A SNP marker related to chicken ten-week-old weight trait and application thereof
By conducting genome-wide association analysis on chicken hybrid populations, SNP markers associated with the weight of chickens at ten weeks of age were discovered, solving the problem of the lack of clear molecular markers in broiler breeding and achieving early, rapid, and low-cost weight prediction and improvement effects.
Patent Information
- Application Number
- CN202410839663.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-26
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-06-26
AI Technical Summary
The lack of molecular markers with clear functions and significant effects in broiler molecular breeding makes it difficult to effectively improve the weight traits of chickens.
Genome-wide association analysis of chicken hybrid populations using resequencing technology revealed an SNP marker at the rs317216119 locus in GRCg6a 104 of the genome. This locus showed significant frequency differences between high-weight and low-weight chickens, with A being the dominant allele in high-weight chickens and C being the dominant allele in low-weight chickens. This marker was used for marker-assisted selection breeding.
It enables early, rapid, and low-cost prediction of chicken weight, thereby improving the weight of breeding populations, and has broad application prospects and economic value.
Smart Images

Figure CN118685535B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, and in particular to a SNP marker related to the ten-week-old body weight trait of chicken and application thereof. BACKGROUND
[0002] Chicken meat is one of the main meat varieties in China, which has the characteristics of high protein, low fat and low cholesterol. In recent years, the output of chicken meat in China has been increasing continuously, and improving muscle yield and quality has become a long-term exploration of breeding scientists. The classical breeding method has made a great contribution to the improvement of production traits of agricultural animals. With the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select the genetic potential of chickens and accelerate the breeding process.
[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variations in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and accuracy. If a SNP molecular marker related to the target trait of chicken can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chicken and bring breakthrough progress to the field of poultry breeding. SUMMARY
[0004] In view of the deficiencies in the prior art, the present application aims to provide a SNP molecular marker related to the ten-week-old body weight trait of chicken and application thereof. The individuals of a 1149 chicken cross population with only ten-week-old body weight records are sequenced by resequencing technology and GWAS analysis is performed, and a SNP site significantly related to ten-week-old body weight is obtained. The SNP is rs317216119 (chr1: 170559727) located in the genome GRCg6a 104. The site contains three genotypes of AA, CC and AC. The SNP frequency of the SNP in other low-weight chicken species and high-weight chicken species in the resequencing is counted, and it is found that the SNP frequency distribution in low-weight chicken species and high-weight chicken species is significantly different. In high-weight chicken, A is the dominant allele, and in low-weight chicken, C is the dominant allele. High-weight chicken has higher body weight than low-weight chicken, indicating that this SNP site can be used as a molecular marker for the breeding of excellent chicken species. In the population with lower body weight, by selecting individuals with allele A, the body weight of the population can be improved.
[0005] To solve the above technical problems, the technical scheme provided by the present application is:
[0006] A SNP molecular marker related to the ten-week-old body weight of a chicken,
[0007] The SNP molecular marker is located at chr1: 170559727 of the genome GRCg6a 104, and the alleles of the SNP site are A and C.
[0008] The economic trait is the ten-week-old body weight, and in high body weight chickens, A is the dominant allele, and in low body weight chickens, C is the dominant allele.
[0009] Preferably,
[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO. 1.
[0011] The application of the above-mentioned SNP molecular marker in the detection of the ten-week-old body weight trait of a chicken.
[0012] Preferably, the application comprises the following steps:
[0013] (1) detecting the genotype of a sample chicken at the SNP site;
[0014] (2) selecting sample chickens with the A / A genotype for breeding of a dominant strain.
[0015] Preferably,
[0016] The step (1) can use direct sequencing, or first amplify the gene fragment containing the SNP molecular marker and then detect. For example, a primer is designed to amplify a fragment containing the SNP molecular marker from the sequence shown in SEQ ID NO. 1, and then detect the alleles at the site.
[0017] The application of the above-mentioned SNP molecular marker in marker-assisted selection breeding, selecting chickens with the A / A genotype for breeding
[0018] A primer pair for amplifying a fragment containing the above-mentioned SNP molecular marker, characterized in that the sequence of the primer pair is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0019] The present application has the following beneficial effects:
[0020] The present application can early, quickly, and effectively predict whether the body weight is high or low by detecting the SNP molecular marker, has a broad application prospect in chicken breed improvement, and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS
[0021] The accompanying drawings are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and are meant to explain the present application but are not intended to limit the application. In the drawings:
[0022] Figure 1 Manhattan plot of ten-week-old body weight GWAS results DETAILED DESCRIPTION
[0023] The preferred embodiments of the present application will be described herein below with reference to the accompanying drawings, in which it is to be understood that the embodiments are given for illustrative purposes only and are not intended to limit the scope of the present application. Various modifications and changes can be made by those skilled in the art without departing from the spirit and scope of the present application.
[0024] The present application provides a SNP marker (chr1: 170559727, located in the intron region of PHF11 gene) related to the ten-week-old body weight trait of chickens and its application, the SNP molecular marker is located at chr1: 170514458 of the genome GRCg6a 104, and the SNP molecular marker is located at the 101st base of the nucleotide sequence shown in SEQ ID NO. 1; the alleles of the SNP site are G and T;
[0025] The economic trait is the ten-week-old body weight of chickens, and G is the dominant allele in high body weight chickens, and T is the dominant allele in low body weight chickens. In the population with lower body weight, by selecting individuals with allele G, the body weight of chickens can be improved.
[0026] SEQ ID NO. 1 (chr1: 170559627-170559827)
[0027] tttggactgtgttcccttactttccaaggcactcctaatgcactgtaaaacgtatcaggaagagctgaggaaactctagaattc
[0028] atcaaaggtatcctgacaggcagcaggctacactttgtgcctatgctagcacttcagagtgctccaaaataggccacccagc
[0029] tttgttttgggtggatgtgatttcctttcaggcca
[0030] Example 1: Whole genome association analysis of ten-week-old body weight of chickens
[0031] 1. Test materials
[0032] The individuals of the cross population of chickens were used as the research objects, and the body weight of 1149 individuals was measured at the age of ten weeks, and the measurement was strictly in accordance with the internal specifications of the chicken farm.
[0033] 2. Test method
[0034] 2.1 Phenotype measurement
[0035] When the chickens reached the age of ten weeks, each chicken was placed on a weighing device, and the chicken was allowed to remain relatively calm and balanced, then the displayed body weight value was recorded, and the gender was recorded.
[0036] 2.2 Whole genome SNP typing method of chicken based on resequencing technology
[0037] The sequencing data was aligned to the GRCg6a 104 reference genome using gtx align, SNP site detection was performed using Basevar, and STITCH was used to estimate the genotype probability of all individuals. For the SNP sites obtained by typing, filtering was performed according to MAF <0.05, site call rate <0.95, and info score <0.4, and a total of 7,901,521 high-quality sites were retained.
[0038] The specific steps of amplification are as follows: the blood tissue of the cross population sample is used to extract DNA using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd., the OD value of the extracted DNA is detected by NanoDrop 2000 spectrophotometer to determine the concentration and purity of the DNA, and the integrity of the DNA is detected by agarose gel electrophoresis. The sequence of the cross population sample is designed using Oligo7 software, and the corresponding primers are used for sequence amplification using Novozyme 2xTaq Master Mix. The reaction system is as follows: 95°C, pre-denaturation 3min; 95°C, denaturation 15s, 60°C, annealing 15s, 72°C, extension 15s, 30 cycles; 72°C, complete extension 5min. Finally, the product fragment size is detected by agarose gel electrophoresis.
[0039] The sequence of the primer pair for amplifying the fragment containing the above-mentioned SNP site is as follows:
[0040] F: TTTGGACTGTGTTCCCTTAC (SEQ ID NO. 2)
[0041] R: TGGCCTGAAAGGAAATCACA (SEQ ID NO. 3)
[0042] 2.3 Whole genome association analysis
[0043] The fastGWA was used to perform genome-wide association study (GWAS) on the body weight phenotype of 1149 chickens at ten weeks of age.
[0044] 2.4 SNP sites significantly associated with body weight traits
[0045] The detection of significant sites at the genome level was performed according to FDR < 0.05 to identify significant sites.
[0046] 3. Results and analysis
[0047] The present application takes 1149 chickens of a crossbreed population as the object, uses 7,901,521 SNPs obtained by resequencing technology to perform GWAS analysis on the body weight of chickens at ten weeks of age, and determines a SNP (chr1: 170559727) site significantly associated with the body weight of chickens at ten weeks of age, as shown in Figure 1
[0048] Example 2: Frequency distribution of SNP (chr1: 170559727) in different chicken breeds
[0049] 1. Test materials
[0050] Low-weight chicken breeds: Beijing oil chicken (n = 25), tea flower chicken (n = 30), Daguishan miniature chicken (n = 33), silk feather chicken (n = 57), and Tibetan chicken (n = 154).
[0051] High-weight chicken breeds: Lingnan yellow-feather broiler (n = 16), white-feather broiler (n = 20), and Kobold chicken (n = 33).
[0052] 2. Test method
[0053] 2.1 Data collection
[0054] The whole genome resequencing data from the above-mentioned five low-weight chicken breeds and three high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).
[0055] 2.2 SNP typing using GATK
[0056] The gVCF of the above-mentioned resequencing samples was constructed based on the GRCg6a 104 reference genome using the GTX server gtx wgs command, and then the joint variant detection was performed on all gVCF samples using the gtx gi and gtxjoint commands to obtain the genotype VCF file.
[0057] 2.3 Filtering and quality control of SNPs
[0058] After joint variant calling, SNPs sites were extracted using the SelectVariants tool of the GATK software package, and then the whole genome resequencing data was quality controlled according to the following hard filtering parameters using the VariantFiltration tool of the GATK software package: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30. Finally, after the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.
[0059] 2.4 Calculation of allele frequency of chr1: 170559727 in different chicken breeds
[0060] The allele frequency of chr1: 170559727 in different chicken breeds was calculated using vcftools--freq2.
[0061] 3 Results and analysis
[0062] The results of SNP frequency distribution of SNP (chr1: 170559727) in different low-weight chicken breeds and high-weight chicken breeds are shown in Table 1, and there is a significant difference between low-weight chicken breeds and high-weight chicken breeds. In high-weight chickens, A is the dominant allele, and in low-weight chickens, C is the dominant allele.
[0063] Table 1 SNP frequency of SNP (chr1: 170559727) in different low-weight chicken breeds and high-weight chicken breeds
[0064]
[0065] It was found that a SNP molecular marker related to the ten-week-old chicken weight trait could improve the weight of the breeding population by breeding individuals with allele A / A in populations with lower weight.
[0066] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.
[0067] Finally, it should be pointed out that the above description is only a preferred example of the present application and does not limit the present application, although the present application has been described in detail with reference to the foregoing examples, and those skilled in the art can still modify the technical solutions described in the foregoing examples or make equivalent replacements for part of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included within the protection scope of the present application.
Claims
1. Application of a SNP molecular marker in detection of ten-week-old body weight traits of chickens, characterized in that, the SNP molecular marker is located at chr1: 170559727 of the genome GRCg6a, and the alleles of the SNP site are A and C.
2. Use according to claim 1, characterized in that, comprising the following steps: (1) detecting the genotype of the sample chicken at the SNP site; (2) selecting sample chickens with A / A genotype for breeding of superior lines.
3. The application of claim 2, characterized in that, the step (1) can use direct sequencing, or first amplify the gene fragment containing the SNP molecular marker and then detect.
Citation Information
Patent Citations
Pathogen biomarkers and uses therefor
CN108513586A
Chicken WHAMM gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in character breeding for eggs
CN117721212A