KASP markers for genotyping of tea green leaf color gene and application thereof
By developing KASP markers related to the yellow-green leaf color of tea trees, and utilizing PCR amplification and fluorescence detection, the problems of long breeding cycles and low efficiency in tea tree breeding have been solved. This has enabled rapid identification and efficient breeding of the yellowing leaf trait in tea trees, meeting the diverse needs of tea products.
Patent Information
- Application Number
- CN202410932945.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-12
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2044-07-12
Smart Images

Figure CN118685556B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a KASP marker for genotyping yellow-green leaf color in tea trees and its application, belonging to the fields of molecular marker technology and agricultural biotechnology. Background Technology
[0002] The tea tree (Camellia sinensis) originated in southwestern my country and is a perennial evergreen woody economic crop. Tea trees exhibit self-incompatibility and rich genetic diversity, including germplasm resources with different leaf color variations, such as yellowing, whitening, and purple leaf colors. Yellowing leaf tea germplasm is typically regulated by light or temperature, resulting in reduced chlorophyll synthesis and higher levels of carotenoids and free amino acids in the leaves, while lower levels of caffeine and polyphenols. Therefore, yellowing tea varieties, due to their unique leaf color and differences in internal components, produce tea with a highly distinctive appearance and flavor, making them very popular with consumers. To meet the diverse and specific demands of consumers for tea products, it is necessary to cultivate tea varieties with different yellowing leaf colors.
[0003] Currently, in tea breeding practices, the selection of superior varieties mainly relies on conventional selection breeding, which involves systematically selecting superior individual plants from wild populations and hybrid offspring. This results in long breeding cycles and low efficiency, hindering the genetic improvement of tea varieties. Molecular marker-assisted selection breeding, especially the development of functional molecular markers associated with target traits, can greatly improve breeding efficiency and accelerate genetic improvement. For example, developing functional molecular markers associated with yellowing tea leaves allows for the selection of breeding materials at the seedling stage, precise identification of parental genotypes for screening hybrid combinations, and rapid identification of offspring, thereby significantly improving breeding efficiency.
[0004] Kompetitive allele-specific polymerase chain reaction (KASP) is a novel genotyping technique based on single nucleotide polymorphisms (SNPs). It enables precise genotyping of SNPs and insertion / deletion polymorphisms (Indels) at the genomic level, offering advantages such as speed, accuracy, low cost, and automation. It is widely used in various species, including major crops, livestock, aquatic products, traditional Chinese medicine, fruits and vegetables, flowers, and microorganisms. This technology is primarily used for rapid detection of large numbers of samples at a limited number of loci. Target SNPs and InDel sites are precisely amplified using specific fluorescent primers, and genotyping is performed by scanning the fluorescence signal, eliminating the need for cumbersome electrophoresis, photography, and band reading analysis. The development and application of KASP marker technology have significantly improved the efficiency of molecular breeding in plant and animal genetic research and molecular-assisted selection. Summary of the Invention
[0005] In view of the above-mentioned prior art, the present invention provides a KASP marker for tea tree yellow-green leaf color gene typing and its application, a method for tea tree yellow-green leaf color gene typing, and functional molecular markers of tea tree leaf yellowing trait related genes and their applications.
[0006] This invention is achieved through the following technical solution:
[0007] A KASP marker for tea plant yellow-green leaf color genotyping is KASP-TGY08G0002006b and / or KASP-TGY08G0002011b;
[0008] The KASP-TGY08G0002006b comprises forward primers TGY08G0002006b-F1 and TGY08G0002006b-F2, and reverse primer TGY08G0002006b-R. The nucleotide sequence of forward primer TGY08G0002006b-F1 is shown in SEQ ID NO.3, the nucleotide sequence of forward primer TGY08G0002006b-F2 is shown in SEQ ID NO.4, and the nucleotide sequence of reverse primer TGY08G0002006b-R is shown in SEQ ID NO.5. Different fluorescent labels are attached to forward primers TGY08G0002006b-F1 and TGY08G0002006b-F2.
[0009] The KASP-TGY08G0002011b includes forward primers TGY08G0002011b-F1 and TGY08G0002011b-F2, and reverse primer TGY08G0002011b-R. The nucleotide sequence of forward primer TGY08G0002011b-F1 is shown in SEQ ID NO.6, the nucleotide sequence of forward primer TGY08G0002011b-F2 is shown in SEQ ID NO.7, and the nucleotide sequence of reverse primer TGY08G0002011b-R is shown in SEQ ID NO.8. Different fluorescent labels are attached to forward primers TGY08G0002011b-F1 and TGY08G0002011b-F2.
[0010] Furthermore, the fluorescent label is selected from FAM or HEX.
[0011] The application of the KASP marker for tea tree yellow-green leaf color gene typing in tea tree yellow-green leaf color gene typing, in identifying tea trees with yellow leaves, and in assisting in the breeding of tea trees with yellow leaves.
[0012] Furthermore, the tea tree is an F1 offspring created through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green tea tree 'Zhongcha 102' as parents.
[0013] A method for genotyping the yellow-green leaf color gene in tea trees is as follows: genomic DNA is extracted from the tea tree to be tested, PCR amplification is performed using the KASP marker for the yellow-green leaf color gene genotyping of tea trees, fluorescence detection is performed, and the genotype of the tea tree to be tested is obtained.
[0014] Furthermore, the tea tree to be tested is an F1 offspring constructed through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green-leaf tea tree 'Zhongcha 102' as parents.
[0015] A functional molecular marker for a gene related to yellowing of tea leaves is identified as SNP site 1 and / or SNP site 2. SNP site 1 is position 1199 of the CDS sequence of CsTGY08G0002006b.t1, with a base of G or A. The CDS sequence of CsTGY08G0002006b.t1 is shown in SEQ ID NO.1. SNP site 2 is position 1435 of the CDS sequence of CsTGY08G0002011b.t1, with a base of C or T. The CDS sequence of CsTGY08G0002011b.t1 is shown in SEQ ID NO.2.
[0016] The application of functional molecular markers related to the yellowing trait of tea leaves in the gene typing of yellow-green leaves of tea trees, in the identification of tea trees with yellowing leaves, and in the assisted selection of tea trees with yellowing leaves.
[0017] Furthermore, the tea tree is an F1 offspring created through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green tea tree 'Zhongcha 102' as parents.
[0018] The specific primers for detecting the functional molecular markers of the above-mentioned tea leaf yellowing trait genes are specific primers for detecting SNP site 1 and / or specific primers for detecting SNP site 2.
[0019] The specific primers for detecting SNP site 1 are a combination of forward primer TGY08G0002006b-F1, forward primer TGY08G0002006b-F2, and reverse primer TGY08G0002006b-R; the nucleotide sequence of forward primer TGY08G0002006b-F1 is shown in SEQ ID NO.3, the nucleotide sequence of forward primer TGY08G0002006b-F2 is shown in SEQ ID NO.4, and the nucleotide sequence of reverse primer TGY08G0002006b-R is shown in SEQ ID NO.5;
[0020] The specific primers for detecting SNP site 2 are a combination of forward primer TGY08G0002011b-F1, forward primer TGY08G0002011b-F2, and reverse primer TGY08G0002011b-R; the nucleotide sequence of forward primer TGY08G0002011b-F1 is shown in SEQ ID NO.6, the nucleotide sequence of forward primer TGY08G0002011b-F2 is shown in SEQ ID NO.7, and the nucleotide sequence of reverse primer TGY08G0002011b-R is shown in SEQ ID NO.8.
[0021] The above-mentioned specific primers for detecting functional molecular markers of tea leaf yellowing trait genes are used in the genotyping of yellow-green leaves in tea trees, in the identification of tea trees with yellowing leaves, and in the assisted breeding of tea trees with yellowing leaves.
[0022] Furthermore, the tea tree is an F1 offspring created through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green tea tree 'Zhongcha 102' as parents.
[0023] This invention constructs a hybrid progeny population using 'Golden Leaf' (yellow leaf variety) and 'Zhongcha 102' (green leaf variety) as parents. Thirty plants each with green and yellow leaves were selected, and genomic DNA was extracted and mixed in equal amounts to construct two pools. Using bulk segregate analysis (BSA), also known as grouped analysis or bulk segregation analysis, functional molecular markers associated with the yellowing trait in tea leaves were obtained, identifying the genes related to the yellowing trait. Based on this, two functional molecular markers for the yellowing trait were successfully developed. Marker-assisted selection transforms traditional phenotypic selection into direct genotype selection, which can shorten the breeding cycle and improve selection accuracy. This has significant application value and importance for improving the yellowing trait in tea leaves.
[0024] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description
[0025] Figure 1 Leaf color phenotypes of parents and offspring: A represents the leaf color phenotype of Golden Leaf (female parent ♀), B represents the leaf color phenotype of Zhongcha 102 (male parent ♂), C represents the field seedling phenotype after the second year of hybrid seed sowing, and D represents the leaf color classification (yellow, yellow-green, green) of Golden Leaf self-pollination offspring (extremely yellow leaf individuals) and hybrid offspring after the third year of transplanting.
[0026] Figure 2 : Genotyping results of marker KASP-TGY08G0002006b.
[0027] Figure 3 Genotyping results of marker KASP-TGY08G0002011b. Detailed Implementation
[0028] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.
[0029] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.
[0030] Example 1: Development of functional molecular markers for genes related to yellowing of tea leaves
[0031] The functional molecular markers associated with tea leaf yellowing trait were analyzed using BSA technology, and the steps are as follows:
[0032] (1) Using the yellowing tea tree 'Golden Leaf' and the green tea tree 'Zhongcha 102' as parents, a hybrid population of 'Golden Leaf' (♀) and 'Zhongcha 102' (♂) F1 offspring was constructed by artificial hybridization. Individuals with yellowing and green leaf phenotypes were found in the offspring population. Self-pollinated offspring of Golden Leaf with extremely yellow leaf color were screened out by phenotypic and SSR molecular markers.
[0033] Leaf color phenotypic diagrams of parents and offspring are shown below. Figure 1 As shown.
[0034] (2) Leaves from the maternal parent (single plant), paternal parent (single plant), F1 etiolated (30 plants), and F1 green-leaved single plants (30 plants) were selected, and DNA was extracted. Equal amounts of DNA from etiolated and green-leaved offspring were pooled to construct libraries, and genome resequencing was performed. SNP site analysis was also performed. The SNP screening process included: firstly, filtering out SNP sites with multiple genotypes; secondly, filtering out SNP sites with Read support less than 4; and thirdly, filtering out SNP sites with consistent genotypes between pools and SNP sites where recessive pool genes did not originate from recessive parents.
[0035] (3) Locating the associated regions of the leaf yellowing trait, including: using the Euclidean Distance (ED) algorithm, using SNP sites with genotypic differences between pools, counting the depth of each base in different pools, calculating the ED value of each site, exponentiating the original ED value, then using the Distance method to fit the ED value to obtain the associated regions, and finally performing functional annotation on the candidate region genes.
[0036] (4) Two functional genes related to chlorophyll biosynthesis, CsTGY08G0002006b.t1 and CsTGY08G0002011b.t1, were identified based on the localization interval. Polymorphic SNP sites were identified in the exon regions of both genes. The CDS sequence of CsTGY08G0002006b.t1 is shown in SEQ ID NO.1, and the CDS sequence of CsTGY08G0002011b.t1 is shown in SEQ ID NO.2.
[0037] The CDS sequence of CsTGY08G0002006b.t1 is shown in SEQ ID NO.1, as follows (direction 5'-3'):
[0038] ATGGCCAGTGTTCTCGGAACTTCTTCTGCAGCACTCTTCGCCTCTCGTCCTTCTTCTTCTCGCTCCTCCAAGTGCCCCATTCATTCTCTCTCCAACCCCAGGGCAGTTATGGGAGGAAATTCTATGGAGGGATTGCAATTCCAGTGAAGAAGGAGAGGTCTCAGTTCCGTGTTTCTATTACTAATGTTGCCACTGAAATCAGTCCTGCCCAAGAACAGGCCCGGAAGCTTGC
[0039]
[0040] The CDS sequence of CsTGY08G0002011b.t1 is shown in SEQ ID NO.2, as follows (direction 5'-3'):
[0041]
[0042]
[0043] (5) SNP site 1 is the 1199th position of the CDS sequence of CsTGY08G0002006b.t1, with a base of G or A, and SNP site 2 is the 1435th position of the CDS sequence of CsTGY08G0002011b.t1, with a base of C or T; the genotypes of these two SNP sites are highly associated with the yellowing trait of tea leaves.
[0044] Example 2: Design and Verification of KASP Tags
[0045] Based on the two SNP sites identified in Example 1, KASP markers were designed, and PCR amplification was performed using maternal parents, paternal parents, F1 etiolated offspring, and F1 green-leaved offspring as materials. Data analysis was conducted using quantitative real-time PCR, and the steps are as follows:
[0046] (1) For the two SNP sites in Example 1, two KASP markers (each consisting of two specific site primers and one universal primer) were designed and synthesized, namely KASP-TGY08G0002006b and KASP-TGY08G0002011b.
[0047] The KASP-TGY08G0002006b includes forward primers TGY08G0002006b-F1 and TGY08G0002006b-F2, and a reverse primer TGY08G0002006b-R. Forward primer TGY08G0002006b-F1 is ligated with the fluorescent label FAM, and forward primer TGY08G0002006b-F2 is ligated with the fluorescent label HEX. The nucleotide sequences of each primer are shown below (in the forward primer sequences, lowercase letters indicate the KASP fluorescent signal adapter, uppercase letters indicate the normal sequence, and the last base is the SNP genotyping site):
[0048] The nucleotide sequence of TGY08G0002006b-F1 is shown in SEQ ID NO.3, as follows (direction 5'-3'):
[0049] gaaggtgaccaagttcatgctTCCCAACTGCTTAAGACACCG;
[0050] The nucleotide sequence of TGY08G0002006b-F2 is shown in SEQ ID NO.4, as follows (direction 5'-3'):
[0051] gaaggtcggagtcaacggattTCCCAACTGCTTAAGACACCA;
[0052] The nucleotide sequence of TGY08G0002006b-R is shown in SEQ ID NO.5, as follows (direction 5'-3'):
[0053] ACAAGCAAACCAGAATCAATGGA.
[0054] The KASP-TGY08G0002011b includes forward primers TGY08G0002011b-F1 and TGY08G0002011b-F2, and reverse primer TGY08G0002011b-R. Forward primer TGY08G0002011b-F1 is ligated with the fluorescent label FAM, and forward primer TGY08G0002011b-F2 is ligated with the fluorescent label HEX. The nucleotide sequences of each primer are shown below (in the forward primer sequences, lowercase letters indicate the KASP fluorescent signal adapter, uppercase letters indicate the normal sequence, and the last base is the SNP genotyping site):
[0055] The nucleotide sequence of CsTGY08G0002011b-F1 is shown in SEQ ID NO.6, as shown below (direction 5'-3'), where "N" represents A, T, C, or G. During primer synthesis, each of the four bases accounts for 25%, resulting in an equal mixture of four primers:
[0056] gaaggtgaccaagttcatgctnACATCTGCTTCCATGCCTCTGCA;
[0057] The nucleotide sequence of CsTGY08G0002011b-F2 is shown in SEQ ID NO.7, as shown below (direction 5'-3'), where "N" represents A, T, C, or G. During primer synthesis, each of the four bases accounts for 25%, resulting in an equal mixture of four primers:
[0058] gaaggtcggagtcaacggattnACATCTGCTTCCATGCCTCTGCG;
[0059] The nucleotide sequence of CsTGY08G0002011b-R is shown in SEQ ID NO.8, as follows (direction 5'-3'):
[0060] CTGAAAAGGTCACAATCAGCCC.
[0061] (2) Using maternal parents, paternal parents, F1 etiolated offspring, and F1 green-leaved offspring as materials, DNA was extracted, PCR amplification was performed, and data analysis was conducted using quantitative real-time PCR. The specific procedures are as follows:
[0062] (a) Extract genomic DNA from the leaves and adjust the concentration to 10 ng / μL; add the DNA sample to a 96-well PCR plate, and add a negative control (NTC) to each PCR plate.
[0063] (b) Prepare the KASP genotyping mixture as follows: 5 μL DNA sample, 5 μL 2×KASP Master mix (containing FRET and Taq polymerase), and 0.14 μL KASP Assay mix (containing the above-mentioned KASP-TGY08G0002006b or KASP-TGY08G0002011b).
[0064] (c) Add the genotyping mixture to the PCR plate: Use a 10 μL pipette to add the required volume of genotyping mixture to the DNA sample; seal the PCR plate with a transparent membrane, and then centrifuge at 6000 rpm for 2 min.
[0065] (d) Perform PCR reaction: Perform KASP reaction on a conventional PCR instrument with the following program settings: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 55~60℃ extension for 60 s, 10 cycles; 94℃ denaturation for 20 s, 55℃ extension for 60 s, 26 cycles.
[0066] (3) KASP marker genotyping: After the PCR reaction, data were read using a real-time PCR instrument (with HEX and FAM fluorescence channels); the excitation and emission wavelengths of FAM fluorescence were 485nm and 520nm, respectively, and the excitation and emission wavelengths of HEX fluorescence were 535nm and 556nm, respectively; the genotype results of parents and offspring with different leaf colors were exported from the real-time PCR instrument.
[0067] (4) Results
[0068] Genotyping was performed on Golden Leaf, Zhongcha 102, Golden Leaf self-crossed progeny with extremely yellow leaves, yellow F1 hybrids, and green F1 hybrids using the marker KASP-TGY08G0002006b. The samples included: 6 Golden Leaf self-crossed progeny with extremely yellow leaves (genotype AA homozygous), 1 Golden Leaf hybrid and 10 yellow-leaf hybrids (genotype GA heterozygous), 1 Zhongcha 102 hybrid and 11 green-leaf hybrids (genotype GG homozygous), and 2 blank controls. The genotyping results are as follows: Figure 2 As shown, the genotyping results are accurate.
[0069] Genotyping was performed on Golden Leaf, Zhongcha 102, and the offspring of Golden Leaf self-crosses with extremely yellow leaves, yellow F1 hybrids, and green-leaf hybrids using the marker KASP-TGY08G0002011b. The samples included: 26 Golden Leaf offspring with extremely yellow leaves from self-crosses (genotype TT), 1 Golden Leaf offspring and 27 yellow-leaf hybrids (genotype CT), 1 Zhongcha 102 offspring and 26 green-leaf hybrids (genotype CC), and 1 blank control. The genotyping results are as follows: Figure 3 As shown, the genotyping results are accurate.
[0070] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.
Claims
1. A KASP primer, characterized in that: The KASP primers are designed for the SNP site, which is the 1435th position of the CDS sequence of CsTGY08G0002011b.t1, with a base of C or T. The CDS sequence of CsTGY08G0002011b.t1 is shown in SEQ ID NO.
2. The KASP primers consist of forward primer TGY08G0002011b-F1, forward primer TGY08G0002011b-F2, and reverse primer TGY08G0002011b-R. The nucleotide sequence of forward primer TGY08G0002011b-F1 is shown in SEQ ID NO.6, the nucleotide sequence of forward primer TGY08G0002011b-F2 is shown in SEQ ID NO.7, and the nucleotide sequence of reverse primer TGY08G0002011b-R is shown in SEQ ID NO.
8. Different fluorescent labels are attached to forward primers TGY08G0002011b-F1 and TGY08G0002011b-F2.
2. The KASP primer according to claim 1, characterized in that: The fluorescent label is selected from FAM or HEX.
3. The application of the KASP primers according to claim 1 or 2 in any of the following: gene typing of yellow-green leaf color in tea trees, identification of tea trees with yellow leaf color, and assistance in the breeding of tea trees with yellow leaf color, characterized in that: The tea tree is an F1 offspring created through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green-leaf tea tree 'Zhongcha 102' as parents; In practical applications, genomic DNA of the tea plant to be tested is extracted, PCR amplification is performed using the KASP primers described in claim 1 or 2, fluorescence detection is performed, and the genotype of the tea plant to be tested at the SNP site is obtained. Result interpretation: If the genotype is TT, it indicates that the tea tree to be tested is a tea tree with yellow leaves; if the genotype is CT, it indicates that the tea tree to be tested is a tea tree with yellow leaves; if the genotype is CC, it indicates that the tea tree to be tested is a tea tree with green leaves.
4. A method for gene typing of yellow-green leaf color in tea plants, characterized in that: Genomic DNA was extracted from the tea plant to be tested, and PCR amplification was performed using the KASP primers described in claim 1 or 2. Fluorescence detection was then performed to determine the genotype of the tea plant at the SNP site. The SNP site is the 1435th position of the CDS sequence of CsTGY08G0002011b.t1, with a base of C or T. The CDS sequence of CsTGY08G0002011b.t1 is shown in SEQ ID NO.
2. The tea trees to be tested are F1 offspring constructed through artificial hybridization using the yellowing tea tree 'Golden Leaf' and the green tea tree 'Zhongcha 102' as parents; Result interpretation: If the genotype is TT, it indicates that the tea tree to be tested is a tea tree with yellow leaves; if the genotype is CT, it indicates that the tea tree to be tested is a tea tree with yellow leaves; if the genotype is CC, it indicates that the tea tree to be tested is a tea tree with green leaves.