

[0101] The first group of embodiments, the kit of the present invention

[0102] This group of embodiments provides an integrated POCT kit for detecting 15 diarrhea pathogens. All embodiments in this group have the following common features: the integrated POCT kit for detecting 15 diarrhea pathogens includes: a stool sample pretreatment reagent and a pathogen detection reagent; the stool sample pretreatment reagent includes: 1~4M guanidine salt, 20~200 mM sodium citrate, 1~10% SDS by volume, 2~10% polidocanol by volume, 25~50% isopropanol by volume, 10~30 mg / mL nanocarbon, 10~30 mg / mL zeolite powder;

[0103] The pathogen detection reagents for the 15 diarrheal pathogens include system A reagents, system B reagents, system C reagents, and system D reagents;

[0104] System A reagents include:

[0105] Primers and probes for amplifying Salmonella whose sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 3,

[0106] Primers and probes for amplifying Campylobacter with sequences as shown in SEQ ID NO. 4 to SEQ ID NO. 6,

[0107] Primers and probes for amplifying Escherichia coli O157 whose sequences are shown in SEQ ID NO. 7 to SEQ ID NO. 9;

[0108] System B reagents include:

[0109] Primers and probes for amplifying Yersinia enterocolitica having sequences as shown in SEQ ID NO. 10 to SEQ ID NO. 12,

[0110] Primers and probes for amplifying the gene encoding Clostridium difficile toxin A in Clostridium difficile, whose sequences are shown in SEQ ID NO. 13-SEQ ID NO. 15,

[0111] Primers and probes for amplifying the gene encoding Clostridium difficile toxin B in Clostridium difficile, whose sequences are shown in SEQ ID NO. 16-SEQ ID NO. 18,

[0112] Primers and probes for amplifying enterotoxigenic Escherichia coli with sequences as shown in SEQ ID NO. 19 to SEQ ID NO. 24;

[0113] System C reagents include:

[0114] Primers and probes for amplifying toxin-producing Escherichia coli with sequences as shown in SEQ ID NO. 25-SEQ ID NO. 27,

[0115] Primers and probes for amplifying enteroinvasive Escherichia coli having sequences as shown in SEQ ID NO. 28 to SEQ ID NO. 30,

[0116] Primers and probes for amplifying Vibrio cholerae whose sequences are shown in SEQ ID NO. 31-SEQ ID NO. 33,

[0117] Primers and probes for amplifying Vibrio parahaemolyticus having sequences as shown in SEQ ID NO. 34 to SEQ ID NO. 36,

[0118] Primers and probes for amplifying Vibrio vulnificus having sequences as shown in SEQ ID NO. 37-SEQ ID NO. 39,

[0119] System D reagents include:

[0120] Primers and probes for amplifying adenovirus 40 / 41 whose sequences are shown in SEQ ID NO. 40-SEQ ID NO. 42,

[0121] Primers and probes for amplifying rotavirus whose sequences are shown in SEQ ID NO. 43-SEQ ID NO. 45,

[0122] Primers and probes for amplifying Norovirus GI whose sequences are shown in SEQ ID NO. 46-SEQ ID NO. 48,

[0123] Primers and probes for amplifying norovirus GII whose sequences are shown in SEQ ID NO. 49-SEQ ID NO. 51,

[0124] The sequences of primers and probes for amplifying Shigella are shown in SEQ ID NO. 52 to SEQ ID NO. 54.

[0125] In some embodiments, the stool sample pretreatment reagent includes: 3M guanidine salt, 50 mM sodium citrate, 5% SDS by volume, 5% polidocanol by volume, 30% isopropanol by volume, 10 mg / mL nanocarbon, and 10 mg / mL zeolite powder;

[0126] Preferably, the diameter of the nanocarbon is 20-50 nm; the diameter of the zeolite powder is 20-50 nm.

[0127] In a further embodiment, the integrated POCT kit for detecting 15 diarrheal pathogens further comprises: an internal standard reagent; the internal standard reagent refers to: primers and probes for amplifying bacteriophage MS2 whose sequences are shown in SEQ ID NO. 55-SEQ ID NO. 57;

[0128] Preferably, the reagents of system A, system B, system C and system D all contain the internal standard reagent; the internal standard reagent is used to monitor extraction and amplification;

[0129] Preferably, the pathogen detection reagent also includes: RNase inhibitor, sodium chloride, tris(hydroxymethyl)aminomethane (Tris)-pH buffer, deoxyribonucleoside triphosphate (dNTP), hot start DNA polymerase, hot start reverse transcriptase, uracil-DNA glycosylase (UDG), bovine serum albumin, DMSO, glycerol, formamide, and ammonium sulfate.

[0130] In a further embodiment, the integrated POCT kit for detecting 15 diarrheal pathogens further comprises: a nucleic acid extraction reagent; the nucleic acid extraction reagent comprises: 4M guanidine isothiocyanate, 50mM sodium citrate, 2% Tween-20, 5% Triton X-100, 50% isopropanol, MS2 bacteriophage at a concentration of 5000 copies / mL and 15μL silicon hydroxy magnetic beads (50 mg / mL);

[0131] Preferably, the 5' end of the probe is connected to a fluorescent marker, and the 3' end is connected to a fluorescent quencher;

[0132] Preferably, the fluorescent marker is selected from: FAM, HEX, ROX, CY5;

[0133] Preferably, the fluorescence quencher is selected from: BHQ1, BHQ2, BHQ3.

[0134] The second group of embodiments, the detection tube of the present invention

[0135] This group of embodiments provides an integrated POCT detection tube for detecting 15 diarrhea pathogens. All embodiments of this group have the following common features: the detection tube is provided with: sample pretreatment area, nucleic acid cleavage and binding area and tube channel from top to bottom; the sample pretreatment area and nucleic acid cleavage and binding area are located in the upper part of the internal cavity of the tube body of the detection tube; 4 independent tube channels are provided at the lower part of the nucleic acid cleavage and binding area; each tube channel is provided with: nucleic acid magnetic bead cleaning area, reagent pre-embedded area, nucleic acid elution and amplification area from top to bottom; a first plug body is provided at the top of the nucleic acid magnetic bead cleaning area; a gap is provided between the outer wall of the periphery of the first plug body and the inner wall of the tube channel for magnetic beads to pass through; the angle between the outer wall of the gap and the inner wall of the tube channel is 6°-8°; the pathogen detection reagent of the test kit described in any one of claims 1-4 is pre-embedded in the reagent pre-embedded area.

[0136] In some embodiments, a nucleic acid extraction reagent is pre-buried in the nucleic acid cleavage binding region 2;

[0137] In a specific embodiment, the sample pretreatment area and the nucleic acid cleavage and binding area are separated by a filter membrane;

[0138] Preferably, a second plug body is provided at the top of the reagent pre-embedded area, and a gap is provided between the outer wall of the second plug body and the inner wall of the tube channel for the magnetic beads to pass through; the angle between the outer wall of the gap and the inner wall of the tube channel is 6°-8°.

[0139] In some specific embodiments, the filter membrane is purchased from Shanghai Shenggong Company, item number: F513135, specification: 0.80 μm, MCE, 25 mm, water system; the filter membrane can filter larger particles in feces, mainly unabsorbed food residues, while ensuring that pathogens can pass through the filter membrane and enter the lysis and binding area below.

[0140] In a more specific embodiment, the angle between the outer wall of the gap and the inner wall of the channel in the tube is 7°;

[0141] Preferably, the first plug body is arranged at the upper part of each inner channel of the tube; the second plug body is arranged at the middle part of each inner channel of the tube;

[0142] In other embodiments, the cleavage and binding region is pre-buried with a nucleic acid extraction reagent of the kit described in any one of the first group of embodiments;

[0143] Preferably, the nucleic acid magnetic bead cleaning area is pre-buried with a cleaning reagent; the cleaning reagent comprises: 30mM Tis-HCl, 20mM EDTA, 200mM NaCl, 1% ammonium aluminum sulfate, 50% PEG6000;

[0144] Preferably, the pH of the cleaning reagent is 5.5; the ammonium aluminum sulfate in the cleaning reagent can specifically remove humic acid impurities in the stool sample;

[0145] Preferably, the reagent pre-embedded area is also pre-embedded with an elution reagent; the elution reagent includes: 10mM Tis-HCl, 50mM KCl, 15mM MgSO4, 0.1% Triton-100, 0.1% tetramethylammonium chloride;

[0146] Preferably, the pH of the elution reagent is 8.5; and the tetramethylammonium chloride is an effective PCR enhancer that can significantly improve the sensitivity of the system.

[0147] The third group of embodiments, the detection system of the present invention

[0148] This group of embodiments provides an integrated POCT detection system for detecting 15 diarrhea pathogens. All embodiments in this group have the following common features: the integrated POCT detection system for detecting 15 diarrhea pathogens includes: the detection tube and PCR analyzer described in any one of the first group of embodiments.

[0149] In a specific embodiment, the PCR analyzer includes: a temperature control component, a main circuit, and a cover detection sensor, a control unit, a magnetic bead drag component, and a fluorescent channel component arranged in sequence on the main circuit; the magnetic bead drag component includes a magnetic steel arm that can move along the axial direction of the detection tube; the control unit monitors the cover flip signal input by the cover detection sensor and outputs a first branch after monitoring the timing ≥ pre-processing time; the first branch is connected to the temperature control component;

[0150] The control unit monitors the temperature signal input by the temperature sensor to be lower than the pyrolysis temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the pyrolysis temperature and outputs it to the downstream magnetic bead dragging component after the monitoring timing is greater than or equal to the pyrolysis time;

[0151] The control unit monitors the magnetic arm movement time input by the magnetic bead dragging component and the output is returned to the magnetic bead dragging component when the magnetic arm movement time is ≥ the magnetic bead dragging threshold time I and 0 mm ≤ the magnetic arm movement distance and ≤ 50 mm; the magnetic arm movement distance refers to the distance that the magnetic arm moves downward from the initial position of the nucleic acid magnetic bead cleaning area 3 of the corresponding detection tube.

[0152] The control unit monitors the magnetic steel arm movement time input by the magnetic bead dragging component, and outputs the first branch when the magnetic steel arm movement time is ≥ the magnetic bead dragging threshold time II and 30 mm ≤ the magnetic steel arm movement distance and ≤ 44 mm;

[0153] The control unit monitors the temperature signal input by the temperature sensor to be lower than the pre-denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the pre-denaturation temperature and outputs the first branch after the monitoring timing is greater than or equal to the pre-denaturation time;

[0154] The control unit monitors the temperature signal input by the temperature sensor to be lower than the denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the denaturation temperature and outputs the first branch after the monitoring timing is greater than or equal to the denaturation time;

[0155] The control unit monitors the temperature signal input by the temperature sensor to be higher than the annealing extension temperature and controls the temperature of the refrigeration zone of the temperature regulating component to drop to the annealing temperature and outputs the second branch after the monitoring timing is greater than or equal to the annealing time; the second branch is connected to the counting device;

[0156] The counting device returns the counting signal to the control unit on the main line;

[0157] The control unit monitors that the count signal is less than the cycle threshold and the temperature signal input by the monitoring temperature sensor is lower than the denaturation temperature and controls the temperature of the heating zone of the temperature regulating component to rise to the denaturation temperature and the monitoring timing is greater than the denaturation time, and then outputs the first branch;

[0158] The control unit monitors the counting signal ≥ cycle number threshold and outputs it to the fluorescent channel component downstream of the main path.

[0159] In a further embodiment, the PCR analyzer further comprises: a housing and a flip cover assembly;

[0160] Preferably, the flip cover assembly comprises: a flip cover base, a flip cover, a flip cover detection sensor and a flip cover indicator light;

[0161] Preferably, the temperature adjustment component comprises: a temperature sensor, a detection cavity, and a heating area and a cooling area arranged outside the detection cavity;

[0162] Preferably, the temperature sensor is connected to the detection cavity, the heating area, and the cooling area respectively via a data path;

[0163] Preferably, the shape and size of the internal space of the detection cavity are compatible with the shape and size of the exterior of the detection tube;

[0164] Preferably, the temperature adjustment component, the main circuit, and the flip detection sensor, the control unit, the magnetic bead dragging component, and the fluorescent channel component sequentially arranged on the main circuit are arranged inside the housing;

[0165] Preferably, the cycle number threshold is ≥23 and ≤45;

[0166] Preferably, the pre-treatment time is ≤5min;

[0167] Preferably, the lysis time is ≤10 min,

[0168] Preferably, the magnetic bead dragging threshold time I≤5min;

[0169] Preferably, the magnetic bead dragging threshold time II is ≤3 min;

[0170] Preferably, the pre-denaturation temperature is 95°C and the pre-denaturation time is ≤15s;

[0171] Preferably, the denaturation temperature is 95°C and the denaturation time is ≤30s;

[0172] Preferably, the annealing temperature is 60° C. and the annealing time is ≤30 s.

[0173] In a specific embodiment, the connection relationship and structure of the flip base, flip, flip detection sensor and flip indicator light of the flip assembly can refer to the specific contents recorded in the published text of Chinese patent application 202210601588.0.

[0174] In some embodiments, the connection relationship and structure between the detection cavity of the temperature control component and the heating zone and the cooling zone arranged outside the detection cavity can refer to the specific contents recorded in the published text of Chinese patent application 202210601588.0.

[0175] In some embodiments, the connection relationship and structure of the control unit, magnetic bead dragging component, and fluorescent channel component can refer to the specific contents of the control module, magnetic bead dragging component, and fluorescent channel component recorded in the published text of Chinese patent application 202210601588.0.

[0176] In the most specific embodiment, the multiplex PCR combined detection kit for 15 intestinal diarrhea pathogens is composed as follows:

[0177] (1) Detection reagent tube: RNase inhibitor, sodium chloride, tris(hydroxymethyl)aminomethane (Tris)-pH buffer, specific primers, probe, deoxyribonucleoside triphosphate (dNTP), hot-start DNA polymerase, hot-start reverse transcriptase, uracil-DNA glycosylase (UDG).

[0178] The detection reagent tube includes: a sample processing area 1, a lysis and nucleic acid binding magnetic bead area 2, a nucleic acid and magnetic bead cleaning area (first plug body) 3, a reagent pre-embedded area (second plug body) 4, a nucleic acid elution and amplification area 5, and guides the magnetic beads to each area through external magnetic force (the schematic diagram of the detection reagent tube is shown in FIG. Figure 1 );

[0179] Sample pretreatment area 1: This area is separated by a filter membrane (Shanghai Shenggong, catalog number: F513135). The filter membrane can intercept larger solid insoluble particles, mainly undigested food residues, and pathogens can pass through the filter membrane to the lower layer;

[0180] Nucleic acid lysis and binding area 2, this area destroys the cell structure in the biological sample through external heating and chemical methods to release DNA and RNA nucleic acids, and efficiently and selectively binds nucleic acids through magnetic beads to separate magnetic beads-nucleic acids from mixed samples, and optimizes the process of formula optimization to reduce RNA nucleic acid lysis during lysis. Then, through the guidance of external magnetic force, the magnetic strain-nucleic acid is magnetically guided to the nucleic acid and cleaning area.

[0181] In the nucleic acid magnetic bead cleaning area 3, the magnetic beads-nucleic acid are magnetically guided to the nucleic acid and cleaning area for cleaning. The conditions include cleaning temperature, time, and frequency, and the non-binding substances or PCR liquid substances are cleaned. In order to avoid the degradation of nucleic acid RNA and DNA in the cleaning solution, a nucleic acid degradation inhibitor is added to the cleaning solution. The magnetic beads-nucleic acid are magnetically guided to the reagent pre-embedded area.

[0182] Reagent pre-embedded area 4, the pathogen detection is based on the results of clinical research and investigation of Peking Union Medical College Hospital, and multiple pathogens related to common diarrhea in clinical practice are selected for detection. The magnetic beads-nucleic acid magnetic force is guided to the nucleic acid elution and amplification area.

[0183] Nucleic acid elution amplification zone 5, magnetic beads-nucleic acid to this area, the nucleic acid is eluted and amplified. The amplification system includes PCR enhancers (bovine serum albumin, DMSO, glycerol, formamide, ammonium sulfate, etc.) and uses hot start enzymes to achieve rapid PCR, and the detection sensitivity is high. The above-mentioned PCR enhancer: 0.1~0.5 mg / mL bovine serum albumin, 2.5~10% DMSO, 5~15% glycerol, 5~10% formamide, 3~12% ammonium sulfate; as a preferred, 0.125 mg / mL bovine serum albumin, 3% DMSO, 6% glycerol, 6% formamide, 4% ammonium sulfate.

[0184] There are multiple groups; as a preferred embodiment, 4 groups are provided for 15 intestinal diarrhea pathogens; the 4 groups are respectively provided with a first group of bacterial PCR detection reagents, a second group of bacterial PCR detection reagents, a third group of bacterial PCR detection reagents, and a fourth group of viral PCR detection reagents.

[0185] (2) DNA & RNA extraction reagents: 4 M guanidine thiocyanate, 50 mM sodium citrate, 2% Tween-20, 5% Triton X-100, 50% isopropanol, 5000 copies / mL of MS2 bacteriophage, and 15 μL of silanol magnetic beads (50 mg / mL).

[0186] (3) Sample pretreatment solution; the components include: 1~4M guanidine salt, 20~200 mM sodium citrate, 1~10% SDS, 2~10% polidocanol, 25~50% isopropanol, 10~30 mg / mL nanocarbon (diameter size 20~50 nm), 10~30 mg / mL zeolite powder (diameter size 20~50 nm); as a preferred solution, 3M guanidine salt, 50 mM sodium citrate, 5% SDS, 5% polidocanol, 30% isopropanol, 10 mg / mL nanocarbon, 10 mg / mL zeolite powder.

[0187] (4) Positive control: The positive control is a mixture of 12 plasmids; the mixed plasmids include 12 pathogen target genes such as Escherichia coli O157, Salmonella, Campylobacter, enterotoxigenic Escherichia coli, Yersinia enterocolitica, Clostridium difficile toxin, Vibrio parahaemolyticus, Shiga toxin-producing Escherichia coli, Shigella, Norovirus, Adenovirus 40 / 41 and Rotavirus, and TE buffer.

[0188] (5) Negative control: TE buffer.

[0189] Applicable instrument: Fully automatic medical PCR analyzer independently developed by Hangzhou Ustar Biotechnology Co., Ltd., as recorded in Chinese patent application CN114933963A.

[0190] Experimental Example 1: Setup and Verification of the Detection System of the Kit of the Present Invention

[0191] This experimental example screened and obtained 15 pathogen primer probes, set up detection systems for them, and tested amplification performance. This experimental example spent a lot of time trying several 15 pathogen detection system settings, and only selected some of them for comparison and display of the effects, as shown in Table 1 below.

[0192] Table 1

[0193]

[0194] The operation method is as follows:

[0195] The 15 pathogen primer probe systems were mixed and three different pathogen system settings were added with 15 pathogen plasmid DNA templates, including Escherichia coli O157, Salmonella, Campylobacter, enterotoxigenic Escherichia coli, Yersinia enterocolitica, Vibrio parahaemolyticus, Vibrio vulnificus, toxin-producing Escherichia coli, Shigella, enteroinvasive Escherichia coli, Norovirus GI, Norovirus GI / GII, Adenovirus 40 / 41, Rotavirus, Clostridium difficile toxin A, Clostridium difficile toxin B, Vibrio cholerae, etc. The plasmid concentration was 1000 cps / reaction. Amplification experiments were performed on a qPCR instrument.

[0196] The amplification system and channels are shown in Table 2:

[0197] Table 2

[0198] name Final (μM) μL / rxn Primer BF (3~15 pathogens) 0.2 0.3 Primer BR (3~15 pathogens) 0.2 0.3 Probes (3~15 pathogens) 0.1 0.3 Polymerase 10U 1 Reverse transcriptase 2U 0.25 PCR buffer 5X 8 template / 5 Add water to 40 μl

[0199] The PCR reaction program was as follows: pre-denaturation at 95°C for 15 seconds; 45 cycles including denaturation at 95°C for 30 seconds, annealing and extension at 60°C for 30 seconds.

[0200] The experimental data results are shown in Table 3 below:

[0201] Table 3

[0202]

[0203] Experimental results:

[0204] Under the same conditions, the amplification test of the plasmid template showed that in the 15-plex hybrid detection system, only Salmonella and Norovirus GI were amplified and detected, but the detection rate did not reach 100%. However, Salmonella and Clostridium difficile toxin B were missed in system setting 2, and Clostridium difficile A was not detected at all; Clostridium difficile toxin B and Norovirus GI were missed in system setting 3, and Vibrio parahaemolyticus was not detected at all; the results showed that the primer probe of system setting 1 was significantly better than the other three groups in terms of amplification speed and stability (assessed by standard deviation). In addition, the primer probe of system setting 1 did not show false positives in the detection of the four channels of NTC, which shows that its specificity is better than the system settings of the other two groups of primer probes.

[0205] Preferably, each pathogen detection system is grouped as shown in Table 4.

[0206] Primers for simultaneous detection of multiple diarrheal pathogens include the following four primer probe sets:

[0207] The first set of specific primer-probe systems amplifies Salmonella, Campylobacter, Escherichia coli O157:H7 and internal standard MS2;

[0208] The second set of specific primers and probe systems amplified Yersinia enterocolitica, Clostridium difficile, enterotoxigenic Escherichia coli, and the internal standard MS2;

[0209] The third set of specific primers and probe systems amplify Shiga toxin-producing Escherichia coli, Shigella, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus and the internal standard MS2;

[0210] The fourth set of specific primers and probe systems for amplifying adenovirus, rotavirus, norovirus, norovirus and internal standard MS2:

[0211] In order to further optimize the above technical solution, the technical measures taken by the present invention also include:

[0212] Preferably, the primer composition further comprises an exogenous internal control primer set, wherein the internal control primer set is used to amplify primers and probes of bacteriophage MS2:

[0213] F19 (SEQ ID NO.55): CGTTCACAGGCTTACAAAGTAACC,

[0214] R19 (SEQ ID NO.56): CCAACAGTCTGGGTTGCCAC,

[0215] P19 (SEQ ID NO.57): CY5-AGAATCGCAAATACACCATCAAAGTCGAGGT-BHQ2;

[0216] The primer sequences of the infectious diarrhea pathogen primer set and the sequence of the internal control primer set are shown in Table 4, and the detection reagent tube channels and fluorescent labels are shown in Table 5.

[0217] Table 4. Primer sequences of infectious diarrhea pathogen primer set and internal control primer set

[0218]

[0219]

[0220]

[0221] Table 5 Detection reagent tube channels and fluorescent labels

[0222]

[0223] Test and verify the amplification speed and specificity of each pathogen primer probe after integration:

[0224] In the case where four independent channels are not used for primer-probe mixing, it is found that the mixing of four to six primer-probes contained therein may lead to poor sensitivity and specificity. In view of this, the present invention uses bioinformatics methods to comprehensively evaluate the designed probe primers to determine the probe primer configurations of various pathogen combinations, and then derive the specific detection probability. On this basis, three to six groups of primer probes were selected from the nucleic acids extracted from the 15 strain mixtures for mixed amplification to evaluate their amplification speed, efficiency and specificity. Please refer to Table 4 for specific probe primer details.

[0225] The operation method is as follows:

[0226] The mixed bacterial solution nucleic acid was extracted using Hangzhou Yousida Biotechnology DNA and RNA nucleic acid extraction kits. The mixed strains included 15 mixed strains of nucleic acid, including Escherichia coli O157, Salmonella, Campylobacter, enterotoxigenic Escherichia coli, Yersinia enterocolitica, Vibrio parahaemolyticus, Vibrio vulnificus, toxin-producing Escherichia coli, Shigella, enteroinvasive Escherichia coli, Norovirus GI / GII, adenovirus 40 / 41, rotavirus (the above three pseudoviruses were purchased from Universal Biotechnology), Clostridium difficile toxin A / B (ATCC9689 strain purchased from Testo Biotechnology), and Vibrio cholerae (engineered bacteria purchased from Sangon Biotechnology). The concentration of each mixed bacteria was 1×10 8 cfu / mL, sham disease concentration was 1×10 8 cps / mL.

[0227] After the nucleic acid stock solution was extracted, it was diluted 1000 times with TE buffer, and three sets of probe primers were added for amplification. Amplification experiments were performed on a qPCR instrument.

[0228] The amplification system and channels are shown in Table 6:

[0229] Table 6

[0230]

[0231]

[0232]

[0233] The PCR reaction program was as follows: reverse transcription at 50°C for 10 minutes; pre-denaturation at 95°C for 15 seconds; 45 cycles including denaturation at 95°C for 30 seconds, annealing and extension at 60°C for 30 seconds.

[0234] Experimental results:

[0235] The results of nucleic acid amplification of mixed bacterial liquid under the same conditions showed that the amplification speed and stability (standard deviation) of the first group of primers and probes were significantly better than those of the other two groups. No false positives were found in the four channels of the first group of primers and probes NTC, indicating that its specificity was better than that of the other two groups of probes and primers.

[0236] The experimental data results are shown in Table 7 below:

[0237] Table 7

[0238]

[0239] Test and verify the amplification sensitivity of each pathogen primer probe after integration:

[0240] The operation method is as follows:

[0241] Hangzhou Ustar Biotechnology DNA and RNA Nucleic Acid Extraction Kit (Cat. No.: Mag20B) was used to extract nucleic acids from strains including Escherichia coli O157, Salmonella, Campylobacter, enterotoxigenic Escherichia coli, Yersinia enterocolitica, Vibrio parahaemolyticus, Vibrio vulnificus, toxin-producing Escherichia coli, Shigella, enteroinvasive Escherichia coli, bacteriophage MS-2 (the above strains were purchased from Beina Biotechnology), Norovirus GI / GII, adenovirus 40 / 41, rotavirus (the above three pseudoviruses were purchased from Universal Biotechnology), Clostridium difficile toxin A / B (ATCC9689 strain purchased from Testo Biotechnology), and Vibrio cholerae (engineered bacteria purchased from Sangon Biotechnology), and then the nucleic acid concentration of each strain was quantified using Snuff digital PCR.

[0242] The first set of probe primers was screened using the above experiment for testing. The concentration gradient of nucleic acid of each pathogen was tested at 30~5000 copies / reaction for amplification experiment. The concentration of internal standard bacteriophage MS-2 was 1000 copies / reaction. Amplification experiment was performed on qPCR instrument.

[0243] The amplification system and conditions were the same as in the previous experiment:

[0244] Experimental results:

[0245] In this experiment, a four-channel diarrhea pathogen integrated detection system was established, which can detect 15 pathogens, with a sensitivity of 30-100 copies / reaction. The internal standard concentration is 1000 copies / reaction, and the CT value is about 25-30.

[0246] The experimental data results are shown in Table 8 below:

[0247] Table 8

[0248]

[0249] Experimental Example 2: Performance Verification of the Detection Tube of the Present Invention

[0250] Fecal samples are different from other samples such as blood, urine, and sputum. Since the composition of fecal samples is complex and difficult to handle, it is difficult to detect fecal samples based on the detection multi-tube described in Chinese utility model patent 202221322890.4. In view of this situation, the present invention optimizes the tube and verifies it. Specifically, in order to avoid missed detection due to magnetic beads hanging on the wall or stuck in the tube due to sample characteristics, the detection tube of the present invention is adjusted (7 degree bevel) between the first plug body and the tube body channel, such as Figure 2 This experimental example was verified based on the optimized and improved detection reagent tube.

[0251] The specific method for testing the test reagent tube is:

[0252] (1) Use sample pretreatment solution to dilute the stool sample. The specific plan is: Use a sampling swab to pick a stool sample of appropriate size, tighten the cover of the collection tube, weigh the weight, add the sample to a collection tube containing physiological saline, and dilute the sample to three concentrations, with a matrix concentration gradient of 10, 20, and 30 mg / ml (solid stool matrix sample). After fully shaking and mixing the sample in the collection tube, add the three concentration gradient matrix samples directly to the test tube, tighten the tube cover, and let it stand for 1 minute until the sample passes through the filter membrane to the nucleic acid extraction area below.

[0253] (2) Place the test tube into the nucleic acid amplification test analyzer, enter the corresponding test QR code and sample information, perform amplification testing, and observe the probability of magnetic beads remaining on the wall of the test reagent tube after the run is completed.

[0254] Experimental results:

[0255] This experimental example used stool samples for experimental testing before and after the optimization of the magnetic bead channel of the test tube consumables, and obtained the following results: After the optimization of the magnetic bead channel, no matter what the matrix concentration of the sample is, there is no phenomenon of magnetic beads remaining on the wall of the test reagent tube. However, in the case of the old test tube consumables, matrix samples of different concentrations showed different degrees of magnetic beads remaining on the wall of the test reagent tube. What is more noteworthy is that as the sample matrix concentration increases, the probability of magnetic beads remaining also increases. This result shows that the new test reagent tube consumables proposed in this experimental example can more effectively detect stool samples, greatly reducing the possibility of missed detection.

[0256] The test results are shown in Table 9 below:

[0257] Table 9

[0258]

[0259] Experimental Example 3: Pretreatment and detection rate verification of the kit of the present invention

[0260] Fecal samples can be roughly divided into two types: watery stool and solid stool. Due to the diverse properties and complex composition of these samples, they face certain challenges when performing sample pretreatment. In view of this situation, the present invention has carried out a variety of different sample pretreatment verifications. Specifically, this experimental example compared the pretreatment of watery stool and solid stool with different sample pretreatment solutions. These sample pretreatment solutions include sample pretreatment solution 1 physiological saline, sample pretreatment solution 2 fecal sample pretreatment solution (Ageconning, item number: NA-012-T03, purchased from Ageconning) and sample pretreatment solution 3 special sample pretreatment solution of the present invention.

[0261] The specific method for testing the test reagent tube is:

[0262] (1) Use stool sample pretreatment reagent to dilute the stool sample. The specific plan is: Use a sampling swab to pick a stool sample of appropriate size, tighten the cover of the collection tube, weigh it, and add the sample pretreatment solution to the collection tube at a concentration of 20 mg / ml (water sample and solid stool matrix sample). After fully shaking and mixing the sample in the collection tube, add 5000 copies / mL of norovirus (pseudovirus) respectively, mix well, and add it directly to the test tube, and cover the tube tightly. Let it stand for 1 minute, and wait for the sample to pass through the filter membrane to the extraction area below.

[0263] (2) Place the test tube into the nucleic acid amplification test analyzer, enter the corresponding test QR code and sample information, perform amplification testing, and observe the amplification detection rate.

[0264] Experimental results:

[0265] This experimental example performed sample pretreatment on three different sample pretreatment liquids, and obtained the following results: For watery stools, the three different sample pretreatment liquids were able to successfully detect rapid amplification. However, in terms of solid stools, except for sample pretreatment liquid 3 which was able to successfully amplify and detect 100%, the sample pretreatments of the other two sample pretreatment liquids missed detections or even failed to detect results. This result shows that the detection reagent tube proposed in this experimental example, combined with a special sample pretreatment liquid for sample pretreatment, can effectively detect two main types of stool samples, achieving successful detection of more diverse samples.

[0266] The test results are shown in Table 10 below:

[0267] Table 10

[0268]

[0269] Experimental Example 4: Optimization of the kit of the present invention and sensitivity test for various pathogens

[0270] This experiment tested the sensitivity of multiplex PCR combined detection reagents for each pathogen that causes intestinal diarrhea, including 15 pathogens. At the same time, this experiment optimized the test kit. By optimizing the polymerase enzyme, reverse transcriptase, adjustment of the amplification system, PCR enhancer, reagent nucleic acid extraction and other conditions, after detailed analysis and verification, the best performance of the test kit was ensured.

[0271] The specific method for testing the sensitivity of the detection reagent tube is:

[0272] (1) Dilute the stool sample with sample pretreatment solution. The specific plan is: Use a sampling swab to pick a stool sample of appropriate size, tighten the cover of the collection tube, weigh it, and add the sample pretreatment solution to the collection tube at a concentration of 20 mg / ml (matrix sample). After fully shaking and mixing the sample in the collection tube, add 15 strains with a concentration gradient of 10, 50, 100, 1000, and 5000 copies / mL, mix them evenly, then add them to the test tube and cover the tube tightly. Let it stand for 1 minute until the sample passes through the filter membrane and is filtered to the extraction area below.

[0273] (2) Place the test tube into the nucleic acid amplification test analyzer, enter the corresponding test QR code and sample information, and then perform amplification testing.

[0274] The test results are shown in Table 11 below:

[0275] After system optimization, the sensitivity of each pathogen ranged from 10 to 100 copies / mL.

[0276] Table 11

[0277]

[0278] Under the same experimental environment, this experimental example repeated the test kit 3 times, and found that there was no significant difference in the test results between these repeated experiments. This shows that the test results of this kit between different batches are comparable and have good repeatability. This experimental result shows that the kit of the present invention has excellent detection repeatability, and after optimization, it not only improves the sensitivity, but also shortens the time required for detection from 103 minutes to 53 minutes, greatly saving the time required for detection, and the detection time is better than similar products on the market. At the same time, this kit only requires one operator to complete all the operation processes, and can detect multiple samples at the same time, effectively avoiding the waste of manpower.

[0279] Experimental Example 5: Validation experiment of the kit optimization of the present invention on mixed strains of pathogens

[0280] This experimental example tests whether the simultaneous detection of 15 mixed strains of pathogenic bacteria that cause intestinal diarrhea will affect the detection performance of the test reagent tube.

[0281] The specific method is:

[0282] (1) The sample processing and test reagent tube operation methods are the same as the previous experiment.

[0283] (2) Add 15 strains at 3 times the LOD or a mixed strain of 15 strains at 3 times the LOD into the test reagent tube.

[0284] Experimental results:

[0285] In this example, a multiplex PCR combined detection kit including 15 intestinal diarrhea pathogens was verified, and the detection performance of mixed strains and single strains was compared. Whether in terms of the amplification rate of the target gene or the internal reference gene, the difference between the two is almost negligible. This shows that the detection performance of the kit of the present invention is not affected by mixed strains. Such results bring obvious advantages to the detection tube kit of the present invention. First, it ensures that the consistency and reliability of the test results are guaranteed during the detection process, whether it is a single strain or a mixed strain, thereby increasing the reliability of the kit of the present invention. Secondly, this superior detection stability can ensure that consistent test results can be obtained under different circumstances, further expanding the scope of application of this detection kit.

[0286] The test results are shown in Table 12 below:

[0287] Table 12

[0288]

[0289] Among the 12 types in the table above, NTC stands for negative control, which excludes false positives caused by contamination.

[0290] Experimental Example 6: Verification of the specificity of the kit of the present invention for detecting various pathogens

[0291] According to the method of Experimental Example 2, the relevant strains in the gastrointestinal tract were detected, including Acinetobacter baumannii, Anaerobic Coccus prevotii, Bacteroides fragilis, Citrobacter freundii, Clostridium sordellii, Eggertella tarda, Enterobacter cloacae, Enterococcus foetida, Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Escherichia coli, Fusobacterium necroticum, Helicobacter pylori, Klebsiella pneumoniae, Lactobacillus jensenii, Listeria monocytogenes, Micrococcus luteus, Morganella morganii, anaerobic Streptococcus, Shigella-like Pleuromonas, Oral Prevotella, Proteus mirabilis, Proteus vulgaris, Providencia alcaligenes, Providencia stuartii, Pseudomonas aeruginosa The concentration of bacterial pathogens was 1×10 6 CFU / mL, viral pathogen concentration is 1×10 6 copies / mL.

[0292] The specificity results are shown in Table 13 below:

[0293] Table 13

[0294]

[0295]

[0296]

[0297] The results showed that the results of the positive control group could be effectively detected and displayed as positive on the machine screen. The detection reagent of the present invention had no cross-reaction with other intestinal strains, indicating that the detection kit of the present invention had good specificity.

[0298] Experimental Example 7: Stability test of various pathogen detection reagents in the kit of the present invention

[0299] PCR detection reagents need to be stored at low temperatures and cannot be repeatedly frozen and thawed. The detection reagent tube of the present invention contains 15 diarrhea pathogen amplification systems and the reagents are freeze-dried in the four channel reagent pre-embedded areas of the reagent detection tube. The freeze-dried reagents can be stored at room temperature, which can save the cost of cold chain transportation and low-temperature storage. This experimental example verifies the stability of the multiple PCR combined detection kit for 15 intestinal diarrhea pathogens.

[0300] The specific operation method is as follows:

[0301] The test tube of the present invention was stored in a 37°C incubator, and the test tube was taken out for testing at 0 days, 30 days, 90 days, and 180 days. 15 pathogens were tested respectively, and the concentration LOD of each pathogen was about 50-5000 copies / mL and a negative control group (NTC).

[0302] The results are shown in Table 14 below:

[0303] Table 14

[0304]

[0305] The results show that the test tubes stored for 0 days, 30 days, 90 days, and 180 days were tested respectively. After the reagents in the test tubes of the present invention were freeze-dried, the test results at 0 days, 30 days, 90 days, and 180 days can effectively detect 15 strains. The results show that the test tubes of the present invention can be stably stored at 37°C for at least 3 months.

[0306] Experimental Example 8: Verification of the accuracy of the detection tube of the present invention in detecting various pathogens

[0307] The accuracy of PCR detection reagents ensures the credibility of the test results. If the reagents are inaccurate, it may lead to false positive or negative results, which may have a serious impact on clinical diagnosis. In order to ensure the accuracy of PCR detection reagents, this experimental example verifies the accuracy of the multiplex PCR combined detection kit for 15 intestinal diarrhea pathogens.

[0308] The specific operation method is as follows:

[0309] (1) Dilute the stool sample with sample pretreatment solution. The specific scheme is as follows: Use a sampling swab to pick a stool sample of appropriate size, tighten the cover of the collection tube, weigh it, add the sample pretreatment solution to the collection tube at a concentration of 20 mg / ml (matrix sample), shake and mix it, and then add it directly to the test tube. Add 15 strains (pseudoviruses) with a concentration gradient of 500, 5000, and 50000 copies / mL. Add equal volumes of positive control group and negative control group to the control test tube, tighten the tube cover, let it stand for 1 minute, and wait for the sample to be filtered through the filter membrane into the extract.

[0310] (2) Place the test tube into the nucleic acid amplification test analyzer, enter the corresponding test QR code and sample information, and then perform amplification testing.

[0311] The results are shown in Table 15 below:

[0312] Table 15

[0313]

[0314]

[0315] The results showed that the same experiment was repeated three times, with no significant difference in the test results, and the standard deviation and coefficient of variation were small, indicating that the experimental accuracy of this kit is high and has good repeatability.

[0316] Experimental Example 9: Repeatability Verification of the Kit and Detection Tube of the Present Invention

[0317] The intra-batch and inter-batch stability of the test reagent tube is very important to ensure the reliability and consistency of the test results. It helps to control quality, ensure the accuracy and reliability of the test results, improve the trust of research and the accuracy of clinical diagnosis, and also improve the efficiency of testing. This experimental example further verifies the intra-batch and inter-batch detection stability of the multiplex PCR combined detection kit for 15 intestinal diarrhea pathogens.

[0318] The specific operation method is as follows:

[0319] (1) The sample matrix and the method of loading the sample onto the machine are the same as those in Experimental Example 5.

[0320] (2) Common clinical strains, including Salmonella, Clostridium difficile, Shigella, and Norovirus (GII pseudovirus), were added to the matrix supernatant at a concentration of 3 times the LOD and mixed evenly. Then, 1 mL of the detection reagent tube was added and tested on the machine.

[0321] (3) Intra-batch differences refer to test tubes produced on the same day, with each group of experiments repeated 8 times. Inter-batch differences refer to test tubes produced at three different times, with each test tube produced at each time point repeated 6 times.

[0322] The results are shown in Table 16 below:

[0323] Table 16

[0324]

[0325] The results showed that the same experiment was repeated three times and there was no significant difference in the test results, which indicated that the test results between different batches of this kit were comparable and had good repeatability.

[0326] From the above experiments, it can be seen that: on the basis of realizing the simultaneous detection of 15 pathogens, the present invention has good repeatability of experimental detection results, large detection sample volume, high sensitivity, good specificity, and good detection timeliness, which can achieve the purpose of sample in and result out, and the detection reagent is stable and can be stored for at least 3 months, with high market value.

[0327] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above experimental examples do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

[0328] Experimental Example 10: Clinical Detection Accuracy of the Kit and Detection Tube of the Present Invention

[0329] 300 clinical stool samples were collected. These stool samples have been confirmed as various pathogens shown in Table 17 by the traditional gold standard for detection: diarrhea pathogen PCR detection method (refer to the "Expert Consensus on Diagnosis and Treatment of Acute Infectious Diarrhea in Adults"). At the same time, the kit and detection tube of the present invention were used to detect these 300 clinical stool samples. The results obtained were 100% consistent with the gold standard results. In view of space considerations, Table 17 only shows some sample results.

[0330] Table 17

[0331]

[0332] .

Claims

1. An integrated POCT kit for detecting 15 diarrheal pathogens, characterized in that: include: Fecal sample pretreatment reagents and pathogen detection reagents; The stool sample pretreatment reagent includes: 1~4M guanidine salt, 20~200 mM sodium citrate, 1~10% SDS by volume, 2~10% polidocanol by volume, 25~50% isopropanol by volume, 10~30 mg / mL nanocarbon, and 10~30 mg / mL zeolite powder; Pathogen detection reagents for 15 diarrheal pathogens include system A reagents, system B reagents, system C reagents, and system D reagents; System A reagents include: Primers and probes for amplifying Salmonella whose sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 3, Primers and probes for amplifying Campylobacter with sequences as shown in SEQ ID NO. 4 to SEQ ID NO. 6, Primers and probes for amplifying Escherichia coli O157 whose sequences are shown in SEQ ID NO. 7 to SEQ ID NO. 9; System B reagents include: Primers and probes for amplifying Yersinia enterocolitica having sequences as shown in SEQ ID NO. 10 to SEQ ID NO. 12, Primers and probes for amplifying the gene encoding Clostridium difficile toxin A in Clostridium difficile, whose sequences are shown in SEQ ID NO. 13-SEQ ID NO. 15, Primers and probes for amplifying the gene encoding Clostridium difficile toxin B in Clostridium difficile, whose sequences are shown in SEQ ID NO. 16-SEQ ID NO. 18, Primers and probes for amplifying enterotoxigenic Escherichia coli with sequences as shown in SEQ ID NO. 19 to SEQ ID NO. 24; System C reagents include: Primers and probes for amplifying toxin-producing Escherichia coli with sequences as shown in SEQ ID NO. 25-SEQ ID NO. 27, Primers and probes for amplifying enteroinvasive Escherichia coli having sequences as shown in SEQ ID NO. 28 to SEQ ID NO. 30, Primers and probes for amplifying Vibrio cholerae whose sequences are shown in SEQ ID NO. 31-SEQ ID NO. 33, Primers and probes for amplifying Vibrio parahaemolyticus having sequences as shown in SEQ ID NO. 34 to SEQ ID NO. 36, Primers and probes for amplifying Vibrio vulnificus having sequences as shown in SEQ ID NO. 37-SEQ ID NO. 39, System D reagents include: Primers and probes for amplifying adenovirus 40 / 41 whose sequences are shown in SEQ ID NO. 40-SEQ ID NO. 42, Primers and probes for amplifying rotavirus whose sequences are shown in SEQ ID NO. 43-SEQ ID NO. 45, Primers and probes for amplifying Norovirus GI whose sequences are shown in SEQ ID NO. 46-SEQ ID NO. 48, Primers and probes for amplifying norovirus GII whose sequences are shown in SEQ ID NO. 49-SEQ ID NO. 51, The sequences of primers and probes for amplifying Shigella are shown in SEQ ID NO. 52 to SEQ ID NO.

54.

2. The integrated POCT kit for detecting 15 diarrheal pathogens according to claim 1, characterized in that: The stool sample pretreatment reagents include: 3M guanidine salt, 50 mM sodium citrate, 5% SDS by volume, 5% polidocanol by volume, 30% isopropanol by volume, 10 mg / mL nanocarbon, and 10 mg / mL zeolite powder; And / or, the diameter of the nano-carbon is 20-50 nm; the diameter of the zeolite powder is 20-50 nm.

3. The integrated POCT kit for detecting 15 diarrheal pathogens according to claim 1, characterized in that: Also includes: Internal standard reagent; the internal standard reagent refers to: primers and probes for amplifying bacteriophage MS2 whose sequences are shown in SEQ ID NO. 55-SEQ ID NO. 57; And / or, the reagents of system A, system B, system C and system D all contain the internal standard reagent; And / or, the pathogen detection reagent also includes: RNase inhibitor, sodium chloride, tris(hydroxymethyl)aminomethane (Tris)-pH buffer, deoxyribonucleoside triphosphate, hot start DNA polymerase, hot start reverse transcriptase, uracil-DNA glycosylase, bovine serum albumin, DMSO, glycerol, formamide, and ammonium sulfate.

4. The integrated POCT kit for detecting 15 diarrheal pathogens according to claim 1 or 3, characterized in that: Also includes: Nucleic acid extraction reagents; The nucleic acid extraction reagent includes: 4M guanidine thiocyanate, 50mM sodium citrate, 2% Tween-20 by volume, 5% Triton X-100 by volume, 50% isopropanol by volume, 5000 copies / mL of MS2 bacteriophage and 50 mg / mL silicon hydroxy magnetic beads; And / or, the 5' end of the probe is connected to a fluorescent marker, and the 3' end is connected to a fluorescent quencher; And / or, the fluorescent marker is selected from: FAM, HEX, ROX, CY5; And / or, the fluorescence quencher is selected from: BHQ1, BHQ2, BHQ3.

Images