A three-layer embedded structure probiotic crystal ball with intestinal fixed-point sustained release and preparation method thereof

Abstract

The present invention belongs to the field of functional probiotic screening and application technology, and specifically provides a three-layer embedded structure probiotic crystal ball with intestinal fixed-point sustained release and a preparation method thereof. The probiotic crystal ball is composed of a core layer, a protective layer and an outer shell layer from the inside to the outside; wherein the core layer is added with plant lactobacillus and an edible plant oil with a melting point of 15°C-30°C, and the preservation number of the plant lactobacillus is CCTCC NO: M20221666. On the basis of screening a plant lactobacillus with a strong degradation effect on intestinal indole, the present invention constructs a probiotic crystal ball that can effectively protect the stability of the live bacteria amount of the original bacterial powder. The probiotic crystal ball prepared by the present invention can achieve fixed-point sustained release in the jejunum, ileum and colon, respectively, and the survival rate of live bacteria in the crystal ball is more than 90%, indicating that the probiotic crystal ball prepared by the present invention can well protect the probiotics to smoothly reach the fixed-point release of the intestine, and help the probiotics to exert their probiotic effects.

Description

Technical Field

[0001] The invention belongs to the technical field of functional probiotic screening and application, and specifically relates to a probiotic crystal ball with a three-layer embedding structure for intestinal fixed-point sustained release and a preparation method thereof. Background Art

[0002] Probiotics refer to live microorganisms in the human intestine that are beneficial to the health of the body. Probiotics have multiple functions for host health, including enhancing intestinal immune function, promoting digestion and absorption of nutrients, and maintaining the balance of intestinal flora.

[0003] However, probiotics can only play a beneficial role in the human body when a sufficient number of probiotics reach the intestine alive and colonize. In order to achieve the desired improvement effect, the Food and Agriculture Organization of the United Nations (FAO) and the World Health Organization (WHO) recommend that when regulating human health through probiotics, the number of live bacteria at the time of ingestion should be greater than 10 6 -10 7 CFU / g. However, it is very difficult to maintain the vitality of probiotics. Most probiotics have poor resistance and are easily inactivated by external environmental conditions such as light, temperature, and oxygen during processing, transportation, and storage. After ingestion, probiotics also face the test of a complex gastrointestinal environment. For example, low pH, bile, pancreatic juice, and high concentrations of digestive enzymes can inactivate exogenous probiotics in the gastrointestinal environment.

[0004] In response to the various challenges faced in achieving effective probiotic intestinal delivery, current solutions mainly focus on the following aspects:

[0005] (1) Through screening, strains with strong stress resistance and high adhesion and colonization ability are directly obtained;

[0006] (2) Using genetic engineering technology to transform probiotics and enhance the resistance and adhesion and colonization capabilities of strains;

[0007] (3) By controlling the probiotic culture conditions, such as culture medium composition, culture temperature, pH value, etc., the physiological structure of probiotics can be adjusted to improve the survival rate of the bacteria under adverse environmental conditions.

[0008] But in terms of actual production, using microencapsulation crystal ball technology to separate probiotics from the adverse external environment is one of the most practical and effective means to protect probiotics. Summary of the invention

[0009] The purpose of the present invention is to provide a probiotic crystal ball with a three-layer embedding structure for sustained release at a specific point in the intestine and a preparation method thereof. The probiotic crystal ball contains Lactiplantibacillus plantarum and can achieve effective sustained release of the probiotics at a specific point in the intestine.

[0010] The present invention firstly provides a probiotic crystal ball with a three-layer embedding structure, wherein the probiotic crystal ball comprises a core layer, a protective layer and an outer shell layer from the inside to the outside.

[0011] Furthermore, the mass ratio of the core layer, the protective layer and the outer shell layer of the probiotic crystal ball is 5:3:2 or 9:6:5.

[0012] The core layer of the probiotic crystal ball is composed of Lactobacillus plantarum powder and edible vegetable oil.

[0013] The plant lactobacillus is plant lactobacillus VHProbi SY, which was deposited in the China Type Culture Collection of Wuhan University, Wuhan, China on October 26, 2022, and its deposit number is CCTCC NO: M20221666.

[0014] Furthermore, the mass ratio of Lactobacillus plantarum powder to edible vegetable oil in the core layer of the probiotic crystal ball is 1:9.

[0015] The protective layer of the probiotic crystal ball consists of edible vegetable oil and sustained-release agent.

[0016] The mass ratio of edible vegetable oil and sustained-release agent in the protective layer of the probiotic crystal ball is 4-9:1.

[0017] The melting point of the edible vegetable oil is 30°C-37°C.

[0018] The sustained-release agent is a mixture of hydroxypropyl methylcellulose and stearic acid, or a mixture of hydroxypropyl methylcellulose, ethyl cellulose and stearic acid.

[0019] As a specific description of the embodiment, the mass ratio of hydroxypropyl methylcellulose to stearic acid in the sustained-release agent is 1:1.

[0020] As a specific description of the embodiment, the mass ratio of hydroxypropyl methylcellulose, ethyl cellulose and stearic acid in the sustained-release agent is 3:2:1.

[0021] The outer shell layer of the probiotic crystal ball consists of gelatin, chitosan, gum arabic and water.

[0022] The mass ratio of gelatin, chitosan, gum arabic and water in the outer shell layer of the probiotic crystal ball is 5:3:3:39.

[0023] The invention discloses an application of the probiotic crystal sphere in preparing food.

[0024] The present invention is based on the screening of a strain of Lactobacillus plantarum VHProbi SY that has a strong degradation effect on intestinal indole, and constructs a probiotic crystal ball that can effectively protect the stability of the live bacteria amount of the original bacterial powder.T The value is increased by more than 2 times. At the same time, the probiotic crystal sphere can effectively improve the tolerance of the original bacterial powder to artificial gastric juice. After digestion with artificial gastric juice of pH 1.2, 2.0, 3.0 and 4.0, the survival rate of live bacteria is as high as more than 95%. In the in vitro gastrointestinal digestion simulation, the probiotic crystal spheres prepared by the present invention can achieve fixed-point sustained release in the jejunum, ileum and colon, respectively, and the survival rate of live bacteria in the probiotic crystal spheres is more than 90%. This shows that the probiotic crystal spheres prepared by the present invention can well protect the probiotics to smoothly reach the fixed-point release in the intestine, and help the probiotics to exert their probiotic effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is a growth curve of Lactobacillus plantarum VHProbi SY in a medium containing indole;

[0026] Figure 2 This is the colony morphology of Lactobacillus plantarum VHProbi SY;

[0027] Figure 3 is the Riboprinter fingerprint of Lactobacillus plantarum VHProbi SY;

[0028] Figure 4 is the RAPD fingerprint of Lactobacillus plantarum VHProbi SY;

[0029] Figure 5 is the rep-PCR fingerprint of Lactobacillus plantarum VHProbi SY;

[0030] Figure 6 It is the MALDI-TOF-MS protein fingerprint of Lactobacillus plantarum VHProbi SY;

[0031] Figure 7 This is a comparative test result of the tolerance of Lactobacillus plantarum VHProbi SY powder and crystal spheres in artificial gastric juice;

[0032] Figure 8 Graphs showing the stability comparison test results of Lactobacillus plantarum VHProbi SY powder and crystal spheres; wherein, a is a graph showing the accelerated stability test results of the original powder live bacteria, b is a graph showing the accelerated stability test results of the crystal spheres of Example 8, and c is a graph showing the accelerated stability test results of the crystal spheres of Example 9. DETAILED DESCRIPTION

[0033] The plant lactobacillus VHProbi SY provided by the present invention has a strong degradation effect on intestinal indole, can significantly degrade indole in vitro, can effectively degrade intestinal indole, and the 48h degradation rate is 58.14%. The strain has strong tolerance to artificial gastrointestinal fluid, is sensitive to common antibiotics such as erythromycin and ampicillin, does not produce hemolysin, cannot dissolve blood cells, and has good biological safety. The plant lactobacillus VHProbi SY provided has strong antioxidant capacity and cholesterol degradation capacity, the scavenging rates of DPPH free radicals and HRS free radicals are as high as 89.02% and 90.12% respectively, the degradation rate of cholesterol reaches 78.79%, and the anti-lipid peroxidation inhibition rates of the fermentation supernatant, bacterial body, and intracellular extract of the plant lactobacillus VHProbi SY are 72.99%, 82.82%, and 89.09% respectively.

[0034] The present invention is described in detail below in conjunction with embodiments and drawings.

[0035] Example 1. Screening of strains

[0036] 1. Strain Isolation

[0037] Prepare MRS (Man Rogosa Sharpe) broth: 1L of pure water, 10g of peptone, 10g of beef extract, 5.0g of yeast extract, 5g of sodium acetate, 5g of glucose, 2g of potassium dihydrogen phosphate, 1.0mL of Tween 80, 2.0g of diammonium citrate, 20g of calcium carbonate, 0.58g of magnesium sulfate heptahydrate, 0.25g of manganese sulfate heptahydrate, and adjust the pH to 6.2-6.5.

[0038] Prepare MRS agar medium: add 15 g agar to 1 L MRS broth.

[0039] Take 1g of fresh naturally fermented kimchi fermentation liquid, dilute it with sterile physiological saline, put it into a sterile sample bag, beat it with a homogenizer, take 100μL of the mixed liquid for gradient dilution, spread it on MRS agar medium, and culture it anaerobically at 37℃ for 48h, and wait for single colonies to grow on the plate for microscopic examination. According to the results of microscopic examination, the applicant screened out 12 potential lactic acid bacteria single colonies, named A1, A2, ..., A11, A12 respectively.

[0040] 2. In vitro screening of indole-degrading strains

[0041] 2.1 Preparation

[0042] Preparation of indole solution: Use 70% ethanol to prepare 30 mg / ml indole stock solution, sterilize with 0.22 μm filter membrane and set aside for use. When using, dilute with strain culture medium to the required concentration.

[0043] Strain preparation: streak the screened or activated single colony of lactic acid bacteria, take the frozen lactic acid bacteria glycerol tube, aseptically streak it onto the MRS plate, and culture it at 37℃ for 48 to 72 hours.

[0044] Preparation of lactic acid bacteria solution: After a single colony grows on the plate, aseptically pick it into MRS broth and culture it at 37℃ for 24 hours. Inoculate it into fresh MRS broth at a 1% inoculum volume, about 6 ml for each strain.

[0045] 2.2 Tolerance test of strains to different concentrations of indole

[0046] Indole was diluted to 0, 50, 100, 200, 300, 400, 600 μg / ml with the strain culture medium, and the strain was inoculated at 1% inoculation volume, and the growth curve of the strain was monitored by an ELISA instrument. The results showed that the strain activity was not affected when the medium contained low concentrations of indole, and even slightly promoted the growth of the strain. When the indole content in the culture medium was close to 300 μg / ml, the strain activity was inhibited. At the same time, according to the data, the indole content of human intestine or feces was 0.25-2.6mM, which was about 45-468 μg / ml. Therefore, 300 μg / ml was used as the indole addition concentration to verify the indole degradation ability of the strain during screening.

[0047] 2.3 Detection of the ability of strains to metabolize indole

[0048] Add indole to the fresh medium containing 1% strain to make the final concentration of 300 μg / ml. Take 1.5 ml of the medium into a new EP tube at 0h, 24h, and 48h after adding indole, centrifuge at 10000g / min for 3min, collect the supernatant, and use the indole detection kit to detect the indole content in the supernatant. The operation method and result determination are carried out according to the Indole Assay Kit instructions.

[0049] Calculation of indole degradation rate: indole degradation rate = (initial concentration - final concentration) / initial concentration × 100%.

[0050] The results showed that among the 12 potential lactic acid bacteria isolated by the present invention, 8 strains had a 24-hour indole degradation rate of more than 30%, among which A3 had a 24-hour indole degradation rate of 34.42±3.33%; 3 strains had a 48-hour indole degradation rate of more than 50%, among which A3 had a 48-hour indole degradation rate of 58.14±1.27%, the highest among all strains. The growth curve of strain A3 in different indole concentrations is shown in FIG. Figure 1 shown.

[0051] Example 2, strain identification

[0052] 1. Colony morphology identification

[0053] The A3 strain was inoculated on MRS agar medium and cultured anaerobically at 37°C for 24 hours. The colony morphology of the A3 strain was as follows: Figure 2 As shown, single colonies are milky white, with diameters of mostly more than 1.0 mm and a smooth surface. Under the microscope, the bacteria appear as long rods of uneven length, arranged singly or in pairs or chains.

[0054] 2. Identification of physiological and biochemical characteristics

[0055] The inoculation solution in this example was prepared as follows: Under sterile conditions, an appropriate amount of fresh bacterial solution of the A3 strain was taken, centrifuged at 5000 rpm / min for 5 min, washed twice with PBS buffer, and then resuspended with the same volume of PBS buffer and diluted 50 times to serve as the inoculation solution.

[0056] 2.1. Salinity tolerance test

[0057] Under sterile conditions, 190 μL of BSM liquid culture medium with salt concentrations of 1%, 2%, 3%, 4%, 5%, 6%, 7%, and 8% was added to the 96-well plate, and 3 parallels were made for each salt concentration. Then 10 μL of inoculation solution was added, and the wells without bacteria were used as controls. 50 μL of autoclaved paraffin oil was added to each well to prevent water evaporation during the culture process. Place it at a constant temperature of 37°C and observe whether the culture medium becomes turbid. The results showed that the maximum tolerance salt concentration of the A3 strain was 5%.

[0058] 2.3 Carbon source metabolism test

[0059] The API 50CHL reagent strip was used to conduct a carbon source metabolism experiment on the A3 strain. The experimental method and result interpretation are detailed in the API 50CHL kit manual. The identification result of the A3 strain was: %ID=99.9 and T value=0.79. The API result was Lactobacillus plantarum. The results are shown in Table 1.

[0060] Table 1: API 50CHL test results of strains

[0061]

[0062] 2.4 Glucose acid and gas production test

[0063] The culture medium formula used in this example is as follows:

[0064] Peptone 0.5 g; yeast extract 0.3 g; Tween 80 0.1 mL; saline solution A 0.5 ml; saline solution B 0.5 ml; sodium acetate 0.5 g; glucose 2.5 g; 2% bromocresol green (w / v) 0.05 mL; distilled water 100 ml; pH 6.8-7.0.

[0065] The prepared culture medium was dispensed into a large test tube containing an inverted small test tube, 3 mL / tube, and sterilized under high pressure at 121°C for 15 min.

[0066] Salt solution A ingredients: KH 2 PO 4 10g, K 2 HPO 4 1.0g, dissolved in distilled water and made up to 100mL.

[0067] Salt solution B ingredient: MgSO 4 7H 2 O 11.5g, MnSO 4 ·2H 2 O 2.4g, FeSO 4 7H 2 O 0.68g, dissolved in distilled water, dilute to 100mL.

[0068] Under sterile conditions, inoculate the culture medium with 10% of the inoculum and use the uninoculated culture medium as a control. Then seal the top with 2 mL of sterile liquid paraffin and culture at 37°C for 24 hours to observe whether the culture medium changes in color.

[0069] The results showed that after culturing at 37°C for 24 hours, the culture medium changed from green to yellow and there was no gas in the small inverted tube, indicating that the A3 strain fermented glucose to produce acid but not gas.

[0070] 3. Molecular Biology Identification

[0071] 3.1 16S rDNA gene sequence analysis

[0072] 3.1.1 Genomic DNA extraction

[0073] The operation was performed according to the Tiangen Bacteria Genomic DNA Extraction Kit (Catalog Number: DP302).

[0074] 3.1.2. 16S rDNA gene amplification

[0075] Primer sequences:

[0076] 27F: AGAGTTTGATCCTGGCTCA (SEQ ID NO: 1);

[0077] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 2).

[0078] The 16s rDNA sequence SEQ ID NO: 3 of the A3 strain was obtained by sequencing, and the sequence was compared with the NCBI database, and the A3 strain was preliminarily determined to be Lactobacillus plantarum.

[0079] The specific sequence of 16s rDNA is as follows (SEQ ID NO: 3):

[0080]

[0081] 3.2Riboprinter fingerprint

[0082] Use a bacterial stick to pick up a single colony of the purified A3 strain from the agar medium plate, put it into a sample tube with buffer, stir it with a handheld stirrer to suspend it in the buffer, then put the sample rack into the heater to inactivate it and put it into the Riboprinter system. After DNA preparation, membrane transfer, imaging detection and data processing, the bacterial identification results are obtained. The identification results show that the A3 strain is Lactobacillus plantarum, and its Riboprinter fingerprint results are shown in Figure 3 .

[0083] 3.3 RAPD and rep-PCR fingerprint identification

[0084] 3.3.1 RAPD fingerprint identification

[0085] Primer sequence: GAGGGTGGCGGTTCT (SEQ ID NO: 4).

[0086] Table 2: RAPD reaction system table

[0087]

[0088]

[0089] A 1.5% agarose gel plate was prepared, and DL2000 DNA Marker was used as the result control. The electrophoresis was conducted at 100 V for 80 min, and the electrophoresis pattern was finally detected using a gel imaging system. Figure 4 shown.

[0090] 3.3.2 rep-PCR fingerprint

[0091] Primer sequence: CTACGGCAAGGCGACGCTGACG (SEQ ID NO: 5).

[0092] Reaction system of rep-PCR

[0093] Table 3: Rep-PCR reaction system

[0094]

[0095] DL2000 DNAMarker was used as the result control. The voltage was 100V and the electrophoresis time was 80min to detect the amplification results. The rep-PCR fingerprint of strain A3 is shown in Figure 5 shown.

[0096] 3.4 MALDI-TOF-MS detection of ribosomal protein expression

[0097] Inoculate fresh bacterial liquid in MRS liquid culture medium at a 0.1% inoculation rate, culture at 37°C, 150rpm for 48 hours, collect the bacteria, wash with sterile water 4 times, and dry the surface moisture. Then take a small amount of fresh bacteria and evenly apply it on the target plate in the form of a thin film, add 1μL of lysis solution to cover the sample, and after drying, add 1μL of matrix solution to cover the sample. After drying, put the sample target into the mass spectrometer for identification. Irradiate the co-crystallized film formed by the sample and the matrix with a laser to ionize the protein in the sample. The ions are accelerated to fly through the flight channel under the action of a 10-20KV electric field, and the molecular weight of the protein is detected according to the different flight times reaching the detector. The protein fingerprint map was obtained using Autofms 1000 analysis software Autof Analyzer v1.0. The ion peaks of the main ribosomal proteins of the A3 strain are: m / z4700.168, 5893.391, 9400.959. The identification results are as follows Figure 6 shown.

[0098] 3.5 Whole genome sequencing

[0099] Inoculate fresh bacterial liquid in MRS liquid medium at 0.1% inoculation volume, culture at 37℃ for 20h, centrifuge at 8000rpm for 10min, and collect the bacteria. The bacteria were sent to the sequencing center to obtain the whole genome sequence of the bacteria. The genome sequence has been uploaded to the NCBI gene database. Its genome contains 1 chromosome and 2 plasmids. The GenBank accession numbers are CP134220, CP134221, and CP134222.

[0100] Combined with the colony morphology, physiological and biochemical characteristics and molecular biological identification results of strain A3, strain A3 was determined to be a new strain of Lactobacillus plantarum and named Lactobacillus paracasei VHProbi SY.

[0101] Example 3: Antibiotic tolerance test of Lactobacillus plantarum VHProbi SY

[0102] The specific results of the minimum inhibitory concentration (MIC) values ​​of antibiotics against Lactobacillus plantarum VHProbi SY determined by the microbroth dilution method are shown in Table 4.

[0103] Table 4: Antibiotic MIC values ​​of Lactobacillus plantarum VHProbi SY

[0104]

[0105] MIC unit: μg / mL.

[0106] From the results in Table 4, it can be seen that the Lactobacillus plantarum VHProbi SY provided by the present invention is sensitive to common antibiotics such as erythromycin, ampicillin and clindamycin, and has good biosafety.

[0107] Example 4: Surface hydrophobicity test

[0108] After activating the MRS liquid culture medium of strain A3, aspirate 1 ml of bacterial solution and centrifuge at 6000 rpm for 2 minutes. Collect the bacteria and rinse them twice with PBS solution. Resuspend the bacteria with 1 ml of sterilized 0.1M KNO3 solution. Dilute the bacterial suspension three times and record OD600 as A0. Add one-third volume of xylene to the bacterial suspension, mix well and let stand at room temperature for 10 minutes (a two-phase system is formed at this time). Vortex the two-phase system for 2 minutes and then let stand for 20 minutes to re-form the aqueous phase and organic phase. Carefully aspirate the aqueous phase and measure the absorbance A1 at OD600nm. Calculate the cell hydrophobicity according to the following formula and take the average value of three experiments.

[0109] Hydrophobicity (%) = (A0-A1) / A1 x 100%.

[0110] The results showed that the surface hydrophobicity of strain A3 was 69.18%±2.45%.

[0111] Example 5: Test of intestinal cell adhesion of Lactobacillus plantarum VHProbi SY

[0112] Caco-2 cells were grown at 2×10 6 The inoculum volume of cells / well was inoculated into a six-well plate and cultured in a carbon dioxide incubator for 24 h for cell adhesion experiments. The stable phase Lactobacillus plantarum VHProbi SY strain was resuspended in MRS medium to 5×10 7 CFU / mL; take 1mL of the above strain and add it to the six-well plate with cells attached to the wall, and culture it in a carbon dioxide incubator for 2h; wash it repeatedly with PBS for 3 times to remove the non-adherent bacteria; add 500μl of trypsin to digest for 3 minutes, then add 1.5mL of cell culture medium to terminate the digestion, blow it repeatedly, and collect the resulting solution into a sterile EP tube, and dilute the collected solution by 10 times, 100 times, 1000 times, and 10000 times, and count it on the plate. At the same time, count the cells in the blank group. Calculate the adhesion ability of the test strain according to the following formula:

[0113] Adhesion capacity (CFU / cells) = total number of bacteria adhered to each culture well / total number of cells in each culture well.

[0114] The results showed that the adhesion ability of Lactobacillus plantarum VHProbi SY was 55.79 and the standard deviation was 1.31.

[0115] Example 6. Determination of the antioxidant function of Lactobacillus plantarum VHProbi SY

[0116] 1. Determination of the ability of strains to remove DPPH (1,1-diphenyl-2-trinitrophenylhydrazine)

[0117] A single colony of plant lactobacillus VHProbi SY with good growth status was inoculated into 3 mL of MRS liquid culture medium, cultured at 37°C for 18-20 hours, and the culture solution was used as inoculum, inoculated into 50 mL of MRS liquid culture medium at an inoculum volume of 2%, and cultured for 18 hours to obtain the culture solution of the strain. After collecting the bacterial cells by absorbing 1 mL of bacterial solution, the bacterial cells were washed twice with 1 mL of PBS buffer, and then 2 mL of PBS solution was added to resuspend the bacterial cells to obtain a bacterial suspension.

[0118] Take 1mL of Lactobacillus plantarum VHProbi SY suspension, add 1mL of 0.4mM DPPH free radical solution, mix well and then place it at room temperature for 30min in the dark, then measure the absorbance of the sample at a wavelength of 517nm A sample, measure 3 times in parallel. The control group sample is zeroed with an equal volume of PBS solution and DPPH·ethanol mixture, and an equal volume of Lactobacillus plantarum VHProbi SY suspension and ethanol mixture.

[0119] The clearance rate was calculated according to the following formula:

[0120] Clearance % = [1-(A 样品 -A 空白 ) / A 对照 ]×100%.

[0121] The results are shown in Table 5.

[0122] Table 5: Scavenging effect of Lactobacillus plantarum VHProbi SY on DPPH free radicals

[0123]

[0124] 2. Determination of the ability of strains to eliminate HRS

[0125] After mixing 100 μL of 5 mM sodium salicylate-ethanol solution, 100 μL of 5 mM ferrous sulfate, 500 μL of deionized water and 200 μL of Lactobacillus plantarum VHProbi SY bacterial suspension, 100 μL of hydrogen peroxide solution (3 mM) was added, and the sample was incubated in a water bath at 37° C. for 15 min, and the absorbance of the sample was measured at a wavelength of 510 nm.

[0126] The hydroxyl radical scavenging rate was calculated according to the following formula.

[0127] Clearance % = (A样品 -A 控制 ) / (A 空白 -A 控制 )×100%.

[0128] Among them: A 控制 Deionized water was used as a substitute for the sample. 空白 Replace sample and H with deionized water 2 O 2 .

[0129] The specific results are shown in Table 6.

[0130] Table 6: Effect of Lactobacillus plantarum VHProbi SY on the elimination of HRS

[0131]

[0132] 3. Identification of strains against lipid peroxidation

[0133] 1) Strain culture and preparation of fermentation supernatant, bacterial cells and intracellular extracts:

[0134] The plant lactobacillus VHProbi SY strain was cultured in MRS liquid medium at 37°C for 24 hours. After three generations, the culture was centrifuged at 6000r / min and 4°C for 10 minutes, and the supernatant was collected as the fermentation supernatant. The collected cells were centrifuged at 6000r / min for 10 minutes with PBS buffer (pH 7.4) and washed three times. The cells were resuspended in PBS buffer and the cell concentration was adjusted to 1.0×10 9 cells / mL, and obtain bacterial suspension. The bacterial suspension was ultrasonically disrupted by ultrasonication for 20 minutes to obtain intracellular extract.

[0135] (2) Preparation of linoleic acid emulsion:

[0136] 0.1 mL linoleic acid, 0.2 mL Tween 20, 19.7 mL deionized water.

[0137] (2) Experimental process

[0138] 1 mL of linoleic acid emulsion and 1 mL of FeSO4 were added to 0.5 mL of PBS solution (pH 7.4). 4 (1%), then add 0.5 mL sample, incubate in 37 °C water bath for 1.5 h, add 0.2 mL TCA (4%) and 2 mL TBA (0.8%) to the mixture, incubate in 100 °C water bath for 30 min, cool rapidly, centrifuge at 4000 rpm / min for 15 min, collect the supernatant and measure the absorbance at 532 nm to obtain A; the control group is replaced by 0.5 mL distilled water to obtain A 0 .

[0139] Inhibition rate / % = (A 0 -A) / A 0 ×100%.

[0140] Note: A is the absorbance of the sample group; A 0 is the absorbance of the control group.

[0141] Table 7: Anti-lipid peroxidation inhibition effect of Lactobacillus plantarum VHProbi SY

[0142]

[0143] Example 7: In vitro cholesterol degradation test with Lactobacillus plantarum VHProbi SY

[0144] 1. Qualitative test of bile salt enzyme activity

[0145] Preparation of bile salt-containing MRS solid plates: Add 0.2% TCA, 0.2% sodium thioglycolate, 0.37 g / L CaCl to freshly prepared MRS liquid medium. 2 and 1.5% agar. Sterilize at 121℃ for 15min, pour into a plate, and condense for later use.

[0146] Preparation of MRS solid plates: Sterilize fresh MRS medium at 121℃ for 15 min, pour into the plate and condense for later use.

[0147] Lactobacillus plantarum VHProbi SY was streaked on an MRS plate for isolation and purification. A single colony was taken for identification and then streaked on an MRS plate and an MRS plate containing bile salts. The results were observed after culturing at 37°C for 72 hours and photographed for archiving.

[0148] The results showed that there was no difference between the streaked colonies on the two plates, and no other substances were produced next to the colonies, indicating that the bile salt enzyme activity of Lactobacillus plantarum VHProbi SY was negative.

[0149] 2. Cholesterol degradation test

[0150] Preparation of cholesterol micelle solution: Accurately weigh 1 g of cholesterol, dissolve it in anhydrous ethanol, and make up to 100 mL. Filter and sterilize it with a 0.22 μm microporous filter membrane under sterile conditions.

[0151] Weigh 10.0 g of peptone, 10.0 g of beef extract, 5.0 g of yeast extract, 2.0 g of diammonium hydrogen citrate, 20.0 g of glucose, 1.0 mL of Tween 80, 5.0 g of sodium acetate, 0.1 g of magnesium sulfate, 0.05 g of manganese sulfate, 2.0 g of dipotassium hydrogen phosphate, 1 g of bile salt, and 1000 mL of distilled water, adjust the pH to 7.3, sterilize at 115°C for 30 min, and then add cholesterol solution to make the final cholesterol concentration 0.1%.

[0152] Inoculate fresh Lactobacillus plantarum VHProbi SY culture at a 0.1% inoculum volume, culture at 37°C for 48 hours, then take 0.2 mL of the culture, add 1.8 mL of anhydrous ethanol, mix, let stand for 10 minutes, centrifuge at 3000 rpm for 5 minutes, and take the supernatant for cholesterol determination. The cholesterol determination method is in accordance with GB / T 5009.128-2016 <Determination of cholesterol in food>.

[0153] The results showed that the degradation rate of cholesterol by Lactobacillus plantarum VHProbi SY provided by the present invention reached 78.79% (this data does not contain bile salts).

[0154] Example 8 Probiotic crystal spheres containing Lactobacillus plantarum and preparation method thereof

[0155] 1. Preparation of crystal ball core liquid

[0156] Mix Lactobacillus plantarum VHProbi SY powder and hydrophobic material in a mass ratio of 1:9. The hydrophobic material is specifically an edible vegetable oil (palm oil or glycerol fatty acid ester) with a melting point of 15°C to 30°C. Dissolve the oil at a temperature of 30°C to 35°C until it is clear, add Lactobacillus plantarum VHProbi SY powder, and stir with a stirrer at 200rpm for 15min to mix and disperse the powder in the oil to obtain a crystal ball core liquid. Pour it into the core liquid storage tank of the capsule machine, set the core liquid storage tank temperature to 30-35°C, and the stirring speed to 10rpm.

[0157] 2. Preparation of crystal ball protective layer liquid

[0158] Mix edible vegetable oil (palm oil or glycerol fatty acid ester, melting point 30℃~37℃) and sustained-release agent in a mass ratio of 9:1 as the protective layer liquid. The sustained-release agent is a 1:1 swelling mixture of hydroxypropyl methylcellulose and stearic acid. Heat the oil at a temperature of 37℃~42℃, add the sustained-release agent and mix it with a homogenizer to obtain the protective layer liquid. Pour it into the protective layer solution storage tank of the capsule machine, and set the temperature of the protective layer liquid storage tank to maintain at 37~42℃.

[0159] 3. Preparation of crystal ball shell liquid

[0160] Mix gelatin, chitosan, gum arabic and purified water to make the shell liquid. The mass ratio of gelatin, chitosan, gum arabic and purified water is 5:3:3:39. Add gelatin to purified water, stir it in a water bath at 70°C to dissolve it, then add the formulated amount of chitosan and gum arabic, continue heating in a water bath at 70°C, stir to dissolve it, and obtain the shell liquid. Pour it into the shell liquid storage tank of the capsule machine, and set the shell liquid storage tank temperature to maintain at 70°C.

[0161] The core layer liquid, protective layer liquid and shell liquid are dripped into the cooling liquid composed of cooled liquid oil through a nozzle with a concentric triple structure by pressure, and the pump head pump speed is adjusted to 650mL / h, the inner core tank pressure is 5Kpa, and the cooling liquid is soybean oil at 10℃~12℃. The core layer liquid, protective layer liquid and shell liquid are dripped out through the inner, middle and outermost channels respectively at the same time, so that the shell liquid tightly wraps the protective layer liquid and the core layer liquid, thereby forming a continuous three-layer structure crystal ball.

[0162] The mass ratio of the core layer, protective layer and outer shell layer of the crystal ball is 9:6:5.

[0163] The prepared three-layer crystal sphere is low-temperature dried at 35° C. or naturally dried to obtain a probiotic crystal sphere with a diameter of about 2.0 mm.

[0164] Example 9 Probiotic crystal spheres containing Lactobacillus plantarum and preparation method thereof

[0165] 1. Preparation of crystal sphere core layer liquid: the components and preparation method are the same as those in Example 8.

[0166] 2. Preparation of crystal ball protective layer liquid:

[0167] Mix edible vegetable oil (palm oil or glycerol fatty acid ester, melting point 30℃~37℃) and sustained-release agent in a mass ratio of 4:1 as the protective layer liquid. The sustained-release agent is a swollen mixture of hydroxypropyl methylcellulose, ethyl cellulose and stearic acid in a ratio of 3:2:1. Heat the oil at a temperature of 37℃~42℃, add the sustained-release agent and mix it with a homogenizer to obtain the protective layer liquid. Pour it into the protective layer solution storage tank of the capsule machine, and set the temperature of the protective layer storage tank to be maintained at 37~42℃.

[0168] 3. Preparation of crystal sphere shell liquid: the components and preparation method are the same as those in Example 8.

[0169] The core layer liquid, protective layer liquid and shell liquid are dripped into the coolant composed of cooled liquid oil through a nozzle with a concentric triple structure by pressure, the pump speed of the pump head is adjusted to 630mL / h, the pressure of the inner core tank is 10Kpa, the coolant is liquid paraffin at 10℃~12℃, the core layer liquid, protective layer liquid and shell liquid are dripped out through the inner, middle and outermost channels respectively, so that the shell liquid tightly wraps the protective layer liquid and the core layer liquid, thereby forming a continuous three-layer structure crystal ball.

[0170] The mass ratio of the core layer, protective layer and outer shell layer of the crystal ball is 5:3:2.

[0171] The prepared three-layer crystal spheres were naturally dried at room temperature to obtain probiotic crystal spheres with a diameter of about 2.5 mm.

[0172] Example 10 Tolerance of probiotic crystal spheres in artificial gastric juice

[0173] 1. Preparation of artificial gastric juice

[0174] 1.1 Solution preparation

[0175] Electrolyte solution A: Weigh 0.064 g potassium chloride, 0.015 g potassium dihydrogen phosphate, 0.263 g sodium bicarbonate, 0.345 g sodium chloride, 0.003 g magnesium chloride hexahydrate, 0.006 g ammonium carbonate, 1.5 g tryptone, and 0.05 g L-cysteine ​​hydrochloride monohydrate, add 95 mL distilled water to fully dissolve, adjust the pH to 3.0 with 1 M sodium hydroxide solution, make up to 100 mL, and sterilize by high pressure at 121°C for 15 min.

[0176] Electrolyte solution B: Weigh 0.022 g of calcium chloride dihydrate, dissolve it in water and make up to 100 mL, and sterilize it by high pressure at 121°C for 15 min.

[0177] Dissolving solution: weigh 8.5 g of sodium chloride and 0.5 g of L-cysteine ​​hydrochloride monohydrate, add 1000 mL of distilled water to fully dissolve, and sterilize at 121°C for 15 min after aliquoting.

[0178] 1.2 Preparation of artificial gastric juice

[0179] According to the actual situation, this example selected three different simulated gastric fluid conditions to carry out the gastric fluid tolerance test of probiotic crystal spheres. The main parameters of the method are shown in Table 8.

[0180] Table 8: Main parameters of gastric juice tolerance test method

[0181]

[0182] Take 8.0 mL of electrolyte solution A and 1.0 mL of electrolyte solution B in a beaker, add pepsin equivalent to 4000 U, adjust the pH value with 1 M hydrochloric acid solution or 1 M sodium hydroxide solution according to the simulated gastric fluid conditions in Table 8, make the volume to 10 mL, mix well and filter through a 0.22 μm sterile filter membrane to prepare simulated gastric fluid, which is prepared and used immediately.

[0183] In addition, this embodiment also uses artificial gastric juice in the gastrointestinal disintegration test for tablets / capsules / pills in the 2020 edition of the "Pharmacopoeia of the People's Republic of China". The preparation and inspection method is: 16.4mL of dilute hydrochloric acid, add about 800ml of water and 10g of pepsin, shake well, dilute with water to 1000mL, adjust the pH to about 1.2, and process for 2h.

[0184] 2. Experiment on tolerance of bacterial powder to artificial gastric juice

[0185] 2.1 Determination of bacterial powder quantity

[0186] The initial bacterial count of Lactobacillus plantarum VHProbi SY powder was determined in accordance with GB4789.35-2016 "Food Microbiology Examination - Examination of Lactic Acid Bacteria".

[0187] 2.2 Experiment on tolerance of bacterial powder to artificial gastric juice

[0188] Weigh 1.0g of bacterial powder aseptically, place it in a sterile homogenizing bag containing 99mL of dissolving solution, mix thoroughly, and beat it with a homogenizer at 10 times / second for 3min until the bacterial powder is evenly dispersed to prepare a sample bacterial solution for immediate use. Take 5.0mL of simulated gastric fluid and 5.0mL of sample bacterial solution in a 50mL centrifuge tube, vortex mix, and place the centrifuge tube in a 37℃ constant temperature water bath for the specified treatment time according to different simulated gastric fluid conditions. According to GB4789.35-2016 "Food Microbiology Test Lactic Acid Bacteria Test", the amount of live bacteria before and after artificial gastric juice digestion is determined, and the survival rate of bacterial powder after artificial gastric juice digestion is obtained by comparing the data before and after artificial gastric juice digestion.

[0189] 3. Probiotic crystal sphere artificial gastric juice tolerance test

[0190] 3.1 Determination of crystal spherical bacteria

[0191] 98 ml of the anaerobic dilution solution was kept warm in a 45°C water bath for 5 min, and 2 g of the probiotic crystal balls in Example 8 and Example 9 were added respectively, warmed for 5 min, homogenized with a homogenizer at 45°C for 5 min, and then the amount of crystal balls was determined according to GB4789.35-2016 "Food Microbiology Test - Lactic Acid Bacteria Test".

[0192] 3.2 Crystal sphere artificial gastric juice tolerance test

[0193] Weigh 2.5g of the probiotic crystal balls in Example 8 and Example 9, add them to 5.0mL simulated gastric juice, place them in a centrifuge tube, and cultivate the prescribed treatment time in a 37°C constant temperature water bath. Remove the artificial gastric juice by filtering with filter paper, then place the filtered crystal balls in a sterile container, soak them with 18mL saline for 10min, then filter with filter paper, and rinse them twice with sterile saline, then add anaerobic diluent to make the total weight of the crystal balls and anaerobic diluent about 10g, and record the true mass. Then measure the bacterial amount according to the method for measuring the amount of crystal balls. The survival rate of the probiotic crystal balls after artificial gastric juice digestion is obtained by comparing the data before and after the artificial gastric juice digestion of the probiotic crystal balls.

[0194] Artificial gastric juice digestion results Figure 7As shown, the probiotic crystal spheres prepared in Example 8 and Example 9 can withstand digestion in four artificial gastric juices of different pH values, and the survival rate of live bacteria is as high as over 95%; while the survival rate of bacterial powder in pharmacopoeia gastric juice, fasting gastric juice, standard gastric juice and full gastric juice is relatively low, which are 0.09%, 3.22%, 22.30% and 66.79% respectively, indicating that the crystal sphere structure can greatly improve the tolerance of Lactobacillus plantarum VHPobi SY to artificial gastric juice.

[0195] Example 11 Accelerated stability comparison test of live bacteria in original bacterial powder and crystal sphere

[0196] The probiotic crystal balls and original bacterial powder prepared in Example 8 and Example 9 were subjected to accelerated stability test. A certain amount of crystal balls or original bacterial powder were weighed and placed in aluminum film bags for airtight storage, and placed in an incubator at 37°C and humidity controlled at 75%. The viable bacterial count was tested on days 0, 5, 17, 26, 34, 41, 47, 55, 61 and 68, respectively. The sampling test was repeated twice at each point, and the log(N t )=Log(N 0 )-t / D T Formula analysis of the stability of live bacteria in original bacterial powder and probiotic crystal balls, where N t Represents the number of viable bacteria on the day, N 0 represents the initial viable bacteria count, t represents the number of testing days, D T Represents the number of days required for the number of viable bacteria to decrease by 1 order of magnitude.

[0197] Figure 8 a represents the accelerated stability test results of the probiotic powder. As can be seen from the figure, the initial live bacteria count of the probiotic powder is 10.33Log CFU / g, and the live bacteria count on the 68th day is 9.64Log CFU / g. T The value is 97.14 days; Figure 8 b represents the accelerated stability test results of the crystal ball in Example 8. It can be seen from the figure that the initial live bacteria count of the crystal ball probiotics is 10.30LogCFU / g, and the live bacteria count on the 68th day is 10.11Log CFU / g. T The value is 295.34 days; Figure 8 c represents the accelerated stability test results of the crystal ball in Example 9. It can be seen from the figure that the initial live bacteria count of the crystal ball probiotics is 10.31Log CFU / g, and the live bacteria count on the 68th day is 10.12Log CFU / g. T The value is 310.68 days. It can be seen that the live bacteria stability of the Jingqiu probiotics in Example 8 and Example 9 is improved by 2.0 and 2.2 times respectively compared with the original bacteria powder.

[0198] Example 12 In vitro gastrointestinal digestion simulation test of probiotic crystal spheres

[0199] 1. Solution Preparation

[0200] 1.1 Artificial gastric juice

[0201] The components and preparation method of artificial gastric juice are the same as those in Example 10;

[0202] 1.2 Intestinal Electrolyte Solution

[0203] Weigh 8.2g NaCl, 4.6g CaCl 2 , 0.3 g KCl, 0.06 g MgCl 2 6H 2 O, 0.11 g urea and 0.2 g CaCl 2 ·2H 2 O, dissolved in 800 ml of deionized water, adjusted the pH to 6.2 with 0.15 M HCl, and finally made up to 1 L.

[0204] 1.3 Artificial colon fluid

[0205] Weigh 5.59 g of dipotassium hydrogen phosphate and 0.41 g of potassium dihydrogen phosphate, dissolve them in 800 ml of deionized water, and finally adjust the volume to 1 L.

[0206] The simulation system constructed in this embodiment is a simplified dynamic simulation system based on TNO. The simulation process completely simulates the entire process of the probiotic crystal sphere gradually entering the stomach, duodenum, jejunum, ileum and colon after oral ingestion. The entire simulation process is carried out in a culture bottle, and different digestion stages are simulated by changing the liquid environment. The simulated digestion conditions are shown in Table 9.

[0207] Table 9: Digestion conditions for in vitro gastrointestinal digestion simulation test

[0208]

[0209] The simulation process starts from the gastric simulation stage. 2 g of probiotic crystal spheres prepared in Example 8 and Example 9 are added to 180-200 mL of simulated gastric fluid. After digestion for a period of time, 180-200 mL of simulated intestinal fluid is added to the small intestine stage. NaHCO 3 The pH of the solution was adjusted by (1M). After digestion of the duodenum, jejunum and ileum, 160-180 mL of the digestive fluid was taken and added to 80-100 mL of artificial colonic fluid to simulate the colon stage. The culture process used a 37°C constant temperature water bath shaker at 60-70 r / min to simulate gastrointestinal peristalsis. At the beginning and end of digestion of the stomach and each intestinal segment, 4 mL of the digestive fluid was taken out for viable bacterial count. The results are shown in Table 10.

[0210] Table 10: Results of in vitro gastrointestinal digestion simulation test of probiotic crystal spheres

[0211]

[0212] It can be seen from Table 10 that in the simulated gastric digestion stage, the number of probiotics dissolved from the probiotic crystal spheres prepared in Examples 8 and 9 of the present invention did not exceed 10 3 The number of probiotics dissolved in the probiotic spheres prepared in Example 8 during jejunal digestion reached 67 million CFU / mL, and the number of probiotics in the digestive fluid increased to 89 million CFU / mL after ileal digestion, indicating that the probiotic spheres prepared in Example 8 dissolved and released probiotics in the jejunum and ileum, while the number of probiotics dissolved in the probiotic spheres prepared in Example 9 was only 1371 CFU / mL, indicating that the probiotic spheres prepared in Example 9 did not dissolve and release probiotics in the simulated small intestinal digestion stage; in the simulated colon digestion stage, the number of probiotics dissolved in the probiotic spheres prepared in Example 9 reached 64 million CFU / mL, indicating that the probiotic spheres prepared in Example 9 can dissolve and release probiotics in the colon. After simulated gastrointestinal digestion in vitro, the survival rates of the probiotic crystal spheres prepared in Examples 8 and 9 of the present invention were both above 90%, indicating that the crystal sphere structure can well protect the probiotics to reach fixed points in the intestine for sustained release and exert probiotic effects.

[0213] In summary, the Lactobacillus plantarum VHProbi SY crystal spheres provided by the present invention can effectively protect the stability of the original bacterial powder. T The value is increased by more than 2 times. At the same time, the crystal sphere can effectively improve the tolerance of the original bacterial powder to artificial gastric juice, and the amount of live bacteria remains stable after digestion with artificial gastric juice. In the in vitro gastrointestinal digestion simulation, the probiotic crystal spheres prepared by the present invention can achieve fixed-point sustained release in the jejunum, ileum and colon, respectively, and the survival rate of live bacteria in the crystal spheres is above 90%, indicating that the crystal sphere structure can well protect the probiotics to smoothly reach the intestinal fixed-point sustained release and exert the probiotic effect.

Claims

1. A probiotic crystal ball with a three-layer embedding structure, characterized in that: The probiotic crystal ball is composed of a core layer, a protective layer and an outer shell layer from the inside to the outside; the mass ratio of the core layer, the protective layer and the outer shell layer is 5:3:2 or 9:6:5; wherein the core layer is added with Lactobacillus plantarum ( Lactiplantibacillus plantarum ) and an edible vegetable oil with a melting point of 15°C-30°C, the deposit number of the plant lactobacillus is CCTCC NO: M20221666; The protective layer comprises edible vegetable oil with a melting point of 30°C-37°C and a sustained-release material, and the mass ratio thereof is 4-9:1; The sustained-release material is a mixture of hydroxypropyl methylcellulose and stearic acid, or a mixture of hydroxypropyl methylcellulose, ethyl cellulose and stearic acid; the mass ratio of hydroxypropyl methylcellulose to stearic acid is 1:1; the mass ratio of hydroxypropyl methylcellulose, ethyl cellulose and stearic acid is 3:2:1; The shell layer contains gelatin, chitosan, gum arabic and water, wherein the mass ratio of gelatin, chitosan, gum arabic and water is 5:3:3:

39.

2. The probiotic crystal ball according to claim 1, characterized in that: The mass ratio of Lactobacillus plantarum to edible vegetable oil in the core layer is 1:9.

Images