1,2-benzopyrone derivatives, processes for their preparation and their medical use
By developing novel mitochondrial RNA polymerase inhibitor compounds, especially POLRMT inhibitors, the problem of the difficulty in specifically inhibiting POLRMT in existing technologies has been solved, enabling effective treatment of various cancers and exhibiting good anti-cancer cell proliferation activity and tumor suppression effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHINA PHARM UNIV
- Filing Date
- 2024-06-21
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies make it difficult to develop small molecule active compounds that can specifically inhibit mitochondrial RNA polymerase POLRMT for the effective treatment of cancers that depend on oxidative phosphorylation, such as melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, and colon cancer.
A novel class of mitochondrial RNA polymerase inhibitor compounds, including their stereoisomers, solvates, prodrugs, metabolites, deuterated compounds, pharmaceutically acceptable salts, or cocrystals, are provided for the preparation of corresponding pharmaceutical compositions for cancer treatment by targeting and inhibiting POLRMT.
These compounds exhibit good anti-cancer cell proliferation activity and tumor inhibition effects, possessing strong anti-cancer cell proliferation activity and tumor inhibition rate, and are suitable for the treatment of various cancer diseases.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_4
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the research and application of mitochondrial RNA polymerase inhibitors and their derivatives. More specifically, this invention relates to a novel class of mitochondrial RNA polymerase inhibitor compounds, including their stereoisomers, solvates, prodrugs, metabolites, deuterated derivatives, pharmaceutically acceptable salts, or cocrystals. Furthermore, this invention also covers pharmaceutical compositions comprising such novel compounds, and their various uses in the pharmaceutical field. The core objective of this invention is to provide more effective and safer drug options for the treatment of related diseases through the development of these novel mitochondrial RNA polymerase inhibitors. Background Technology
[0002] Despite significant progress in cancer treatment research, cancer remains one of the most serious public health challenges globally. The fact that approximately 1,500 cancer patients die every day worldwide due to disease progression is heartbreaking. Therefore, in addition to existing chemotherapy, radiotherapy, and emerging immunotherapy methods, there is an urgent need to discover new and more effective cancer treatments.
[0003] Metabolism, a core regulatory mechanism in cancer biology, has not yet been fully elucidated in its role in drug resistance formation. Recent research indicates that mitochondrial metabolism and oxidative phosphorylation play crucial roles in chemotherapy resistance in cancer, providing new avenues for improving chemotherapy efficacy. In particular, evidence shows that cancer cell growth and drug resistance formation largely depend on mitochondrial oxidative phosphorylation (OXPHOS). These findings provide a solid theoretical foundation and novel strategies for utilizing OXPHOS and mitochondrial function inhibitors in anticancer therapy.
[0004] Mitochondrial RNA polymerase (POLRMT) is a key enzyme in mitochondrial transcription, responsible for transcribing the 13 subunits, 2 rRNAs, and 22 tRNAs required for the OXPHOS complex. It also participates in the RNA initiation process of mitochondrial DNA replication. Therefore, POLRMT plays an indispensable role in maintaining mitochondrial function.
[0005] Recent studies have further revealed the potential of targeting POLRMT in the treatment of acute myeloid leukemia, and this strategy is expected to be extended to other cancer types that depend on oxidative phosphorylation, such as certain types of breast cancer, as well as specific subgroups of melanoma and pancreatic cancer.
[0006] Therefore, we are committed to developing new compounds that can specifically target and inhibit POLRMT, with the aim of effectively treating cancers that depend on oxidative phosphorylation. In particular, we are seeking novel compounds that can be used to treat cancers such as melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, and ovarian cancer.
[0007] However, obtaining small-molecule active compounds capable of specifically inhibiting POLRMT still faces many challenges. Therefore, the objective of this invention is to provide a new class of compounds that can specifically inhibit POLRMT, thereby providing a new and effective means for cancer treatment. Summary of the Invention:
[0008] Purpose of the invention: The technical problem to be solved by the present invention is to provide a class of specific POLRMT small molecule inhibitors for the treatment of cancer, the general structural formula of which is shown in formula (I).
[0009] Another technical problem to be solved by the present invention is to provide stereoisomers, hydrates, metabolites, deuterated products, solvates, pharmaceutically acceptable salts or cocrystals of compounds as shown in formula (I).
[0010] Another technical problem that the present invention can solve is to provide a pharmaceutical composition comprising the aforementioned compounds.
[0011] The technical problem to be solved by this invention is to provide the use of compounds, stereoisomers, hydrates, metabolites, deuterated products, solvates, pharmaceutically acceptable salts or cocrystals or pharmaceutical compositions in the preparation of mitochondrial RNA polymerase inhibitors or antitumor drugs.
[0012] Technical Solution: To solve the above-mentioned technical problems, the present invention provides one or more embodiments of a compound of formula (I) or a stereoisomer, tautomer, nitrogen oxide, deuterated product, hydrate, solvate, metabolite, pharmaceutically acceptable salt, or prodrug thereof:
[0013]
[0014] in:
[0015] Q1 is selected from halogen, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl, cyano, hydroxyl, nitro, carboxyl;
[0016] Q2, Q3, Q4, and Q5 are each independently selected from hydrogen, halogens, and carbon. 1-6 Alkyl, C 1-6 Alkoxy, trifluoromethyl, cyano, hydroxy, nitro, carboxyl;
[0017] V1, V2, V3, and V4 are each independently selected from hydrogen, halogens, and carbon. 1-6 Alkyl, C 1-6 Alkoxy, cyano, nitro, and V1, V2, V3, V4 are not all hydrogen;
[0018] R and R1 are each independently selected from hydrogen and C. 1-6 Alkyl groups or R can be combined with R1 rings to form three- or four-membered rings;
[0019] Y is -NR3R4, where R3 and R4 are each independently selected from hydrogen and C. 1-6 Alkyl, C 3-8 cycloalkyl, C 1-6 Hydroxyalkyl, C 6-10 aryl, 3-6 heteroaryl; or
[0020] R3, R4, and the N atoms attached to them form an unsubstituted or substituted 5- or 6-membered saturated heterocycle, the saturated heterocycle including or excluding other heteroatoms selected from O or S, and the substituents selected from halogens, cyano groups, hydroxyl groups, or carboxyl groups; or
[0021] Y is -OR5, where R5 is hydrogen, C 1-6 Alkyl, isopropyl, cyclopropyl, C 6-10 Aryl, 3-6 heteroaryl.
[0022] In some embodiments, Q1 is selected from halogen, C 1-6 Alkyl, C 1-6 Alkoxy, trifluoromethyl, cyano, nitro; preferably, Q1 is selected from halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, trifluoromethyl.
[0023] In some embodiments, Q2, Q3, Q4, and Q5 are each independently selected from hydrogen, halogen, and C. 1-6 Alkyl, C 1-6 Alkoxy, trifluoromethyl, cyano, nitro; preferably, Q2, Q3, Q4, Q5 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl; more preferably, Q2, Q3, Q5 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, and Q4 is hydrogen; preferably, Q1, Q2, Q3, Q4, Q5 are not all hydrogen.
[0024] In some embodiments, V1, V2, V3, and V4 are each independently selected from hydrogen, halogen, and C. 1-6 Alkyl, C 1-6The alkoxy or cyano group is used, and V1, V2, V3, and V4 are not all hydrogen; preferably, V1, V2, V3, and V4 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, and ethoxy, and V1, V2, V3, and V4 are not all hydrogen; more preferably, V1, V2, and V3 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, and ethoxy, V4 is hydrogen, and V1, V2, V3, and V4 are not all hydrogen.
[0025] In some embodiments, R, R1 are each independently selected from hydrogen or C. 1-6 Alkyl; preferably, R and R1 are each independently selected from hydrogen, methyl or ethyl, and R and R1 are not both hydrogen.
[0026] In some embodiments, Y is -NR3R4, wherein R3 and R4 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, C 1-3 Hydroxylalkyl, pyridyl, phenyl; or R3, R4 and the N attached to them form unsubstituted or substituted heterocycles such as pyrrolidine ring, piperidine ring, morpholine ring, piperazine ring, wherein the substituent is preferably a carboxyl group.
[0027] In some specific instances, one or more embodiments of the compound of formula (II) or its stereoisomers, tautomers, nitrides, deuterates, hydrates, solvates, metabolites, pharmaceutically acceptable salts, or prodrugs thereof are provided:
[0028]
[0029] The definitions of Q1, Q3, V2, and Y can be as described above.
[0030] In some preferred embodiments, Q1 is selected from hydrogen, methyl, chlorine, and fluorine; Q3 is selected from hydrogen, methyl, chlorine, and fluorine, and Q1 and Q3 are not both hydrogen; V2 is selected from hydrogen, methyl, chlorine, and fluorine; Y is Or -NR3R4, where R3 and R4 are hydrogen or C. 1-3 Hydroxyalkyl; more preferably, R3 is hydrogen and R4 is C. 1-3 Hydroxyalkyl.
[0031] Furthermore: the compounds provided in one or more embodiments of the present invention are selected from, but not limited to, the following structures:
[0032]
[0033] One or more embodiments of the present invention provide pharmaceutical compositions comprising a compound of general formula (I) or the specific structure described above or its stereoisomers, a solvate, a metabolite, a deuterated product, a pharmaceutically acceptable salt, a cocrystal or a prodrug, and one or more pharmaceutically acceptable carriers and / or excipients.
[0034] One or more embodiments of the present invention provide the use of the pharmaceutical compositions of this application, compounds of general formula (I) or the specific structures described above or their stereoisomers, solvates, metabolites, deuterated products, pharmaceutically acceptable salts, cocrystals or prodrugs in the preparation of POLRMT inhibitors.
[0035] One or more embodiments of the present invention provide the use of the pharmaceutical compositions of this application, compounds of general formula (I) or the specific structures described above or their stereoisomers, solvates, metabolites, deuterated products, pharmaceutically acceptable salts, cocrystals or prodrugs in the preparation of medicaments for treating POLRMT-mediated diseases.
[0036] In one or more embodiments of the present invention, the POLRMT-mediated related diseases are selected from: ovarian cancer, melanoma, metastatic melanoma, pancreatic cancer, hepatocellular carcinoma, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, renal cancer, or colorectal cancer.
[0037] One or more embodiments of the present invention provide a method for inhibiting POLRMT, comprising contacting a compound of general formula (I) of the present application or the specific structure thereon or its stereoisomers, solvates, metabolites, deuterated products, pharmaceutically acceptable salts, eutectics or prodrugs or compositions of the present application with a target in which this is desired.
[0038] One or more embodiments of the present invention provide a method for treating a disease associated with POLRMT, comprising applying a compound of general formula (I) of the present invention or the specific structure described above or its stereoisomers, solvates, metabolites, deuterated products, pharmaceutically acceptable salts, cocrystals or prodrugs or compositions of the present application to a subject in need.
[0039] One or more embodiments of the present invention provide compounds of general formula (I) or the specific structures described above or their stereoisomers, solvates, substitutes, deuterated products, pharmaceutically acceptable salts, cocrystals or prodrugs for the treatment of diseases associated with POLRMT or as POLRMT inhibitors.
[0040] Unless otherwise stated, the terms used in the specification and claims have the following meanings.
[0041] The carbon, hydrogen, oxygen, sulfur, nitrogen, or F, Cl, Br, I involved in the groups and compounds described in this invention include their isotopes, and the carbon, hydrogen, oxygen, sulfur, or nitrogen involved in the groups and compounds described in this invention may optionally be further replaced by one or more of their corresponding isotopes, wherein the isotopes of carbon include 12 C 13 C and 14 C, Isotopes of hydrogen include protium (H), deuterium (D, also called heavy hydrogen), and tritium (T, also called superheavy hydrogen), while isotopes of oxygen include... 16 O、 17 O and 18 O, isotopes of sulfur include 32 S, 33 S, 34 S and 36 S, nitrogen isotopes include 14 N and 15 N, isotopes of fluorine include 17 F and 19 F, isotopes of chlorine include 35 Cl and 37 Cl, isotopes of bromine include 79 Br and 81 Br.
[0042] "alkyl" refers to a straight-chain or branched saturated aliphatic hydrocarbon group with 1 to 20 carbon atoms, preferably an alkyl group with 1 to 8 carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8), more preferably an alkyl group with 1 to 6 carbon atoms, and even more preferably an alkyl group with 1 to 4 carbon atoms. Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, neobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, and various branched isomers thereof; when the alkyl group is substituented, it may optionally be further substituted by one or more substituents.
[0043] "Alkoxy" refers to a group formed by replacing at least one carbon atom in an alkyl group with an oxygen atom. Non-limiting examples include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, n-hexoxy, cyclopropoxy, and cyclobutoxy. The definition of alkyl is the same as that of "alkyl" as described above.
[0044] "Aryl" refers to a substituted or unsubstituted aromatic ring, which can be a 5- to 8-membered (e.g., 5, 6, 7, 8-membered) monocyclic ring, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system. It can be a bridged ring or a spirocyclic ring. Non-limiting examples include phenyl and naphthyl groups. The aryl group may optionally be further substituted by one or more substituents.
[0045] "Heteroaryl" refers to a substituted or unsubstituted aromatic ring, which can be a 3- to 8-membered (e.g., 3, 4, 5, 6, 7, 8-membered) monocyclic ring, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1 to 6 (e.g., 1, 2, 3, 4, 5, 6) heteroatoms selected from N, O, or S, preferably 5- to 8-membered heteroaryl. The 1 to 4 (e.g., 1, 2, 3, 4) N and S atoms selectively substituted in the ring of the heteroaryl can be oxidized to various oxidation states. The heteroaryl group can be attached to a heteroatom or a carbon atom. The heteroaryl group can be a bridged ring or a spiro ring. Non-limiting examples include cyclopyridyl, furanyl, thiophenyl, pyranyl, pyrrolidinyl, pyrimidinyl, pyrazinyl, pyridazinyl, imidazolyl, piperidinylbenzimidazolyl, benzopyridyl, and pyrrolopyridyl. The heteroaryl group may optionally be further substituted with one or more substituents.
[0046] "Cycloalkyl" refers to a saturated cycloalkyl group whose ring can be a 3- to 10-membered (e.g., 3, 4, 5, 6, 7, 8, 9, 10-membered) monocyclic ring, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 20-membered (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20-membered) polycyclic system, preferably with 3 to 10 carbon atoms, more preferably with 3 to 8 carbon atoms. Non-limiting examples of "cycloalkyl" include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,5-cyclooctadienyl, 1,4-cyclohexadienyl, and cyclohepttrienyl, etc. When the cycloalkyl group is substituted, it may optionally be further substituted by one or more substituents.
[0047] "Saturated heterocycle" refers to a substituted or unsubstituted saturated non-aromatic cyclic group, which can be a 3- to 8-membered (e.g., 3, 4, 5, 6, 7, 8-membered) monocyclic, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1, 2, or 3 heteroatoms from N, O, or S, preferably a 3- to 8-membered heterocyclic group. The 1, 2, or 3 N or S atoms selectively substituted in the ring of the "heterocyclic alkyl" can be oxidized to various oxidation states. Non-limiting examples of “saturated heterocycles” include epoxyethyl, aziridinepropyl, oxacyclobutyl, aziridinebutyl, 1,3-dioxolanecycloyl, 1,4-dioxolanecycloyl, 1,3-dioxahexacycloyl, aziridineheptyl, piperidinyl, piperinyl, morpholinyl, thiomorpholinyl, 1,3-dithiaalkyl, tetrahydrofuranyl, tetrahydropyrroleyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydropyranyl, aziridine[3.2.1]octyl, aziridine[5.2.0]nonyl, oxacyclo[5.3.1.1]dodecyl, aziridine, and oxaspiro[3.3]heptyl.
[0048] When the terms "alkyl", "alkoxy", "aryl", "heteroaryl", "carbocyclic", "heterocyclic", "cycloalkyl", "heterocyclic", or "heterocyclic" mentioned above are substituted, they may be further replaced by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 groups selected from F, Cl, Br, I, hydroxyl, mercapto, nitro, cyano, amino, C 1-6 Alkylamino, =O, C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyl, C 2-6 alkynyl group, -NR t4 R t5 =NR t6 ,-C(=O)OC 1-6 Alkyl group, -OC (=O)C 1-6 Alkyl, -C(=O)NR t4 R t5 C 3-8 cycloalkyl, C 3-8 Heterocyclic alkyl, C 6-10 Aryl, C 5-10 heteroaryl, -C(=O)OC 6-10 Aryl, -OC(=O)C 6-10 Aryl, -OC(=O)C 5-10 heteroaryl, -C(=O)OC 5-10 heteroaryl, -OC(=O)C 3-8 Heterocyclic alkyl, -C(=O)OC 3-8 Heterocyclic alkyl groups, -OC (=O)C 3-8Cycloalkyl, -C(=O)OC 3-8 cycloalkyl, -NHC(=O)C 3-8 Heterocyclic alkyl groups, -NHC(=O)C 6-10 Aryl, -NHC(=O)C 5-10 heteroaryl, -NHC(=O)C 3-8 cycloalkyl, -NHC(=O)C 3-8 Heterocyclic alkyl groups, -NHC(=O)C 2-6 alkenyl or -NHC(=O)C 2-6 The alkynyl group is replaced by a substituent, and the substituent C is described in the figure. 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-8 cycloalkyl, C 3-8 Heterocyclic alkyl, C 6-10 Aryl, C 5-10 heteroaryl, -NHC(=O)C 6-10 Aryl, -NHC(=0)C 5-10 heteroaryl, -NHC(=O)C 3-8 Heterocyclic alkyl groups or -NHC(=O)C 3-8 The cycloalkyl group may optionally be further surrounded by one to three elements selected from OH, F, Cl, Br, I, C. 1-6 Alkyl, C 1-6 Alkoxy, -NR t4 R t5 Or replaced by the =O substituent; R t1 Selected from C 1-6 Alkyl, C 1-6 Alkoxy or C 6-10 Aryl; R t2 R t3 Selected from H or C 1-6 Alkyl; wherein, R t4 R t5 Selected from H, C 1-6 Alkyl group, -NH (C=NR) t1 )NR t2 R t3 -S(=O)2NR t2 R t3 -C(=O)R t1 Or -C(=0)NR t2 R t3 The C mentioned therein 1-6 The alkyl group may optionally be further influenced by one or more elements selected from OH, F, Cl, Br, I, and C. 1-6 Alkyl, C 1-6 Alkoxy, C 6-10 Aryl, C5-10 heteroaryl, C 3-8 cycloalkyl or C 3-8 Substituents of heterocyclic alkyl groups; or R t4 With R t5 The N atom forms a 3- to 8-membered heterocycle, which may contain one or more heteroatoms selected from N, O or S.
[0049] "Pharmaceutically acceptable salt" or "its pharmaceutically acceptable salt" means that the compound of the present invention retains the bioavailability and properties of a free acid or a free base, and that the free acid is obtained by reacting with a non-toxic inorganic or organic base, and the free base is obtained by reacting with a non-toxic inorganic or organic acid.
[0050] "Carrier" refers to a material that does not cause significant stimulation to an organism and does not eliminate the biological activity and properties of the compound given.
[0051] "Excipients" are inert substances added to a pharmaceutical composition to facilitate administration of the compound. Non-limiting examples include calcium carbonate, calcium phosphate, sugar, starch, cellulose derivatives (including microcrystalline cellulose), gelatin, vegetable oils, polyethylene glycols, diluents, granulating agents, lubricants, binders, and disintegrants.
[0052] "Prodrug" refers to a compound of the present invention that can be metabolized in vivo and converted into a biologically active compound. The prodrug of the present invention is prepared by modifying the amino or carboxyl groups in the compound of the present invention. This modification can be performed through conventional procedures or removed in vivo to obtain the parent compound. When the prodrug of the present invention is administered to a mammalian individual, the prodrug is cleaved to form free amino or carboxyl groups.
[0053] "Co-crystal" refers to a crystal formed by the bonding of an active pharmaceutical ingredient (API) and a co-crystal form (CCF) through hydrogen bonds or other non-covalent bonds. Both API and CCF are solids at room temperature in their pure states, and a fixed stoichiometric ratio exists between the components. Co-crystal is a multi-component crystal, encompassing both binary co-crystals formed between two neutral solids and multi-component co-crystals formed between a neutral solid and a salt or solvate.
[0054] "Stereoisomers" are isomers that are produced by different spatial arrangements of atoms in a molecule, including cis-trans isomers, enantiomers, and conformational isomers.
[0055] "Optional" or "optionally" or "selectively" means that the event or condition described below may or may not occur, and the description includes both cases in which the event or condition occurs and cases in which it does not occur. For example, "optionally alkyl-substituted heterocyclic group" means that the alkyl group may or may not be present, and the description includes both cases in which the heterocyclic group is substituted with an alkyl group and cases in which the heterocyclic group is not substituted with an alkyl group.
[0056] Beneficial effects: Compared with the prior art, the present invention has the following advantages: The present invention is the first to prepare a class of mitochondrial RNA polymerase inhibitors, especially POLRMT inhibitors. These inhibitors can treat diseases related to the inhibitor and various tumor diseases with good effects, and have strong anti-cancer cell proliferation activity and strong tumor inhibition rate. Attached Figure Description
[0057] Figure 1 Comparison of tumor suppression effects of compounds, controls, and positive control drug IMT1B in Examples 1, 3, 6, 13, 19, and 28, and changes in tumor size;
[0058] Figure 2 The tumor-suppressive effects of compounds, controls, and the positive control IMT1B in Examples 1, 3, 6, 13, 19, and 28, and changes in mouse body weight. Detailed Implementation
[0059] The following examples illustrate specific implementation methods to further describe the content of the present invention in detail. However, this should not be construed as limiting the scope of the above-mentioned subject matter of the present invention to the following examples. All technologies that can be implemented in the art based on the above-mentioned content of the present invention should be included in the content of the present invention.
[0060] The structure of the compound was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). NMR shifts (δ) were expressed in 10⁻¹⁰ increments. -6 The unit (ppm) is given. NMR measurements were performed using a Bruker Avance 500 or Bruker Avance 300 NMR spectrometer, with deuterated form (CDCl3) as the solvent and tetramethylsilane (TMS) as the internal standard.
[0061] Scheme 1: Exemplary preparation of the compound of formula (I) of the present invention:
[0062]
[0063] It will be apparent to those skilled in the art that the order of the synthetic steps depends on the availability of intermediates and the compatibility of functional groups, and can vary from compound to compound.
[0064] For the compounds described in this invention, the step from intermediate 6 to the final product involves amide condensation. Depending on the substrate, some compounds may require further ester hydrolysis or deprotection.
[0065] Example 1 (S)-1-((R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0066] Prepared according to Scheme 1, including the following steps:
[0067] first step:
[0068]
[0069] Procedure: Sodium hydride (52.15 mmol) was dissolved in 100 mL of anhydrous tetrahydrofuran, cooled to 0 °C, and then commercially available 2-methylacetophenone (28.59 mmol) was added dropwise. The mixture was stirred at room temperature for half an hour, followed by the dropwise addition of diethyl carbonate (86.91 mmol). The temperature was raised to 65 °C and the reaction was carried out for approximately 3 hours. After the reaction was completed, the mixture was cooled to room temperature, quenched with 100 mL of saturated ammonium chloride, and 100 mL of ethyl acetate was added. The mixture was extracted three times, and the organic layer was concentrated. Column chromatography with a PE:EA (V / V) ratio of 150:1 was used to obtain intermediate b in 77.56% yield. Step 2:
[0070]
[0071] Procedure: Intermediate b (23.24 mmol) and 4-fluororesorcinol (22.08 mmol) were dissolved in methanesulfonic acid (30 mL / g), and the mixture was heated to 45 °C and reacted for 2 hours. After the reaction was completed, the mixture was cooled to room temperature, and extracted three times with 100 mL of ethyl acetate and 100 mL of ice water. The organic layer was concentrated, and intermediate c was obtained by column chromatography with PE:EA (V / V) = 4:1, with a yield of 53.26%.
[0072] Step 3:
[0073]
[0074] Procedure: Intermediate c (8.60 mmol) and triphenylphosphine (9.46 mmol) were dissolved in anhydrous tetrahydrofuran, and ethyl (S)-2-hydroxypropionate (12.90 mmol) was added. The reaction mixture was cooled to 0 °C, and DIAD (9.46 mmol) was added dropwise. The mixture was then brought to room temperature and reacted for 4 hours. After the reaction was complete, the mixture was cooled to room temperature, and extracted three times with 100 mL of ethyl acetate and 100 mL of ice water. The organic layer was concentrated, and intermediate d was obtained by column chromatography with a PE:EA (V / V) ratio of 10:1, yielding 52.98%.
[0075] Step 4:
[0076]
[0077] Procedure: Dissolve intermediate d (8.60 mmol) in 50 mL of tetrahydrofuran, cool to 0 °C, add 50 mL of 2 M NaOH solution, and then allow to react at room temperature for 3 hours. After the reaction is complete, add 2 M HCl to adjust the pH to 2, stir for 30 minutes, add 100 mL of ethyl acetate, extract three times, concentrate the organic layer to obtain intermediate e, and proceed directly to the next step.
[0078] Step 5:
[0079]
[0080] Intermediate e (1.65 mmol) was dissolved in 20 mL of anhydrous dichloromethane, and HATU (2.48 mmol) was added. The mixture was stirred for 30 minutes, followed by the addition of ethyl (S)-3-piperidinic carboxylate (1.98 mmol) and DIPEA (2.48 mmol). The reaction was allowed to proceed for 1 hour. After the reaction was complete, the mixture was extracted three times with 100 mL of dichloromethane and 100 mL of ice water. The organic layer was concentrated, and intermediate f was obtained by column chromatography with a PE:EA (V / V) ratio of 2:1, yielding 77.35%.
[0081] Step 6:
[0082]
[0083] Intermediate f (1 mmol) was dissolved in 10 mL of tetrahydrofuran, cooled to 0 °C, and 50 mL of 1 M NaOH solution was added. The mixture was then allowed to react at room temperature for 3 hours. After the reaction was complete, 1 M HCl was added to adjust the pH to 2, and the mixture was stirred for 30 minutes. Ethyl acetate (100 mL) was added, and the mixture was extracted three times. The organic layer was concentrated, and compound 1 was obtained by column chromatography with a DCM:MeOH (V / V) ratio of 30:1, yielding compound 1 in 62.58%. The characterization data of compound 1 are as follows:
[0084] 1H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.26(m,4H),6.89 (d,J=4.3Hz,1H),6.40(s,1H),5.20(q,J=6.6Hz,1H),3.77(dd,J=11.5,3.8Hz,1H) ,3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,4.9,3.8 Hz,1H),2.41(d,J=0.7Hz,3H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.63,161.24,153.22,153.20,153.03,152.99,151.81,149.83,148.26,148.14,138.99,136.63,130. 57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,1 06.22,106.17,75.17,49.17,46.57,43.27,26.96,23.89,20.96,17.83.
[0085] Example 2 (S)-1-((R)-2-((6-chloro-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0086] The procedure was the same as in Example 1, except that 4-fluoro-resorcinol in the second step was replaced with 4-chloro-resorcinol to prepare compound 2. The characterization data for compound 2 are as follows:
[0087] 1H NMR(500MHz,Chloroform-d)δ7.62(s,1H),7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27 (m,3H),6.94(s,1H),6.40(s,1H),5.23(q,J=6.6Hz,1H),3.77(dd,J=11.5,3.8Hz,1 H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,4.9,3. 8Hz,1H),2.41(d,J=0.7Hz,3H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.61(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.72,161.23,156.52,154.28,152.56,138.95,136.29,130.57,129.38,1 29.28,127.26,126.08,120.15,116.15,114.51,104.32,75.61,49.17,46.57,43.27,26.96,23.89,20.96,17.54.
[0088] Example 3 (S)-1-((R)-2-((6-methyl-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0089] The procedure was the same as in Example 1, except that 4-fluoro-resorcinol in the second step was replaced with 4-methyl-resorcinol to prepare compound 3. The characterization data for compound 3 are as follows:
[0090] 1 H NMR(500MHz,Chloroform-d)δ7.49(dd,J=7.8,1.7Hz,1H),7.43-7.27(m,3H),6.91 (s,1H),6.40(s,1H),5.15(q,J=6.5Hz,1H),3.77(dd,J=11.5,3.8Hz,1H),3.56(dd ,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,5.0,3.8Hz,1H),2 .41(d,J=0.7Hz,3H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.61(d,J=6.6Hz,2H). 13C NMR(125MHz,Chloroform-d)δ175.74,171.79,161.21,159.43,153.80,153.35,139.00,135.96,130.57,129.28,128. 78,127.26,126.08,125.85,114.84,114.62,100.69,75.35,49.16,46.58,43.27,26.96,23.89,20.96,17.62,16.12.
[0091] Example 4 (S)-1-((R)-2-((6-methoxy-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0092] The procedure was the same as in Example 1, except that 4-fluoro-resorcinol in the second step was replaced with 4-methoxy-resorcinol to prepare compound 4.
[0093] The characterization data for compound 4 are as follows:
[0094] 1 H NMR(500MHz,Chloroform-d)δ7.48(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,3H),6.82 (s,1H),6.40(s,1H),5.16(q,J=6.4Hz,1H),3.85(s,2H),3.77(dd,J=11.5,3.8Hz,1 H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.6,6.6,4.9,3. 8Hz, 1H), 2.41 (d, J = 0.7Hz, 3H), 1.99-1.82 (m, 2H), 1.81-1.65 (m, 2H), 1.60 (s, 1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.60,161.13,152.96,150.55,149.65,148.12,138.99,136.31,130.57,129. 28,127.24,126.09,115.24,114.65,112.65,103.92,75.34,55.96,49.17,46.57,43.27,26.96,23.89,20.96,17.83.
[0095] Example 5 (S)-1-((R)-2-((8-chloro-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0096] The procedure was the same as in Example 1, except that 4-fluoro-resorcinol in the second step was replaced with 2-chloro-resorcinol to prepare compound 5. The characterization data for compound 5 are as follows:
[0097] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,4H),6.94 (d,J=8.8Hz,1H),6.41(s,1H),5.24(q,J=6.4Hz,1H),3.77(dd,J=11.5,3.8Hz,1H) ,3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,5.0,3.8 Hz, 1H), 2.41 (d, J = 0.7Hz, 3H), 1.99-1.82 (m, 2H), 1.81-1.65 (m, 2H), 1.61 (s, 1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.72,159.48,156.09,152.22,151.56,138.97,136.06,130.57,129.28,1 27.74,127.34,126.08,117.98,114.47,114.05,111.27,75.52,49.17,46.57,43.27,26.96,23.89,20.96,17.82.
[0098] Example 6 (S)-1-((R)-2-((3-chloro-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0099] The procedure is the same as in Example 1, except that a chlorination reaction is added between the first and second steps:
[0100] Ethyl benzoyl chloride (9.0 mL, 10 g, 52 mmol) was dissolved in 40 mL of CHCl2 and cooled to 0 °C in an ice bath. Then, thioyl chloride (4.4 mL, 7.4 g, 55 mmol) was added dropwise. After the addition was complete, the mixture was stirred at room temperature for 1 hour, then refluxed for 2 hours. After cooling to room temperature, the turbid yellow solution was washed successively with water, saturated NaHCO3, water, and brine. The solution was dried over anhydrous Na2SO4, and the solvent was concentrated to give ethyl 2-chloro-3-oxo-3-phenylpropionate. Characterization data for compound 6 are as follows:
[0101] 1 H NMR(500MHz,Chloroform-d)δ7.56-7.49(m,2H),7.40-7.27(m,3H),7.09(s,1 H),6.89(dd,J=9.1,2.3Hz,1H),5.12(q,J=6.6Hz,1H),3.77(dd,J=11.5,3.8Hz ,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6 ,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.36(d,J=6.4Hz,3H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.78,161.40,159.21,154.85,150.35,139.92,136.82,130.56,129.72,1 29.59,129.43,125.72,119.45,114.38,113.68,104.64,74.55,49.16,46.58,43.27,26.96,23.89,20.88,17.54.
[0102] Example 7 (S)-1-((R)-2-((5-chloro-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0103] The procedure was the same as in Example 1, except that 4-fluoro-resorcinol in the second step was replaced with 5-chloro-resorcinol to prepare compound 7. The characterization data for compound 7 are as follows:
[0104] 1H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.42-7.27(m,3H),7.02(d ,J=2.2Hz,1H),6.88(d,J=2.2Hz,1H),6.40(s,1H),5.13(q,J=6.6Hz,1H),3.77(dd,J =11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7. 7,6.6,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.36(d,J=6.4Hz,3H). 13 CNMR(125MHz,Chloroform-d)δ175.74,171.78,160.35,158.94,153.80,153.59,139.10,136.23,130.75,130.59, 129.28,126.32,126.09,116.37,115.81,114.72,103.62,74.67,49.16,46.58,43.27,26.96,23.89,20.96,17.62.
[0105] Example 8 (S)-1-((R)-2-((4-(2-chlorophenyl)-6-methyl-2-carbonyl-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0106] The procedure was the same as in Example 3, except that 2-methylacetophenone in the first step was replaced with 2-chloroacetophenone to obtain compound 8. The characterization data for compound 8 are as follows:
[0107] 1 H NMR(500MHz,Chloroform-d)δ7.64(dd,J=7.8,1.6Hz,1H),7.52(dd,J=7.9,1.4Hz,1H),7.4 2(td,J=7.6,1.4Hz,1H),7.38-7.29(m,2H),6.93(s,1H),6.56(s,1H),5.15(q,J=6.5Hz,1H ),3.77(dd,J=11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(ddd d,J=7.6,6.6,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.61(d,J=6.6Hz,3H).13 C NMR(125MHz,Chloroform-d)δ175.74,171.79,161.21,159.43,154.57,151.39,135.30,133.35,130.47,130.40,1 30.35,129.40,127.34,125.85,115.14,115.12,100.71,75.35,49.16,46.58,43.27,26.96,23.89,17.62,16.13.
[0108] Example 9 (S)-1-((R)-2-((4-(2-chlorophenyl)-6-fluoro-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0109] The procedure was the same as in Example 1, except that 2-methylacetophenone in the first step was replaced with 2-chloroacetophenone to obtain compound 9. The characterization data for compound 9 are as follows:
[0110] 1 H NMR(500MHz,Chloroform-d)δ7.65(dd,J=7.8,1.6Hz,1H),7.52(dd,J=7.9,1.4Hz,1H),7.4 2(td,J=7.6,1.4Hz,1H),7.36-7.29(m,2H),6.91(d,J=4.3Hz,1H),6.55(s,1H),5.20(q,J= 6.6Hz,1H),3.77(dd,J=11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H), 2.68(dddd,J=7.6,6.6,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.63,161.23,153.55,153.53,151.55,150.67,150.64,149.57,148.26,148.15,136.14,133.19,1 30.53,130.40,130.35,127.34,117.10,116.91,116.60,116.54,115. 14,106.20,106.15,75.17,49.17,46.57,43.27,26.96,23.89,17.83.
[0111] Example 10 (S)-1-((R)-2-((4-(2-chloro-4-fluorophenyl)-6-fluoro-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0112] The procedure was the same as in Example 1, except that the 2-methylacetophenone in the first step was replaced with 2-chloro-4-fluoroacetophenone to obtain compound 10. The characterization data for compound 10 are as follows:
[0113] 1 H NMR(500MHz,Chloroform-d)δ7.57(dd,J=8.3,5.0Hz,1H),7.37-7.29(m,2H),7.16(d dd,J=10.4,8.4,2.2Hz,1H),6.91(d,J=4.3Hz,1H),6.55(s,1H),5.20(q,J=6.6Hz,1H) ,3.77(dd,J=11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68( dddd,J=7.6,6.6,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.63,163.76,161.79,161.23,153.60,15 3.57,151.55,150.36,150.33,149.57,148.26,148.15,134.61,134.53,132.30,1 32.28,132.20,132.13,118.21,118.01,117.10,116.91,116.48,116.43,114.77,114.46,114.28,106.20,106.15,75.17,49.17,46.57,43.27,26.96,23.89,17.83.
[0114] Example 11 (S)-1-((R)-2-((4-(2-isopropylphenyl)-6-methyl-2-carbonyl-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0115] The procedure is the same as in Example 1, except that the 2-methylacetophenone in the first step is replaced with 2-isopropylacetophenone to obtain compound 11. The characterization data of compound 11 are as follows:
[0116] 1H NMR(500MHz,Chloroform-d)δ7.48-7.36(m,2H),7.33(dd,J=3.6,2.3Hz,1H), 6.81(s,1H),6.36(s,1H),5.23(q,J=6.4Hz,1H),3.68-3.58(m,2H),3.38-3.2 5(m,3H),2.67(dddd,J=8.0,6.1,4.9,4.2Hz,1H),1.87-1.73(m,3H),1.68-1. 58(m,1H),1.56(d,J=6.4Hz,3H),1.28(d,J=6.8Hz,3H),1.23(d,J=7.0Hz,3H). 13 C NMR(125MHz,Chloroform-d)δ174.92,170.44,161.15,158.33,153.90,152.85,147.06,136.02,129.80,129.21,127.98, 127.58,126.54,125.22,116.40,113.55,100.60,74.40,47.11,46.74,41.71,30.16,26.44,23.72,23.55,17.56,16.27.
[0117] Example 12 (S)-1-((R)-2-((6-fluoro-4-(4-fluoro-2-methylphenyl)-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0118] The procedure is the same as in Example 1, except that the 2-methylacetophenone in the first step is replaced with 2-methyl-4-fluoroacetophenone to obtain compound 12. The characterization data of compound 12 are as follows:
[0119] 1 H NMR(500MHz,Chloroform-d)δ7.49(dd,J=8.0,5.0Hz,1H),7.30(s,0H),7.11(ddd ,J=10.1,8.0,2.2Hz,1H),7.01-6.95(m,1H),6.86(d,J=4.3Hz,1H),6.36(s,1H), 5.25(q,J=6.5Hz,1H),3.68-3.58(m,2H),3.38-3.30(m,2H),2.67(dddd,J=7.8,6 .2,4.9,4.2Hz,1H),1.87-1.73(m,3H),1.69-1.58(m,1H),1.55(d,J=6.4Hz,3H). 13C NMR(125MHz,Chloroform-d)δ174.92,170.35,163.41,161.44,161.15,152.85,152.8 3,151.89,151.86,151.66,149.67,148.11,148.00,138.98,138.92,134.33,134.31, 129.09,129.02,116.34,116.16,116.11,115.92,115.45,115.40,113.54,112.75,112.57,104.49,104.44,74.27,47.11,46.74,41.71,26.44,23.73,20.18,20.14,17.82.
[0120] Example 13 (S)-1-((R)-2-((6-fluoro-4-(2-fluorophenyl)-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0121] The procedure was the same as in Example 1, except that 2-methylacetophenone in the first step was replaced with 2-fluoroacetophenone to obtain compound 13. The characterization data for compound 13 are as follows:
[0122] 1 H NMR(500MHz,Chloroform-d)δ7.71(ddd,J=8.6,3.9,1.7Hz,1H),7.50-7.31(m,2H) ,7.30-7.23(m,1H),6.91(d,J=4.3Hz,1H),6.51(s,1H),5.20(q,J=6.6Hz,1H),3.77 (dd,J=11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dd dd,J=7.6,6.6,4.9,3.8Hz,1H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13CNMR(125MHz,Chloroform-d)δ175.74,171.63,162.48,161.21,160.49,153.71,153.69,151 .51,149.53,149.38,149.35,149.33,149.30,148.26,148.15,131.38,131.33,131.14,131. 08,125.90,125.79,125.36,125.34,117.23,117.05,115.91,115.74,115.01,114.97,114.67,114.64,114.62,114.59,106.19,106.14,75.17,49.17,46.57,43.27,26.96,23.89,17.83.
[0123] Example 14 (S)-1-((R)-2-((6-fluoro-2-carbonyl-4-(m-benzyl)-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0124] The procedure was the same as in Example 1, except that the 2-methylacetophenone in the first step was replaced with 3-methylacetophenone to obtain compound 14. The characterization data for compound 14 are as follows:
[0125] 1 H NMR(500MHz,Chloroform-d)δ7.63-7.57(m,1H),7.42-7.35(m,1H),7.32(s,0H),7.2 5-7.19(m,2H),6.91(d,J=4.3Hz,1H),6.54(s,1H),5.20(q,J=6.6Hz,1H),3.77(dd,J= 11.5,3.8Hz,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.6, 6.6,4.9,3.8Hz,1H),2.35(s,2H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13C NMR(125MHz,Chloroform-d)δ175.74,171.63,161.31,155.60,155.57,153.09,153.07,151.79,149.81,148.26,148.14,140.33,135.77,130. 80,128.54,127.40,126.49,117.97,117.78,115.99,115.93,112.23,1 06.25,106.20,75.17,49.17,46.57,43.27,26.96,23.89,21.28,17.83.
[0126] Example 15 (S)-1-((R)-2-((6-fluoro-2-carbonyl-4-(p-phenylmethyl)-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0127] The procedure was the same as in Example 1, except that the 2-methylacetophenone in the first step was replaced with 4-methylacetophenone to obtain compound 15. The characterization data for compound 15 are as follows:
[0128] 1 H NMR(500MHz,Chloroform-d)δ7.60-7.54(m,2H),7.39-7.32(m,2H),6.91(d,J=4 .3Hz,1H),6.49(s,1H),5.20(q,J=6.6Hz,1H),3.77(dd,J=11.5,3.8Hz,1H),3.5 6(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,5.0,3.8Hz ,1H),2.42(d,J=0.9Hz,2H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.63,161.40,156.03,156.00,153.07,153.05,151.79,149.81,148.26,148.14,139.47,133. 91,129.66,129.04,117.99,117.80,116.12,116.07,111.60,106.25,106.20,75.17,49.17,46.57,43.27,26.96,23.89,21.37,17.83.
[0129] Example 16 (S)-1-((R)-2-((4-(2,6-dimethylphenyl)-6-fluoro-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0130] The procedure was the same as in Example 1, except that the 2-methylacetophenone in the first step was replaced with 2,6-dimethylacetophenone to obtain compound 16. The characterization data for compound 16 are as follows:
[0131] 1 H NMR(500MHz,Chloroform-d)δ7.27-7.19(m,1H),7.19-7.12(m,1H),6.88(d,J =4.3Hz,1H),6.30(s,1H),5.20(q,J=6.6Hz,1H),3.77(dd,J=11.5,3.8Hz,1H) ,3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.6,6.6,5.0 ,3.8Hz,1H),2.35(s,5H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.63,161.49,153.73,153.70,153.35,153.33,151.56,149.58,148.26,148.14,138.35,136. 36,128.67,127.31,117.48,115.45,115.40,114.42,114.23,106.20,106.15,75.17,49.17,46.57,43.27,26.96,23.89,20.27,17.83.
[0132] Example 17 (S)-1-((R)-2-((4-(2-fluorophenyl)-6-methyl-2-carbonyl-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0133] The procedure was the same as in Example 11, except that the first step raw material was replaced with 2-fluoroacetophenone to prepare compound 17. The characterization data of compound 17 are as follows:
[0134] 1H NMR(500MHz,Chloroform-d)δ7.70(ddd,J=8.7,3.9,1.7Hz,1H),7.50-7.36(m,2H),7.2 7(ddd,J=10.1,7.8,1.6Hz,1H),6.93(s,1H),6.50(s,1H),5.15(q,J=6.5Hz,1H),3.77(d d, J=11.5, 3.8Hz, 1H), 3.56 (dd, J=11.5, 6.6Hz, 1H), 3.44-3.32 (m, 2H), 2.68 (dddd, J=7. 7,6.6,5.0,3.8Hz,1H),2.31(s,2H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.62(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.79,162.51,161.19,160.52,159 .43,154.40,149.50,149.44,131.29,131.24,131.14,131.08,129.54,125. 84,125.36,125.35,125.34,125.24,115.91,115.74,115.22,115.18,111.9 3,111.90,100.71,75.35,49.16,46.58,43.27,26.96,23.89,17.62,16.13.
[0135] Example 18 (S)-1-((R)-2-((6-methyl-2-carbonyl-4-(m-phenylmethyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0136] The procedure was the same as in Example 17, except that the first step raw material was replaced with 3-methylacetophenone to prepare compound 18. The characterization data of compound 18 are as follows:
[0137] 1H NMR(500MHz,Chloroform-d)δ7.58(ddd,J=7.7,2.0,1.3Hz,1H),7.42-7.35(m,1H),7.2 5-7.19(m,2H),6.93(s,1H),6.55(s,1H),5.15(q,J=6.5Hz,1H),3.77(dd,J=11.5,3.8H z,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,4.9,3. 8Hz,1H),2.35(s,2H),2.31(s,2H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ175.74,171.79,161.28,159.43,155.69,153.78,140.33,135.17,130.80,130.18,128. 56,127.42,126.45,125.83,114.93,112.24,100.71,75.35,49.16,46.58,43.27,26.96,23.89,21.28,17.62,16.12.
[0138] Example 19 (S)-1-((R)-2-((6-methyl-2-carbonyl-4-(p-phenylmethyl)-2H-chromen-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0139] The procedure was the same as in Example 18, except that the first step raw material was replaced with 4-methylacetophenone to prepare compound 19. The characterization data of compound 19 are as follows:
[0140] 1 H NMR(500MHz,Chloroform-d)δ7.59-7.53(m,2H),7.38-7.32(m,2H),6.93(s,1H) ,6.50(s,1H),5.15(q,J=6.5Hz,1H),3.77(dd,J=11.5,3.8Hz,1H),3.56(dd,J=1 1.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.7,6.6,5.0,3.8Hz,1H),2.4 2(d,J=0.9Hz,2H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.61(d,J=6.6Hz,2H). 13C NMR(125MHz,Chloroform-d)δ175.74,171.79,161.36,159.43,155.71,153.76,139.47,133.29,130.20,129. 66,129.04,125.83,114.62,111.82,100.71,75.35,49.16,46.58,43.27,26.96,23.89,21.37,17.62,16.12.
[0141] Example 20 (S)-1-((R)-2-((4-(2,6-dimethylphenyl)-6-methyl-2-carbonyl-2H-chromene-7-yl)oxo)propionyl)piperidine-3-carboxylic acid
[0142] The procedure was the same as in Example 18, except that the first step raw material was replaced with 2,6-dimethylacetophenone to prepare compound 20. The characterization data of compound 20 are as follows:
[0143] 1 H NMR(500MHz,Chloroform-d)δ7.31-7.27(m,1H),7.22(dt,J=2.1,0.9Hz,1H),7.19-7 .12(m,1H),6.90(s,1H),6.31(s,1H),5.15(q,J=6.5Hz,1H),3.77(dd,J=11.5,3.8Hz ,1H),3.56(dd,J=11.5,6.6Hz,1H),3.44-3.32(m,2H),2.68(dddd,J=7.6,6.6,5.0,3 .8Hz,1H),2.35(s,5H),1.99-1.82(m,2H),1.81-1.65(m,2H),1.61(d,J=6.6Hz,2H). 13 CNMR(125MHz,Chloroform-d)δ175.74,171.79,161.41,159.43,155.48,154.02,138.46,135.84,128.67,127 .36,127.28,125.87,117.56,113.67,100.68,75.35,49.16,46.58,43.27,26.96,23.89,20.29,17.62,16.12.
[0144] Example 21(R)-6-fluoro-7-((1-carbonyl-1-(piperidin-1-yl)propane-2-yl)oxo)-4-(o-benzyl)-2H-chromen-2-one
[0145] The procedure was the same as in Example 1, except that the starting material in step 5 was replaced with piperidine to prepare compound 21. The characterization data of compound 21 are as follows:
[0146] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.6Hz,1H),7.43-7.26(m,2H),6.89(d,J=4.3Hz,1H ),6.40(s,0H),5.18(q,J=6.5Hz,1H),3.42-3.30(m,3H),2.41(d,J=0.7Hz,2H),1.67-1.54(m,4H). 13 C NMR(125MHz,Chloroform-d)δ171.64,161.24,153.22,153.20,153.03,152.99,151.81,149.83,148.26,148.14,138.99,136.63,130.5 7,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.22,106.17,75.00,74.99,47.09,25.56,24.33,20.96,17.83.
[0147] Example 22(R)-N,N-diethyl-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)propionamide
[0148] The procedure was the same as in Example 1, except that the starting material in step 5 was replaced with diethylamine to prepare compound 22. The characterization data of compound 22 are as follows:
[0149] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.26(m,2H),6.89(d,J=4.3Hz,1H),6.40( s,1H),5.20(q,J=6.6Hz,1H),3.51-3.37(m,3H),2.41(d,J=0.7Hz,2H),1.64(s,1H),1.08(t,J=7.1Hz,4H). 13C NMR(125MHz,Chloroform-d)δ170.60,161.24,153.20,153.17,153.03,152.99,151.48,149.50,148.35,148.24,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.23,106.18,74.58,41.22,20.96,17.82,13.36.
[0150] Example 23(R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)-N,N-dimethylpropionamide
[0151] The procedure was the same as in Example 1, except that the starting material in step 5 was replaced with dimethylamine to prepare compound 23. The characterization data of compound 23 are as follows:
[0152] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.6Hz,1H),7.43-7.26(m,3H),6.89(d, J=4.3Hz,1H),6.40(s,1H),5.29(q,J=5.9Hz,1H),2.93(s,4H),1.36(d,J=5.7Hz,3H). 13 C NMR(125MHz,Chloroform-d)δ173.92,161.24,153.20,153.17,153.03,152.99,151.48,149.50,148.30,148.19,138.99,136 .63,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.23,106.18,72.13,36.92,20.96,17.79.
[0153] Example 24(R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)-N-isopropylpropionamide
[0154] The procedure was the same as in Example 1, except that the raw material in step 5 was replaced with isopropylamine to prepare compound 24. The characterization data of compound 24 are as follows:
[0155] 1H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,2H),6.91-6.84(m,1H),6.40(s,1H) ,5.09(q,J=5.6Hz,1H),3.96(dhept,J=8.0,5.6Hz,1H),1.38(d,J=5.7Hz,2H),1.17(dd,J=15.7,5.6Hz,4H). 13 C NMR(125MHz,Chloroform-d)δ173.64,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.87,147.76,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,75.22,41.73,22.61,20.96,17.33.
[0156] Example 25(R)-6-fluoro-7-((1-carbonyl-1-(piperidin-1-yl)propane-2-yl)oxo)-4-(2-(trifluoromethyl)phenyl)-2H-chromen-2-one
[0157] The procedure is the same as in Example 21, except that the first step involves replacing the raw material with 2-trifluoromethylacetophenone to prepare compound 25. The characterization data of compound 25 are as follows: 1 H NMR(500MHz,Chloroform-d)δ7.79-7.72(m,2H),7.57(ddd,J=10.6,6.8,1.6Hz,1H),7.48(td,J=7.1,1.5Hz,1H ),7.34(s,0H),6.97(d,J=4.2Hz,1H),6.46(s,1H),5.18(q,J=6.5Hz,1H),3.42-3.30(m,4H),1.67-1.54(m,3H). 13CNMR(125MHz,Chloroform-d)δ171.64,161.19,153.91,153.88,153.85,153.82,153.79,153.05,153.03,151.5 5,149.57,148.26,148.14,134.96,134.94,134.91,134.89,130.66,130.63,130.61,130.58,129.98,129.73,1 29.48,129.23,128.81,128.42,128.39,128.36,128.33,127.58,127.56,127.53,127.50,127.36,125.16,122.97,120.78,116.67,116.49,115.11,114.39,114.34,106.20,106.15,75.00,74.99,47.09,25.56,24.33,17.83.
[0158] Example 26(R)-N-ethyl-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)propionamide
[0159] The procedure was the same as in Example 1, except that the starting material in step five was replaced with ethylamine to prepare compound 26. The characterization data of compound 26 are as follows:
[0160] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.26(m,3H),6.89(d,J=4.3Hz,1H),6.40(s,1H),5 .09(q,J=5.9Hz,1H),3.26(pdd,J=7.9,3.9,2.0Hz,2H),2.41(d,J=0.7Hz,2H),1.39(s,1H),1.24(t,J=6.2Hz,2H). 13 C NMR(125MHz,Chloroform-d)δ173.45,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.84,147.73,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,75.49,35.88,20.96,17.24,14.86.
[0161] Example 27(R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)-N-methylpropionamide
[0162] The procedure was the same as in Example 1, except that the starting material in step five was replaced with methylamine to prepare compound 27. The characterization data of compound 27 are as follows:
[0163] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,2H),6.89(d,J=4.3Hz,1H),6.40(s, 0H), 6.23 (q, J = 4.8Hz, 1H), 5.10 (q, J = 5.5Hz, 1H), 2.78 (d, J = 4.8Hz, 2H), 2.41 (d, J = 0.7Hz, 2H), 1.40 (s, 1H). 13 C NMR(125MHz,Chloroform-d)δ175.05,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.85,147.74,138.99,136 .63,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,74.28,25.94,20.96,17.22.
[0164] Example 28(R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)-N-(2-hydroxyethyl)propionamide
[0165] The procedure was the same as in Example 1, except that the raw material in step five was replaced with ethanolamine to prepare compound 28. The characterization data of compound 28 are as follows:
[0166] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,3H),7.12(t,J=5.3Hz,1H),6.89(d,J=4.3Hz,1H ),6.40(s,1H),5.92(t,J=5.7Hz,1H),5.08(q,J=5.9Hz,1H),3.74-3.64(m,2H),3.30-3.16(m,2H),1.38(d,J=5.9Hz,3H). 13C NMR(125MHz,Chloroform-d)δ173.72,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.84,147.72,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,75.62,60.83,42.90,20.96,17.24.
[0167] Example 29 (R)-6-methyl-7-((1-carbonyl-1-(piperidin-1-yl)propane-2-yl)oxo)-4-(o-benzyl)-2H-chromen-2-one
[0168] The procedure is the same as in Example 21, except that in the second step, the raw material is replaced with 4-methylresorcinol to prepare compound 29. The characterization data of compound 29 are as follows:
[0169] 1 H NMR(500MHz,Chloroform-d)δ7.49(dd,J=7.8,1.7Hz,1H),7.43-7.27(m,2H),6.91(s,1H),6. 40(s,1H),5.14(q,J=6.4Hz,1H),3.42-3.30(m,3H),2.41(d,J=0.7Hz,2H),1.66-1.54(m,6H). 13 C NMR(125MHz,Chloroform-d)δ172.13,161.21,159.43,153.80,153.35,139.00,135.96,130.57,129.28,1 28.78,127.26,126.08,125.85,114.84,114.62,100.69,75.14,47.09,25.56,24.33,20.96,17.55,16.12.
[0170] Example 30(R)-N,N-diethyl-2-((6-methyl-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)propionamide
[0171] The procedure is the same as in Example 21, except that in step five, the starting material is replaced with diethylamine to prepare compound 30. The characterization data of compound 30 are as follows:
[0172] 1H NMR(500MHz,Chloroform-d)δ7.49(dd,J=7.8,1.7Hz,1H),7.43-7.27(m,2H),6.93(s,1H),6.40(s,1H),5.21 (q,J=6.6Hz,1H),3.51-3.37(m,3H),2.41(d,J=0.7Hz,2H),2.31(s,2H),1.63(s,1H),1.08(t,J=7.1Hz,4H). 13 C NMR(125MHz,Chloroform-d)δ171.63,161.21,159.47,153.80,153.35,139.00,135.96,130.57,129.2 8,128.78,127.26,126.08,125.68,114.84,114.62,100.70,74.83,41.13,20.96,17.52,16.12,13.36.
[0173] Example 31(R)-6-fluoro-7-((1-carbonyl-1-(pyrrolidin-1-yl)propane-2-yl)oxo)-4-(o-benzylmethyl)-2H-chromen-2-one
[0174] The procedure was the same as in Example 1, except that the starting material in step five was replaced with tetrahydropyrrole, to prepare compound 31. The characterization data of compound 31 are as follows:
[0175] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.6Hz,1H),7.43-7.26(m,2H),6.89(d,J=4.3Hz,1H),6.40( s,1H),5.18(q,J=6.5Hz,1H),3.48-3.36(m,3H),2.41(d,J=0.7Hz,2H),1.85(t,J=4.1Hz,3H),1.60(s,1H). 13 C NMR(125MHz,Chloroform-d)δ172.15,161.24,153.22,153.20,153.03,152.99,151.81,149.83,148.26,148.14,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.22,106.17,74.99,47.96,24.98,20.96,17.83.
[0176] Example 32(R)-6-fluoro-7-((1-morpholino-1-carbonylpropane-2-yl)oxo)-4-(o-benzylmethyl)-2H-chromen-2-one
[0177] The procedure was the same as in Example 1, except that the raw material in step 5 was replaced with morpholine to prepare compound 32. The characterization data of compound 32 are as follows:
[0178] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,2H),6.89(d,J=4.3Hz, 1H), 6.40 (s, 1H), 5.20 (q, J = 6.5Hz, 1H), 3.75-3.57 (m, 5H), 2.41 (d, J = 0.7Hz, 2H), 1.60 (s, 1H). 13 C NMR(125MHz,Chloroform-d)δ171.31,161.24,153.22,153.20,153.03,152.99,151.81,149.83,148.26,148.15,138.99,136.63 ,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.22,106.17,75.07,66.49,46.47,20.96,17.83.
[0179] Example 33(R)-2-((6-methyl-2-carbonyl-4-(o-phenylmethyl)-2H-chromene-7-yl)oxo)-N-phenylpropionamide
[0180] The procedure was the same as in Example 30, except that the raw material in step five was replaced with aniline to prepare compound 33. The characterization data of compound 33 are as follows:
[0181] 1 H NMR(500MHz,Chloroform-d)δ8.98(s,1H),7.62-7.56(m,2H),7.49(dd,J=7.8,1.7Hz,1H),7.43-7.27(m,5H),7.05( tt,J=7.0,1.1Hz,1H),6.93(s,1H),6.40(s,1H),5.10(q,J=5.7Hz,1H),2.41(d,J=0.7Hz,3H),1.45(d,J=5.7Hz,3H). 13C NMR(125MHz,Chloroform-d)δ171.43,161.21,159.20,153.80,153.35,139.00,138.32,135.96,130.57,129.28 ,129.16,128.78,127.26,126.08,125.71,125.62,121.30,114.84,114.62,100.70,76.83,20.96,17.26,16.12.
[0182] Example 34(R)-2-((6-methyl-2-carbonyl-4-(o-benzyl)-2H-chromen-7-yl)oxo)-N-(pyridin-2-yl)propionamide
[0183] The procedure was the same as in Example 30, except that the starting material in step five was replaced with 2-aminopyridine to prepare compound 34. The characterization data of compound 34 are as follows:
[0184] 1 H NMR(500MHz,Chloroform-d)δ9.58(s,1H),8.30(dd,J=4.3,1.8Hz,1H),7.80(td,J=7.3,1.7Hz,1H),7.56(dd,J=7.5,1.4Hz,1H),7.49(dd,J=7.8,1.7Hz, 1H),7.43-7.27(m,2H),7.12(ddd,J=7.1,4.4,1.5Hz,1H),6.93(s,1H),6.40 (s,1H),5.24(q,J=5.7Hz,1H),2.41(d,J=0.7Hz,2H),1.44(d,J=5.7Hz,2H). 13 C NMR(125MHz,Chloroform-d)δ172.05,161.21,159.22,153.80,153.35,151.62,149.62,139.08,139.00,135.96,130 .57,129.28,128.78,127.26,126.08,125.62,120.35,114.84,114.62,114.15,100.68,76.44,20.96,17.27,16.12.
[0185] Example 35(R)-N-cyclopropyl-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)propionamide
[0186] The procedure is the same as in Example 1, except that the raw material in step five is replaced with cyclopropylamine. The characterization data of compound 35 are as follows:
[0187] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.27(m,3H),6.94(d,J=7.3Hz,1H),6.89(d,J=4.3Hz,1H),6.40(s,1H) ,5.09(q,J=5.6Hz,1H),3.23(dp,J=7.5,4.6Hz,1H),1.38(d,J=5.7Hz,3H),0.99(dd,J=10.7,4.7Hz,2H),0.74(dd,J=10.8,4.6Hz,2H). 13 C NMR(125MHz,Chloroform-d)δ173.21,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.87,147.76,138.99,136.6 3,130.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,75.57,23.15,20.96,17.33,8.51.
[0188] Example 36(R)-2-((6-fluoro-2-carbonyl-4-(o-benzyl)-2H-chromene-7-yl)oxo)-N-(3-hydroxypropyl)propionamide
[0189] The procedure was the same as in Example 1, except that the starting material in step 5 was replaced with propanolamine to prepare compound 36. The characterization data of compound 38 are as follows:
[0190] 1 H NMR(500MHz,Chloroform-d)δ7.50(dd,J=7.9,1.7Hz,1H),7.43-7.26(m,3H),7.10(t,J=4.9Hz,1H),6.89(d,J=4.3Hz,1H),6.40(s,1H),5.09(q ,J=5.9Hz,1H),3.65(dd,J=6.0,5.1Hz,1H),3.57(q,J=5.6Hz,2H),3.26-3.13(m,2H),2.41(d,J=0.7Hz,3H),1.63(p,J=5.9Hz,2H),1.39(s,2H). 13C NMR(125MHz,Chloroform-d)δ173.80,161.24,153.20,153.17,153.03,152.99,151.44,149.46,147.84,147.73,138.99,136.63,13 0.57,129.28,127.24,126.09,116.30,116.12,115.91,115.86,114.78,106.21,106.16,75.62,59.22,38.24,32.70,20.96,17.24.
[0191] In the following embodiments, the inventors used some compounds of the present invention as examples to detect the anti-cancer cell proliferation activity of the compounds of the present invention and to assess cell activity using real-time quantitative PCR.
[0192] Example 37 Anti-cell proliferation activity test
[0193] Pancreatic cancer cells MIA-PaCa-2, liver cancer cells Hep-G2, and lung cancer cells A549 (derived from ATCC, USA) were seeded at 2000 cells / well in 96-well plates. The following day, compounds prepared in this invention (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, 10 μM, 100 μM) were added, and cell viability was then measured according to the following SRB assay:
[0194] 1) Cell fixation: 168 hours after drug administration, aspirate the culture medium from the wells and add 200 μL of 10% TCA (trichloroacetic acid) solution pre-cooled at 4°C to each well to fix the cells. After standing for 5 min, transfer to a 4°C refrigerator for 1 h of fixation. Remove and rinse 5 times with deionized water, then air dry at room temperature.
[0195] 2) Staining: After the 96-well plate has dried at room temperature, add 100 μL of 0.4% (w / v) SRB staining solution (prepared with 1% acetic acid) to each well. After staining for 30 min, discard the staining solution and rinse 5 times with 1% (v / v) acetic acid to remove unbound dye. Let it air dry at room temperature.
[0196] 3) Detection: Dissolve the dye bound to cellular proteins in 100 μL of unbuffered Tris-base solution (10 mM, pH = 10.5), shake on a horizontal shaker for 20 min, and measure the absorbance at 545 nM using a microplate reader. The inhibition rate is calculated as: [1 - (change in absorbance of experimental group / change in absorbance of blank group)] × 100%. The compound is then subjected to IC50 assay. 50The IC50 was determined by measuring the inhibition rate at six concentrations of the target compound (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM). A linear regression was performed between the negative logarithm of the molar concentration and the inhibition rate. The concentration at which the inhibition rate reached 50% was then identified as the IC50 of the compound. 50 value.
[0197] Example 38 Real-time quantitative PCR
[0198] Using the MIA-PaCa-2 cell line, 500,000 cells / well were seeded in 6-well plates. The next day, a 100 nM concentration of the compound was added and incubated for 6 hours. RNA was then extracted using a kit, and the RNA concentration was measured and reverse transcribed. ND1 primers (F: TCCTGCCATCATGACCCTTG, R: CTGCGGCGTATTCGATGTTG) were then added and amplified using a real-time quantitative PCR instrument to obtain the changes in the amount of ND1-related RNA in the compound.
[0199] Table 1: Activity data of some compounds of the present invention
[0200]
[0201]
[0202]
[0203] a The fold increase in ND1 mRNA expression level in the treatment group relative to the blank control group (MIA-PaCa-2 cells)
[0204] As shown in Table 1, compound 1-36 exhibits stronger antiproliferative activity against MIA-PaCa-2, Hep-G2, and A5491 cell lines than the positive control drug IMT1B, and also shows stronger inhibition of mitochondrial-associated factor ND1 than the positive control drug IMT1B.
[0205] Example 39: Preferred compound's antiproliferative activity against different cell lines
[0206] Compounds 1, 3, 6, 13, 19, and 28, which showed superior activity, underwent further screening for expanded antiproliferative activity: SF295 glioma cells, A2780 ovarian cancer cells, SK-MEL-5 melanoma cells, HL-60 leukemia cells, MDA-MB-468 breast cancer cells, RAMOS lymphoma cells, DLD-1 colon cancer cells, and C33A cervical cancer cells (derived from the American College of Cancer Research, Inc.) were seeded at 2000 cells / well in 96-well plates. The following day, the compounds prepared in this invention (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, 10 μM, 100 μM) were added, and cell viability was subsequently determined using the following SRB assay:
[0207] Table 2: Screening of the antiproliferative activity of preferred compounds against different cell lines
[0208]
[0209] Note: The activity unit is IC. 50 (nM)
[0210] As can be seen from Table 2, the representative compound exhibits stronger antiproliferative activity against multiple cell lines than the positive control drug IMT1B.
[0211] Example 40: Treatment of human MIA-PaCa-2 pancreatic cancer xenografts in nude mice
[0212] On day 0, MIA-PaCa-2 cells in the exponential growth phase were subcutaneously transplanted into female Balb / c nude mice, which were then cultured in individually ventilated cages (IVCs). The diameter of the xenografts in the nude mice was measured using calipers. The tumors were cultured until they reached 100-150 mm in diameter. 3 The animals were then randomly divided into three groups of six each. After initial drug administration (see Table 2 for details), the antitumor effect of the test substance was dynamically observed using tumor diameter measurement. After drug administration, the mice were euthanized, and the tumor masses were surgically removed and weighed. The formula for calculating tumor volume (TV) is: TV = 1 / 2 × a × b 2 Where a and b represent length and width, respectively. The relative tumor volume (RTV) is calculated based on the measurement results using the formula: RTV = V t / V0. Where V0 is the tumor volume measured when the drug is administered in separate cages (i.e., d0), V t The tumor volume is used for each measurement. The evaluation index of antitumor activity is the relative tumor proliferation rate (T / C%), calculated using the following formula:
[0213]
[0214] T RTV Treatment group RTV; C RTV : Negative control group RTV.
[0215] Evaluation index of antitumor activity: tumor growth inhibition rate (%), calculated as follows:
[0216]
[0217] The animal's body weight and tumor length and short axis were measured every other day, and curves showing the changes in the animal's body weight and tumor volume were plotted.
[0218] Table 2
[0219] 1 6 physiological saline Oral administration via gavage 25 days - 2 6 Example 1 (Compound 1) Oral administration via gavage 25 days 100mg / kg 3 6 Example 3 (Compound 3) Oral administration via gavage 25 days 100mg / kg 4 6 Example 6 (Compound 6) Oral administration via gavage 25 days 100mg / kg 5 6 Example 13 (Compound 13) Oral administration via gavage 25 days 100mg / kg 6 6 Example 19 (Compound 19) Oral administration via gavage 25 days 100mg / kg 7 6 Example 28 (Compound 28) Oral administration via gavage 25 days 100mg / kg 8 6 Positive drug IMT1B Oral administration via gavage 25 days 100mg / kg
[0220] Experimental results: Compounds 1, 3, 6, 13, 19, and 28 showed good tolerance to treatment, and even after treatment with higher doses, [the condition improved]. Figure 2 As can be seen, there was no significant difference in body weight compared to the control group, and no signs of toxicity were observed. After administration of 100 mg / kg, from... Figure 1 It can be seen that mice treated with compounds 1, 3, 6, 13, 19, and 28 showed tumor growth inhibition and had a stronger tumor-suppressing effect than the positive control drug IMT-1B.
Claims
1. The compound represented by formula (I) or a pharmaceutically acceptable salt thereof: ; in: Q1 is selected from halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, and trifluoromethyl; Q2, Q3, and Q5 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, and isopropyl, respectively; Q4 is hydrogen; Q1, Q2, Q3, Q4, and Q5 are not all hydrogen. V1, V2, V3, and V4 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, and ethoxy, and not all of V1, V2, V3, and V4 are hydrogen. R and R1 are each independently selected from hydrogen or C. 1-6 alkyl; Y is -NR3R4, where R3 and R4 are each independently selected from hydrogen and C. 1-6 Alkyl, C 3-8 cycloalkyl, C 1-6 Hydroxyalkyl, C 6-10 aryl, 3-6 heteroaryl; or R3, R4 and their associated N form an unsubstituted or substituted 5- or 6-membered saturated heterocycle, the saturated heterocycle comprising heteroatoms selected from O or S, and substituents selected from halogen, cyano, hydroxyl or carboxyl groups.
2. The compound of formula (I) according to claim 1, or the compound of formula (I) or a pharmaceutically acceptable salt thereof, characterized in that, V1, V2, and V3 are each independently selected from hydrogen, halogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, and ethoxy. V4 is hydrogen. V1, V2, V3, and V4 are not all hydrogen.
3. The compound of formula (I) according to claim 1, or the compound of formula (I) or a pharmaceutically acceptable salt thereof, characterized in that, R and R1 are each independently selected from hydrogen, methyl, or ethyl, and R and R1 are not both hydrogen.
4. The compound of formula (I) according to claim 1, or the compound of formula (I) or a pharmaceutically acceptable salt thereof, characterized in that, Y is -NR3R4, where R3 and R4 are each independently selected from hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, C 1-3 Hydroxylalkyl, pyridyl, phenyl; or R3, R4 and the N attached to them form unsubstituted or substituted heterocycles such as pyrrolidine ring, piperidine ring, morpholine ring, piperazine ring.
5. The compound of formula (I) according to claim 4, or the compound of formula (I) or a pharmaceutically acceptable salt thereof, characterized in that, The substituent is a carboxyl group.
6. The compound shown in formula (II) or a pharmaceutically acceptable salt thereof: ; in, Q1, Q3, V2, and Y are defined as described in any one of claims 1-5.
7. The compound of formula (II) according to claim 6, or a pharmaceutically acceptable salt thereof, characterized in that, Q1 is selected from methyl, chlorine, and fluorine; Q3 is selected from hydrogen, methyl, chlorine, and fluorine; V2 is selected from hydrogen, methyl, chlorine, and fluorine; Y is... Or -NR3R4, where R3 and R4 are hydrogen or C. 1-3 Hydroxyalkyl.
8. The compound of formula (II) according to claim 7, or a pharmaceutically acceptable salt thereof, characterized in that, R3 is hydrogen, R4 is carbon. 1-3 Hydroxyalkyl.
9. A compound with any of the following structures, or a pharmaceutically acceptable salt thereof: 。 10. A pharmaceutical composition, characterized in that... The pharmaceutical composition comprises the compound shown in any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.
11. The use of the compound or a pharmaceutically acceptable salt thereof as described in any one of claims 1 to 9, or the pharmaceutical composition of claim 10, in the preparation of a medicament for treating POLRMT-mediated diseases, wherein the POLRMT-mediated diseases are selected from: lung cancer, pancreatic cancer, or liver cancer.