A bacillus subtilis mutant strain and application thereof in alkaline protease production

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to a mutant strain of Bacillus subtilis and its application in the production of alkaline protease. The applicant will utilize a strain derived from alkaline Bacillus (… Alkalihalobacillus xiaoxiensis The alkaline protease gene of Bacillus subtilis (Bacillus subtilis) Bacillus subtilis Overexpression in the host cell yielded a recombinant integrated expression strain. Further, by knocking out the antibiotic resistance marker gene in the alkaline protease expression, a recombinant strain without the antibiotic selection marker was obtained. This strain was then used as the starting material for UV mutagenesis, and a mutant strain exhibiting significantly increased alkaline protease expression was obtained. This mutant strain was deposited on December 5, 2022, at the China Center for Type Culture Collection (CCTCC), Wuhan University, China, with accession number CCTCC NO: M20221874. This mutant strain can be widely used in the production of alkaline protease, which is beneficial for reducing the production cost of this enzyme.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a Bacillus subtilis mutant strain and its application in the production of alkaline protease. Background Technology

[0002] Nearly two-thirds of the world's alkaline proteases are used in the detergent industry. Alkaline proteases can hydrolyze various protein-based stains, such as blood, sweat, and milk stains, and can release stains that are encapsulated by proteins or have enhanced adhesion to substrates due to proteins. They also exhibit good synergistic detergency with surfactants. The alkaline proteases in liquid detergents are almost all serine proteases produced by natural Bacillus microorganisms and their recombinant gene expression, possessing properties such as alkali resistance and surfactant resistance. Liquid detergents are typical environments for enzyme inactivation, containing various substances that can destroy the activity and stability of alkaline proteases, such as surfactants, chelating agents, and bleaching agents. Furthermore, autolysis and inactivation of enzymes are very common in liquid washing environments.

[0003] Alcalase, the first alkaline protease truly used in detergents, was isolated from Bacillus licheniformis by Novozymes in 1963. It exhibits excellent SDS (anionic surfactant) tolerance. Alkaline proteases isolated from natural extreme environments can maintain good conformation and activity in harsh liquid detergent environments, showing great potential for industrial production applications.

[0004] Currently, the main Bacillus species that produce alkaline proteases and the subjects of research include: Bacillus subtilis ( Bacillus subtilis ), Bacillus licheniformis ( Bacillus licheniformis ), Bacillus pumilus ( Bacillus pumilus ), Bacillus amyloliquefaciens ( Bacillus amyloliqueaciens ), alkalophilic Bacillus ( Bacillus alcalophilus ) and Bacillus clausti ( Bacillus clausii(Liu Yihan et al., 2008) etc. my country's alkaline protease industry is maturing, but the commonly used production strains and fermentation processes lack updates, resulting in output and cost that cannot compete with international giants (Yuan Yuan et al., 2021). Bacillus subtilis, as an important prokaryotic expression host, possesses a powerful protein secretion expression system and a relatively complete vector / host system, making it an ideal host for heterologous protease expression. Studies have found that optimizing Bacillus subtilis expression regulatory elements can significantly increase protease expression levels, thereby reducing costs and making it more suitable for large-scale production. In genetic engineering operations, selection markers are an important component of recombinant DNA vectors, typically used to verify the success of transformants. Currently, the commonly used selection marker in Bacillus expression systems is the antibiotic resistance gene. However, this novel pollutant, the antibiotic resistance gene, not only increases its abundance in host bacteria along with bacterial proliferation but also increases diversity, host range, and abundance through gene mutation and horizontal gene transfer. All of these indicate that antibiotic plasmids pose a significant threat to the public environment and health.

[0005] Therefore, we need to develop an antibiotic-free screening marker for use in liquid detergents, while also stabilizing high alkaline protease production by Bacillus subtilis. Summary of the Invention

[0006] This invention addresses the problems of existing technologies by providing a mutant strain of Bacillus subtilis that produces a high level of alkaline protease, and its applications. The applicant will utilize data derived from alkaline Bacillus (…). Alkalihalobacillus xiaoxiensis The alkaline protease gene of Bacillus subtilis (Bacillus subtilis) Bacillus subtilis Overexpression in the host cell yielded a recombinant integrated expression strain. Further, by knocking out the antibiotic resistance marker gene in the alkaline protease expression, a recombinant strain without the antibiotic selection marker was obtained. This strain was then used as the starting material for UV mutagenesis, and a mutant strain that significantly increased the expression level of alkaline protease was obtained. This mutant strain can be widely used in the production of alkaline protease, which is beneficial for reducing the production cost of this enzyme.

[0007] The present invention provides an engineered strain of Bacillus subtilis carrying a recombinant plasmid expressing an alkaline protease.

[0008] The nucleotide sequence of the alkaline protease is SEQ ID NO: 1, and the amino acid sequence it encodes is SEQ ID NO: 2.

[0009] This invention provides a mutant strain obtained by ultraviolet mutagenesis, named Bacillus subtilis APL02 (… Bacillus subtilis APL02 was deposited on December 5, 2022, at the China Center for Type Culture Collection in Wuhan, China, with accession number CCTCC NO: M20221874.

[0010] In one aspect, this invention provides the application of the Bacillus subtilis mutant strain in the production of alkaline protease.

[0011] The present invention also provides a method for producing alkaline protease, using the Bacillus subtilis mutant strain as the fermentation strain. Beneficial effects

[0012] This invention first provides an engineered Bacillus subtilis strain APL01 that integrates and expresses an alkaline protease gene without an antibiotic selection marker. The alkaline protease activity in the shake-flask fermentation supernatant of this strain reaches 18762 U / ml.

[0013] To increase the yield of alkaline protease, this invention uses Bacillus subtilis APL01 as the starting strain and obtains a mutant strain, Bacillus subtilis APL02, through UV mutagenesis screening. The mutant strain exhibits an alkaline protease activity as high as 23408 U / ml in the shake-flask fermentation supernatant, a 24.7% increase compared to the starting strain. Furthermore, the mutant strain, after 30 hours of fermentation in a 15L tank, shows an alkaline protease activity as high as 75320 U / ml, a 33.6% increase compared to the starting strain, achieving unexpected technical results. This mutant strain can be widely used in the production of alkaline protease, which is beneficial for reducing the production cost of alkaline protease and promoting its application. Attached Figure Description

[0014] Figure 1 The temperature-relative enzyme activity curve of alkaline protease APL;

[0015] Figure 2 The pH-relative enzyme activity curve of alkaline protease APL;

[0016] Figure 3 Fermentation curves of Bacillus subtilis APL01 and APL02 in a 15L tank. Implementation

[0017] The method of the present invention will be further illustrated below with reference to examples. Experimental methods not specified in the examples can be performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention with the help of these examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.

[0018] The culture medium formulation involved in the embodiments of the present invention is as follows:

[0019] LB liquid medium: 1% tryptone, 0.5% yeast extract, 0.5% NaCl;

[0020] LB agar: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, 2% agar;

[0021] Skim milk agar plates: 1% tryptone, 0.5% yeast, 0.5% NaCl, 1% skim milk, 1.5% agar;

[0022] The preparation method for GM I is as follows: 95.6 ml of 1× minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml of 10% yeast extract; wherein the preparation method for the 1× minimum salt solution is as follows: 14 g / L K2HPO4, 6 g / L KH2PO4, 2 g / L (NH4)2SO4, 1 g / L trisodium citrate, and 0.2 g / L MgSO4•7H2O are dissolved in distilled water in sequence;

[0023] The preparation method for GM II is as follows: 96.98 ml of 1× minimum salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast extract, 0.25 ml of 1M MgCl2, and 0.05 ml of 1M CaCl2.

[0024] Seed culture medium: yeast extract 0.5%, tryptone 0.5%, glucose 0.5%, sodium chloride 0.5%;

[0025] Fermentation medium: yeast powder 1%, glucose 5%, sodium citrate 0.1%, CaCl2 0.2%, MgSO4 0.1%, K2HPO4 0.8%.

[0026] Example 1: Alkaline protease gene apl Cloning

[0027] The applicant will use Bacillus alkaline (Bacillus) Alkalihalobacillus xiaoxiensis The alkaline protease gene was named apl Its nucleotide sequence is SEQ ID NO:1, and its encoded amino acid sequence is SEQ ID NO:2. (Gene) apl The expression box sequence, including promoters, apl The gene and terminator sequences were synthesized by Beijing Liuhe BGI Genomics Co., Ltd. Then, using the synthesized gene fragment as a template, the gene was amplified using primers apl-F and apl-Rv. apl Gene expression cassette fragments.

[0028] The PCR primers and reaction conditions are as follows:

[0029] apl-F: ctactctgaatttttttaaaaggagagggtaaagagtgaataagaaaatggggaaaatt;

[0030] apl-Rv: gttatctatgaccatgattacgccaagctgggcccttaagcttaaaaata.

[0031] PCR conditions were: 98℃ for 2 min; 98℃ for 10 s; 58℃ for 20 s, 72℃ for 50 s, 30 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit.

[0032] Example 2 Recombinant expression of alkaline protease apl Construction and screening of engineered Bacillus subtilis strains

[0033] The tetracycline resistance gene derived from Proteus was named tet Its nucleotide sequence is SEQ ID NO:3, and its encoded amino acid sequence is SEQ ID NO:4. tet The gene expression cassette sequence was synthesized by Beijing Liuhe BGI Genomics Co., Ltd. Then, using the synthesized gene fragment as a template, primers were applied... tet -F and primers tet -Rv amplifies tetracycline resistance gene tet The expression cassette fragment has loxp sites at its 5' and 3' ends.

[0034] The PCR primers and reaction conditions are as follows:

[0035] tet-F: cttaagggcccagcttggcgtaatcatggtcatagataac;

[0036] tet-Rv: ctagagcggataacaatttcacacaggaaacagctatgaccatg.

[0037] PCR conditions were: 98℃ for 2 min; 98℃ for 10 s; 58℃ for 20 s, 72℃ for 45 s, 30 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit.

[0038] The p302 vector was digested with restriction endonucleases BglII and SphI for 3 hours, and the 4.8 kb digestion product was recovered by gel electrophoresis. Using the NEB Gbison assembly kit, in a 20 μL reaction system... tetThe molar ratio of fragment to vector digestion products was 1:3. The reaction was carried out at 50℃ for 60 min. 10 μL of the reaction solution was used to transform *E. coli*, plated on LB agar plates containing 100 μg / ml ampicillin, and incubated overnight at 37℃. Five transformants were selected from the above transformation plates, and the plasmids were extracted using an Omega plasmid extraction kit and sent to the Qingdao BGI Genomics Sequencing Center for sequencing analysis. The plasmid that met the expected sequence was obtained and named p303(p302-tet).

[0039] The p303 vector was digested with the restriction endonuclease SphI for 2 hours, and the digestion product was recovered by gel electrophoresis. Using the NEBGbison assembly kit, in a 20 μL reaction system... apl The molar ratio of the gene expression cassette fragment to the p303 restriction enzyme digestion product was 1:3. The reaction was carried out at 50℃ for 60 min. 10 μL of the reaction solution was used to transform *E. coli*, plated on LB agar plates containing 100 μg / ml ampicillin, and incubated overnight at 37℃. Five transformants were selected from the transformed plates, and their sequences were analyzed using an Omega plasmid extraction kit at the Qingdao BGI Genomics Sequencing Center. The resulting plasmid, matching the expected sequence, was named p303-apl.

[0040] The expression plasmid p303-apl was transformed into Bacillus subtilis 1A751 host cells using the competent cell method. The specific transformation process is as follows: Freshly activated Bacillus subtilis 1A751 cells were inoculated into 5 ml of GMI solution on LB plates and cultured overnight at 30°C and 125 rpm with shaking. The next day, 1 ml of the culture medium was transferred to 9 ml of GMI and cultured at 37°C and 220 rpm for 3.5 h. Then, 1 ml of the culture medium from the previous step was transferred to 9 ml of GMII solution and cultured at 37°C and 125 rpm for 90 min. The cells were then collected by centrifugation at 5000 g for 10 min. The cells were gently resuspended in 1 ml of GMII solution. The resuspended cells are the competent cells. Then, 0.2 ml of competent cells were taken, and 10 μL of plasmid p303-apl was added. After incubation at 37°C and 200 rpm for 60 min with shaking, the cells were spread onto skim milk plates containing 10 μg / ml tetracycline and incubated overnight at 37°C with the plates inverted. The next day, the transformants and clear zones on the plates were examined. Transformants with larger clear zones were selected and seeded onto skim milk plates containing 10 μg / ml tetracycline. After incubation at 37°C for 6 h, 100 transformants with larger clear zones were selected and named APL.tet-1, APL.tet-2, ..., APL.tet-100.

[0041] The 100 transformants were cultured overnight, and their genomes were extracted using the Tiangen Bacterial Genome Extraction Kit. PCR amplification was performed using both the genomes of each transformant and the genome of the Bacillus subtilis host 1A751 as templates. Gel electrophoresis results showed that 21 transformants had amplified bands of 1745 bp, as expected. Combined with the clear zone results on the selection plates, this indicates that the alkaline protease gene in these 21 transformants was correctly integrated into the Bacillus subtilis host genome. SpoIIA Gene regions. The 21 amplified bands were recovered and sent to BGI Genomics in Qingdao for sequencing verification. Sequencing results showed that the alkaline protease gene was present in all 21 transformants. apl All were correctly integrated into the expected sites.

[0042] Twenty-one transformants were selected and purified by streaking on skim milk plates containing 10 μg / ml tetracycline. After overnight culture, they were inoculated into 20 ml of seed culture medium and cultured at 37°C and 220 rpm for about 6 h with shaking. Then, 2.5 ml of the seed culture was inoculated into 50 ml of fermentation medium and cultured at 37°C and 220 rpm for 48 h with shaking. The supernatant was obtained by centrifugation and alkaline protease activity was detected.

[0043] The results showed that, under shake-flask fermentation conditions, the positive transformants obtained above exhibited the highest alkaline protease activity of 18432 U / ml in their fermentation supernatant. This positive transformant with the highest enzyme activity was named *Bacillus subtilis* APL.tet. Bacillus subtilis APL.tet).

[0044] 1. Principle

[0045] Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent is reduced to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, and thus the enzyme activity of the product can be calculated.

[0046] 2. Definition of enzyme activity

[0047] The definition of protease activity, expressed in units, is as follows: 1 g of solid enzyme powder (or 1 ml of liquid enzyme) hydrolyzes casein to produce 1 μg of tyrosine in 1 minute under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as u / g (u / ml).

[0048] 3. Reagents and solutions

[0049] (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 mg / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.

[0050] 4. Measurement Method

[0051] (1) Development of the standard curve

[0052] Prepare L-tyrosine standard solutions with concentrations of 0 mg / mL, 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, and 50 mg / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin-Ciocalteu reagent, shake well, and incubate in a 40°C water bath for 20 min. Remove and measure the absorbance at 680 nm using a 10 mm cuvette, with a tyrosine-free tube (C) as a blank. Plot a standard curve (this line should pass through zero) with absorbance (A) as the ordinate and tyrosine concentration (C) as the abscissa.

[0053] (2) Enzyme activity assay

[0054] Take an appropriate amount of pre-diluted enzyme solution, then add an equal volume of 10% casein preheated at 40℃, and react at 40℃ for 10 min. Then add an equal volume of trichloroacetic acid (6.54% concentration) to the reaction system, mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and perform a colorimetric reaction at 40℃ for 20 min. Measure the OD680 value.

[0055] (3) Calculation

[0056] Read the enzyme activity of the final diluted sample from the standard curve, in units of u / mL. The enzyme activity of the sample is calculated using the following formula:

[0057] X = A × K × 4 / 10 × n = 2 / 5 × A × K × n

[0058] Where: X — enzyme activity of the sample (u / g or u / ml);

[0059] A—The average absorbance of the sample in parallel tests;

[0060] K—absorption constant;

[0061] 4 — Total volume of reaction reagents (ml);

[0062] 10 — Reaction time 10 min, calculated as 1 min;

[0063] n – dilution factor.

[0064] Example 3 Construction of antibiotic-free Bacillus subtilis engineered strain APL01

[0065] The Cre protein expression plasmid pZXcre was transformed into competent cells of the engineered bacterium APL.tet. The specific process for preparing competent cells is described in Example 2. 0.2 ml of competent cells were added to 10 μL of plasmid pZXcre, and the cells were cultured at 30°C and 200 rpm for 60 min with shaking. The culture was then spread onto skim milk plates containing 30 μg / ml kanamycin and incubated overnight at 30°C. The transformants and clear zones were examined the following day.

[0066] Collect all transformants with clear zones on the transformation plates, vortex to mix, and transfer 100 μL of the bacterial culture to 20 ml of LB broth containing 30 μg / ml kanamycin. Incubate at 30°C with shaking until the OD 600 reaches 1.5. Then, transfer another 100 μL of the culture to LB broth containing 30 μg / ml kanamycin and incubate at 30°C with shaking until the OD 600 reaches 1.5. Dilute the diluted culture and spread it onto skim milk plates containing 30 μg / ml kanamycin, and incubate overnight at 30°C. Pick transformants with clear zones from the diluted plates and inoculate them onto skim milk plates containing 30 μg / ml kanamycin and 10 μg / ml tetracycline, respectively. Incubate at 30°C for 18 h to screen for transformants that are both kanamycin resistant and tetracycline sensitive. R Tet S The transparent ring of the good transformant.

[0067] Collect all Kan R Tet S Transformants were vortexed to mix thoroughly. 100 μL of the bacterial culture was transferred to 20 ml of LB broth and incubated at 37°C with shaking until the OD 600 reached 1.5. Then, another 100 μL of the culture was transferred to LB broth and incubated at 37°C with shaking until the OD 600 reached 1.5. The culture was then diluted and plated onto skim milk plates and incubated overnight at 37°C. Transformants with clear zones on the diluted plates were picked and inoculated onto LB plates containing 30 μg / ml kanamycin and skim milk plates without antibiotics, respectively, to screen for kanamycin-sensitive transformants. S This refers to recombinant expression of alkaline protease. apl Antibiotic-free Bacillus subtilis engineered strain.

[0068] Pick different Kan STransformants were purified by streaking on skim milk plates and inoculated into 20 ml of seed culture medium, and cultured at 37°C and 220 rpm for about 6 h with shaking. Then, 2.5 ml of the seed culture was inoculated into 50 ml of fermentation medium and cultured at 37°C and 220 rpm for 48 h with shaking. The supernatant was obtained by centrifugation of the cells and alkaline protease activity was detected.

[0069] The shake-flask fermentation results showed that the antibiotic-free positive transformants obtained above exhibited the highest alkaline protease activity of 18762 U / ml in the fermentation supernatant under shake-flask fermentation conditions. This transformant with the highest enzyme activity was named Bacillus subtilis APL01 (…). Bacillus subtilis APL01).

[0070] Ultraviolet (UV) mutagenesis results in highly random mutations, and the effects of these mutations are also random and difficult to predict. Therefore, to obtain effective positive mutations, technicians typically need to conduct multiple rounds of UV mutagenesis, resulting in a large workload and the possibility of failing to obtain effective positive mutations. However, because UV mutagenesis requires simple equipment, is inexpensive, and can produce a large number of mutants in a short time, it remains a commonly used mutagenesis breeding method.

[0071] The applicant used Bacillus subtilis APL01 as the starting strain and genetically modified it using ultraviolet mutagenesis to further improve the expression titer of alkaline protease.

[0072] 4.1 Ultraviolet mutagenesis treatment and determination of mutagenic dosage

[0073] Centrifuge the Bacillus subtilis APL01 bacterial culture after 7 hours of shaking culture, discard the supernatant, wash the bacterial cells twice with sterile physiological saline, suspend the dispersed cells in physiological saline, and finally adjust the cell concentration to 10. 8 Cells / ml. Turn on the 9W UV lamp and preheat for about 30 minutes; take a 9 cm diameter sterile petri dish and add the above cell concentration of 10. 8 Add 10 ml of a bacterial suspension (1 / ml) to a sterile magnetic stirrer, turn on the stirrer, open the petri dish lid, and irradiate with UV light at a vertical distance of 15 cm for different durations (0 s–300 s), taking samples every 20 s. Replace the petri dish lid, turn off the UV light, and incubate in the dark for 30 min. Then, serially dilute the irradiated bacterial suspension with 0.85% physiological saline to a concentration of 10⁻⁶. -1 ~10 -6 Take 10 -4 10 -5 10 -6Three dilutions of bacterial suspension, 100 μL each, were spread onto skim milk plates, with three plates for each dilution. A control was prepared by diluting and spreading untreated bacterial suspension. The evenly spread plates were wrapped in black cloth or newspaper and incubated overnight at 37°C. The number of single colonies grown on each dilution at different irradiation times was counted. A dilution with 30–300 single colonies was considered appropriate. The average number of single colonies grown on the three plates at that dilution was calculated, and the bacterial suspension concentration was calculated using the following formula:

[0074] Bacterial suspension concentration (CFU / ml) = average number of colonies at a certain dilution × dilution factor × 10.

[0075] Calculate the lethality at a given UV treatment dose using the following formula:

[0076] Lethality (%) = (1 - concentration of bacterial suspension after treatment with a certain dose / concentration of bacterial suspension before treatment) × 100%.

[0077] The bacterial suspension was treated with a mutagenic dose that had a lethality of approximately 80%-90%. When the irradiation time was 126 seconds, the lethality reached 86.34%. Therefore, the applicant ultimately determined the mutagenicity time to be 126 seconds.

[0078] 4.2 Screening of mutant strains producing high levels of alkaline protease

[0079] Colonies were picked from skim milk plates with a lethality of 86.34%, streaked to obtain single colonies, and then inoculated onto skim milk plates. Three replicates were set up for each group, with the starting strain inoculated simultaneously as a control. The plates were incubated at 37°C for 12 hours. The applicant continued this process with 13 rounds of mutagenesis screening, resulting in 2156 mutant strains with better clear zones than the starting strain. Each single colony was inoculated into a 96-well plate containing 200 μL of LB liquid medium and incubated at 37°C with shaking at 500 rpm for 6 hours. Then, 30 μL of the inoculum was transferred to a 96-well plate containing 200 μL of fermentation medium (1% glucose, 0.2% disodium hydrogen phosphate, 1% peptone, 1% sodium chloride, and 0.5% yeast extract). The plates were incubated at 37°C with shaking at 500 rpm for 2 days. After centrifugation to remove the bacterial cells, the fermentation supernatant was obtained. The activity of alkaline protease in the supernatant was measured, using the starting strain as a control, to screen for mutant strains with significantly enhanced fermentation enzyme activity. Finally, a mutant strain with a significantly higher alkaline protease production than the original strain was obtained and named Bacillus subtilis APL02. Bacillus subtilis (APL02). The alkaline protease activity in the shake-flask fermentation supernatant of this mutant strain reached 23408 U / ml, which was 24.7% higher than that of the original strain, achieving unexpected technical results.

[0080] 1. Optimal operating temperature

[0081] The supernatant from the Bacillus subtilis APL02 fermentation was diluted with sodium hydroxide-borax buffer, and its alkaline protease activity was measured at 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, and 65℃, at pH 10.0. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated to create a temperature-relative enzyme activity curve. The results are as follows: Figure 1 As shown, the optimal operating temperature of the alkaline protease described in this invention is 60°C, and it can maintain a relative enzyme activity of more than 68% within the range of 50-65°C.

[0082] 2. Optimal pH

[0083] The supernatant from the fermentation of *Bacillus subtilis* APL02 was diluted with 0.1M disodium hydrogen phosphate-0.05M citric acid, boric acid-borax, and sodium hydroxide-borax buffer solutions at pH 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, and 12.0, respectively. The alkaline protease activity was measured at 40℃, and the highest activity was taken as 100%. Relative enzyme activity was calculated, and pH-relative enzyme activity curves were plotted. The results are as follows: Figure 2 As shown, the optimal pH for the alkaline protease described in this invention is 11, and it can maintain a relative enzyme activity of more than 87% within the pH range of 10.0-12.

[0084] The original strain *Bacillus subtilis* APL01 and the mutant strain *Bacillus subtilis* APL02 were fermented separately in a 15L fermenter. The fermentation medium formula was: glucose 10 g / L, soybean meal 15 g / L, NaCl 5 g / L, K₂HPO₄ 0.3 g / L, calcium chloride 5 g / L, magnesium sulfate heptahydrate 1 g / L, pH 7.1. The fermentation process was as follows: pH 7.1, temperature 37℃, stirring speed 800 rpm, aeration rate 2.16 m³ / h. 3 / h, inoculation amount is 3%, dissolved oxygen is controlled above 25%.

[0085] By measuring the alkaline protease activity in the fermentation supernatant at different times, a fermentation enzyme activity curve can be obtained. Figure 3 The results showed that after 30 hours of fermentation, the alkaline protease activity in the fermentation broth of the original strain Bacillus subtilis APL01 was 56396 U / ml, while the fermentation enzyme activity of the mutant strain Bacillus subtilis APL02 was 75320 U / ml, which was 33.6% higher than that of the original strain, achieving unexpected technical results.

[0086] In summary, the mutant Bacillus subtilis APL02 provided by this invention can significantly increase the yield of alkaline protease for detergents, which is beneficial to reducing the production cost of the enzyme and improving its application effect, thereby facilitating its widespread application in the detergent industry.

[0087] The applicant submitted the aforementioned mutant strain, Bacillus subtilis APL02, on December 5, 2022. Bacillus subtilis (APL02) is deposited at the China Center for Type Culture Collection in Wuhan, China, with accession number CCTCC NO: M20221874.

Claims

1. A Bacillus subtilis mutant strain, characterized in that, The mutant strain has the accession number CCTCC NO:M20221874.

2. The application of the Bacillus subtilis mutant strain according to claim 1 in the production of alkaline protease.

3. A method for producing alkaline protease, wherein the Bacillus subtilis mutant strain described in claim 1 is used as the fermentation strain.

Images