Protein gmbr4 for regulating plant architecture and yield and its coding gene and application thereof

By using gene editing technology to regulate soybean plant architecture and yield, and utilizing the GmMBR4 protein and its encoding gene, the problem of unclear soybean plant architecture regulation mechanism was solved, and soybean yield per unit area was improved.

CN118702789BActive Publication Date: 2026-06-26INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410793566.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-19
Publication Date
2026-06-26
Estimated Expiration
2044-06-19

Smart Images

  • Figure SMS_4
    Figure SMS_4
  • Figure HDA0004900802610000011
    Figure HDA0004900802610000011
  • Figure HDA0004900802610000012
    Figure HDA0004900802610000012
Patent Text Reader

Abstract

The application discloses a protein GmMBR4 for regulating plant type and yield, a coding gene thereof and application thereof. The application belongs to the field of plant breeding and particularly relates to the protein GmMBR4 for regulating plant type and yield, the coding gene thereof and application thereof. The protein of the application is any one of the following: A1) a protein with an amino acid sequence shown in SEQ ID No. 2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues on the protein of A1) and having more than 80% identity with the protein shown in A1) and having the same function; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). Experiments prove that the protein GmMBR4 can regulate plant type (especially plant height or / and plant branch number) and yield (pod number per plant or / and grain number per plant), and has important theoretical significance for soybean breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and relates to the protein GmMBR4, which regulates plant architecture and yield, its encoding gene, and its applications. Background Technology

[0002] Soybeans, as an important crop used for both grain and oilseed, play a crucial role in ensuring my country's food security and agricultural trade. With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically. How to rapidly and effectively improve soybean varieties and increase soybean yield through modern bio-breeding technologies is a critical production problem that urgently needs to be solved and a breeding technology bottleneck that urgently needs to be overcome.

[0003] Crop plant architecture plays a decisive role in the morphogenesis of individual plants and crop populations, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and spike type (pod-setting habit). Crop plant architecture domestication or improvement plays a vital role in achieving significant breakthroughs in crop yield. However, current research on the regulatory mechanisms of soybean plant architecture and key genes involved in this regulation is still in the exploratory stage, with few related research reports. The molecular mechanisms, key genes, and functional networks affecting soybean plant architecture regulation remain unclear. In particular, due to limitations in research materials, there is a lack of research on which plant architecture is more conducive to increasing soybean yield under field production conditions. Therefore, further exploration of more plant architecture regulatory genes is not only of significant theoretical value for discovering superior soybean plant architecture regulatory genes and cultivating high-yielding ideal plant architectures; but also, through the creation of specific materials, allows for the systematic evaluation and selection of ideal soybean plant architectures under production conditions, which has significant practical application value for ultimately realizing breeding applications and improving soybean yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate plant shape and / or increase plant yield.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 2;

[0008] A2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that have more than 75% identity with the protein shown in A1) and that regulate plant architecture and yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 2 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 2 by substituting, deleting and / or adding one or more amino acids without affecting their activity.

[0009] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1 above is named GmMBR4.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tag proteins include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmMBR4 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GmMBR4 isolated in this invention, provided they encode and function as protein GmMBR4, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.

[0017] In this document, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the above 90% identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from soybeans ( Glycine max (L.) Merr.).

[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0021] B1) Nucleic acid molecules that encode the proteins described above;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0028] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0029] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0030] C3) contains an expression cassette containing the gene encoding described in C2);

[0031] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0032] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0033] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0034] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0035] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0036] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0037] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 3;

[0038] E2) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 1.

[0039] The DNA molecule shown in SEQ ID No. 3 (which regulates plant architecture and yield traits) GmMBR4 The gene encodes the protein GmMBR4, whose amino acid sequence is SEQ ID No. 2.

[0040] The nucleotide sequence shown in SEQ ID No. 3 is the nucleotide sequence of the gene encoding protein GmMBR4 (CDS).

[0041] The present invention GmMBR4 Genes can be any nucleotide sequence that encodes the protein GmMBR4. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in a specific species as needed.

[0042] B1) The nucleic acid molecule may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 1.

[0043] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with that shown in SEQ ID No. 1 and originate from the same species.

[0044] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0045] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.

[0046] Existing plant expression vectors can be used to construct structures containing... GmMBR4 Recombinant gene expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0047] use GmMBR4When constructing recombinant plant expression vectors, any type of enhancing promoter or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0048] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0049] In one specific embodiment, the recombinant vector is GmMBR4 -sgRNA, the recombinant vector GmMBR4 The structure of -sgRNA is described as follows: The recombinant expression vector is obtained by inserting a linear cas9 / gRNA vector (VK005-15, Beijing Weishang Lide Biotechnology Co., Ltd.) into a DNA molecule with a target sequence of 5'-AATTGGGAAACTTCAGAGTT-3' through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged.

[0050] The microorganisms mentioned in this article may be yeast, bacteria, algae, or fungi. Among them, bacteria may originate from the genus *Escherichia* (…). Escherichia Erwinia ( Erwinia Agrobacterium tumefaciens ( ), Agrobacterium tumefaciens Agrobacterium Flavobacterium ( Flavobacterium Alcaligenes ( ) Alcaligenes ), Pseudomonas ( Pseudomonas ), Bacillus spp. ( Bacillus (e.g., Agrobacterium tumefaciens EHA105).

[0051] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105- GmMBR4 -sgRNA.

[0052] The recombinant Agrobacterium EHA105- GmMBR4 -sgRNA is the recombinant vector. GmMBR4 Recombinant bacteria obtained by introducing sgRNA into Agrobacterium tumefaciens EHA105.

[0053] The present invention also provides a method for regulating plant architecture and increasing yield, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate plant architecture and increase yield.

[0054] In the above method, regulating the activity and / or content of the protein GmMBR4 in the target plant, and / or the expression level of the gene encoding the protein, includes introducing into the recipient plant an inhibitor, a reduction, or a silencer of the gene encoding the protein. GmMBR4 The desired plant species were obtained, exhibiting altered plant structure and increased yield. GmMBR4 The gene encodes the protein GmMBR4.

[0055] The importation refers to the use of recombination methods, including but not limited to Agrobacterium (…). Agrobacterium Introduced methods include mediated transformation, bio-projectile methods, electroporation, in-planta techniques, and more.

[0056] The present invention also provides the use of the protein GmMBR4 described above, or an expression substance regulating the gene, or a substance regulating the activity or content of said protein, in any of the following:

[0057] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating plant architecture and yield.

[0058] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant architecture and yield;

[0059] The application of the protein or gene expression substance or substance regulating the activity or content of the protein described in U3) in cultivating plants with altered plant structure and increased yield.

[0060] The application of the protein or gene expression substance or substance regulating the activity or content of the protein described in U4) in the preparation of products that cultivate plants with altered plant type and increased yield.

[0061] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5 in plant breeding.

[0062] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmMBR4.

[0063] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein can be a biological material related to the protein, and the biological material can be the biological material described above.

[0064] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0065] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0066] In this article, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0067] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0068] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene).

[0069] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm).

[0070] 4) Regulation of the translation of the aforementioned genes;

[0071] 5) Regulation of mRNA degradation of the aforementioned gene;

[0072] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0073] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0074] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0075] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0076] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0077] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0078] The present invention also provides a method for cultivating plants with altered plant structure and increased yield, comprising: 1) inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the coding gene of the protein described above, to obtain plants with altered plant structure and increased yield.

[0079] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and reduced yield.

[0080] In one specific embodiment, a method for cultivating plants with altered plant type and increased yield includes the following steps: inhibiting the expression of nucleic acid molecules encoding GmMBR4 protein in the target plant to obtain transgenic plants with altered plant type and increased yield. Specifically, the inhibition of nucleic acid molecule expression encoding GmMBR4 protein in the target plant can be achieved by introducing a knockout vector targeting the nucleic acid molecule encoding GmMBR4 protein into the target plant.

[0081] The knockout vector may be a gene editing vector.

[0082] As one embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield includes the following steps:

[0083] (1) Construct a system containing the inhibitor shown in SEQ ID No. 4 GmMBR4 Gene editing vectors for gene expression;

[0084] (2) Introduce the gene editing vector constructed in step (1) into plants;

[0085] (3) Plants with altered plant type and increased yield obtained through screening and identification.

[0086] Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets a nucleic acid molecule encoding the GmMBR4 protein. Specifically, the target of the sgRNA is: 5'-AATTGGGAAACTTCAGAGTT-3'.

[0087] In the above method, the target site for gene editing by the CRISPR / Cas9 system is positions 1799-1818 of SEQ ID No. 1, which corresponds to positions 258-277 of SEQ ID No. 3 (coding sequence CDS).

[0088] In the above method, the CRISPR / Cas9 system gene editing can be performed by making the following mutation on the gene encoding the protein GmMBR4 in the soybean genome: deleting the nucleotide "G" at position 1816 of SEQ ID No. 1 (corresponding to position 275 of SEQ ID No. 3 (coding sequence CDS)); thereby knocking out the gene encoding the GmMBR4 protein.

[0089] In this invention, the purpose of plant breeding includes cultivating plants with altered plant type and / or increased / decreased yield.

[0090] In this article, plant type traits may include plant height, number of pods per plant, number of grains per plant, number of nodes and / or number of branches.

[0091] In the above applications or methods, the plant is any one of the following:

[0092] N1) Dicotyledons:

[0093] N2) Leguminosae;

[0094] N3) Leguminosae (family legumes);

[0095] N4) Soybean genus plants;

[0096] N5) soybeans. Attached Figure Description

[0097] Figure 1 for GmMBR4 Sequencing results of mutation types in mutants.

[0098] Figure 2 for GmMBR4 Phenotypes of mutant and wild-type soybeans. Detailed Implementation

[0099] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0100] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0101] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0102] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium -mediated transformation efficiency by adding glutamineand asparagine into the culture media. International Journal of Molecular Sciences 19,3039, The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of the present invention and may not be used for any other purpose.

[0103] The Agrobacterium tumefaciens EHA105 in the following examples has been described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis ofGmFT2a This delays flowering time in soya bean. Plant Biotechnol J16, 176-185. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and may not be used for any other purpose.

[0104] The cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15.

[0105] MS Salt: PhytoTech, Catalog No.: M524.

[0106] MS Organic: PhytoTech, Catalog No.: M533.

[0107] B5 Organic: Phytotech, catalog number: G219.

[0108] B5 Salt: Phytotech, Catalog No.: G768.

[0109] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was considered satisfactory. () indicates a significant difference, P < 0.01. () indicates a highly significant difference.

[0110] Example 1: Obtaining the GmMBR4 mutant line

[0111] 1. Obtaining the GmMBR4 protein and its encoding gene

[0112] The genome sequence of soybean GmMBR4 was obtained from the Phytozome database. GmMBR4 Located on chromosome 17, it encodes the protein GmMBR4. This protein is found in the genomic DNA of the soybean variety Jack. GmMBR4 The genome sequence is SEQ ID No. 1. GmMBR4 The gene encodes the protein GmMBR4, whose amino acid sequence is SEQ ID No. 3 and whose amino acid sequence is SEQ ID No. 2.

[0113] 2. GmMBR4 Obtaining gene-edited plants

[0114] 1) Obtaining sgRNA

[0115] Using the CRISPR-P online web tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) GmMBR4 Selection of sgRNA target site sequences. The target site is located at... GmMBR4 The target sequence for the third exon region is 5'-AATTGGGAAACTTCAGAGTT-3' (positions 1799-1818 of SEQ ID No. 1, corresponding to positions 258-277 of SEQ ID No. 3 (coding sequence)).

[0116] After the target is designed, it needs to be integrated into the vector. First, synthesize the target primers for the sgRNA (the underlined sequence is a 20bp sgRNA). The primer sequence information is as follows:

[0117] GmMBR4 -F:5'-TTGAATTGGGAAACTTCAGAGTT -3';

[0118] GmMBR4 -R:5'- AACAACTCTGAAGTTTCCCAATT -3';

[0119] Add each to a 25 μL system GmMBR4 -F and GmMBR4 5 μL of -R primer, 15 μL of water, 95℃ for 3 min, anneal to 16℃ at 0.1℃ / s, hold at 16℃ for 10 min to complete annealing, and obtain gRNA annealed product with sticky ends.

[0120] 2) GmMBR4 Gene editing expression vector GmMBR4 Preparation of -sgRNA

[0121] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 1 above and perform T4 ligation with the cas9 / gRNA vector (which contains the Cas9 protein expression unit) to obtain the recombinant vector Cas9-sgRNA. This vector can express the above sgRNA. The target sequence of the sgRNA is positions 1799-1818 of SEQ ID No. 1, which corresponds to positions 258-277 of SEQ ID No. 3 (coding sequence).

[0122] 3) Preparation of recombinant bacteria

[0123] The recombinant vector Cas9-sgRNA prepared in step 2 was transformed into E. coli DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sent for sequencing.

[0124] Sequencing primer SQ: 5'- GATGAAGTGGACGGAAGGAAGGAG-3', plasmid with the correctly inserted fragment is named the recombinant vector. GmMBR4 -sgRNA.

[0125] Recombinant vector GmMBR4 The structure of -sgRNA is described as follows: A recombinant expression vector is obtained by inserting a DNA molecule with the target sequence 5'-AATTGGGAAACTTCAGAGTT-3' into a linear cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged.

[0126] Recombinant vector GmMBR4 The Cas9-sgRNA contains an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 are the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 are the terminator for terminating sgRNA gene transcription. The Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, and can express the Cas9 protein.

[0127] 4) GmMBR4 Acquisition and phenotypic identification of mutants

[0128] The recombinant vector was transferred using electroporation. GmMBR4 Agrobacterium tumefaciens EHA105 was transformed with sgRNA, and plasmids were extracted for sequencing verification. The recombinant strain that was correctly sequenced was named EHA- GmMBR4 -sgRNA.

[0129] 5) Agrobacterium EHA- GmMBR4 -sgRNA-mediated transformation

[0130] The culture medium preparation method used in this step is as follows:

[0131] YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are as follows: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, 15 g / L agar; the solvent is water. The pH of YEP solid medium is 7.0.

[0132] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, balance water.

[0133] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0134] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0135] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0136] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0137] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0138] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0139] The EHA- constructed in step 4) was used in the Agrobacterium-mediated method. GmMBR4 -sgRNA was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using the following method:

[0140] A. Seed sterilization

[0141] (1) Take Jack soybean seeds that are free from disease, pests, and spots, plump, uniform, and dry, spread them completely in a petri dish, and then put the petri dish into a desiccator.

[0142] (2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.

[0143] B. Preparation of infecting bacterial solution

[0144] (1) Cultivate the EHA obtained in step 4) at 28℃. GmMBR4 -sgRNA bacterial suspension, resuspended in liquid culture medium, yielded OD 600nm =0.6% of the infecting bacterial solution.

[0145] (2) Place the seeds treated in step A into a clean bench, peel off the seed coat under a microscope, separate the two cotyledons along the long axis, keep the cotyledon with the complete hypocotyl, make a scratch at the junction of the hypocotyl and cotyledon, generally make 3-5 scratches on one cotyledon, and then soak in a 28 ℃ incubator for 2 h.

[0146] (3) Place the cotyledons with the inner surface (smooth surface) facing up on the co-culture medium that has been covered with sterile filter paper, and incubate in the dark at 22℃ for 5 days.

[0147] (4) After co-culturing for 5 days, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were placed in recovery medium and cultured for 7 days at 28 ℃ under 16 h light / 8 h dark conditions.

[0148] (5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, retain 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them for 21 days at 28 ℃ under 16 h light / 8 h dark conditions.

[0149] (6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28 ℃ under 16 h light / 8 h dark conditions.

[0150] (7) In the elongation medium, when the clustered buds produce 5-8 cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1 mg / L IBA solution for 1 min, and then transfer it to the rooting medium for culture. Culture for one week at 28 ℃ under 16 h light / 8 h dark conditions. After a large number of roots are produced at the base of the stem, transplant it into a pot. The resulting plant is a T0 generation transformed soybean.

[0151] 6) Molecular detection of edited plants

[0152] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 5) and used as a template for PCR molecular detection, with wild-type soybean as a control.

[0153] exist GmMBR4 PCR primers were designed near the gene target site for PCR amplification and sequencing. Among these, the primers... GmMBR4 -F: 5'-TCTTCTACTGATGTTTGTTTTC-3' and GmMBR4 -R: 5'- GTGTTATGAGGAGGAGAAATG-3' amplification GmMBR4 Gene.

[0154] PCR reaction system: 12.5 μL 2× Phanta Max Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL F (10 pmol / μL), 1 μL R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.

[0155] The plants exhibiting overlapping peaks near the target site were heterozygous edited plants, named the T0 generation. GmMBR4 Gene-edited soybeans.

[0156] T0 generation GmMBR4 Gene-edited soybeans are harvested after planting the T1 generation. GmMBR4 Genetically edited soybean seeds were cultivated to obtain the T1 generation. GmMBR4 Gene-edited soybeans.

[0157] T1 generation was detected using PCR detection method. GmMBR4 Gene-edited soybeans, sequencing results of amplified products showed that in the T1 generation... GmMBR4In gene-edited soybeans, compared to the genomic DNA of the soybean variety Jack (wild type), GmMBR4 In both homologous chromosomes of the homozygous mutant, the gene encoding the GmMBR4 protein underwent the following mutation: a frameshift mutation was performed at position 1816 of SEQ ID No. 1 (corresponding to position 275 of SEQ ID No. 3 (coding sequence CDS)) that removed the nucleotide "G", thus knocking out the gene encoding the GmMBR4 protein. Sequencing results of this mutation site and its surrounding nucleotides are shown in [link to sequencing data]. Figure 1 .

[0158] The above have GmMBR4 T1 generation with gene mutation GmMBR4 Gene-edited soybean mutant plants gmmbr4 Continued breeding and screening yielded T2 generation homozygous soybean mutants that do not contain transgenic elements. gmmbr4 And perform phenotypic identification.

[0159] Example 2 GmMBR4 Phenotypic identification of gene-edited soybean mutants

[0160] Planted under natural light conditions in a greenhouse during the summer in Beijing, with the following planting conditions: plant spacing 10cm and row spacing 50cm.

[0161] The wild-type soybean variety Jack (referred to as wild-type) was analyzed separately. gmmbr4 Plant morphological traits of homozygous mutants (plant height, number of nodes, number of branches, number of pods per plant, number of seeds per plant). At least 6 individual plant data should be collected for each material.

[0162] The results (Table 1) show that, in terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant. gmmbr4 The homozygous mutant had 166.5 pods per plant and 420.3 seeds per plant. gmmbr4 The number of pods and seeds per plant was significantly increased in homozygous mutants compared to wild-type.

[0163] In terms of plant type, compared with the control plant which was 148.3 cm tall, gmmbr4 The average plant height of the homozygous mutant was 127.5 cm. gmmbr4 The plant height of the homozygous mutant was significantly lower than that of the control; in terms of branching phenotype, the control plant had 1.5 branches. gmmbr4 The homozygous mutant plant had 3.4 branches, a significant increase compared to the control; in terms of the number of nodes, the control plant had 25.0 nodes. gmmbr4 The homozygous mutant plants had an average of 24.8 nodes. gmmbr4 The number of nodes in homozygous mutant plants did not change significantly compared to the control.

[0164] Table 1. Statistics on soybean plant type data

[0165]

[0166] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for regulating soybean plant height, number of branches, number of pods per plant, and number of grains per plant, characterized in that, This includes reducing the protein content in the target plant to decrease soybean plant height and increase the number of branches, pods per plant, and grains per plant; the amino acid sequence of the protein is shown in SEQ ID No.

2.

2. The method according to claim 1, characterized in that, The reduction of protein content in the target plant includes introducing a substance into the recipient plant that inhibits the gene encoding the protein; the gene encoding the protein of claim 1.

3. The method according to claim 2, characterized in that, The substance is any one of the following: C1) A nucleic acid molecule that inhibits the expression of the gene encoding the protein described in claim 1 or 2; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette encoding the gene described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).

4. The application of substances that reduce protein content in any of the following: U1) Application in reducing plant height and increasing the number of branches, pods per plant, and grains per plant; U2) is used in the preparation of products that reduce plant height and increase the number of branches, pods per plant, and grains per plant; U3) Application in cultivating plants with reduced plant height and increased number of branches, number of pods per plant and number of grains per plant; U4) Application in the preparation of products from plants with reduced plant height, increased number of branches, increased number of pods per plant, and increased number of seeds per plant; Application of U5 in plant breeding; The purpose of the breeding is to cultivate plant varieties with reduced plant height and increased number of branches, number of pods per plant, and number of seeds per plant; The amino acid sequence of the protein is shown in SEQ ID No. 2; The plant in question is soybean.

5. The application according to claim 4, characterized in that, The substance is a biomaterial related to the protein, and the biomaterial is the substance described in claim 3.

6. A method for breeding plants with reduced plant height and increased number of branches, pods per plant, and grains per plant, comprising reducing the content of the gene encoding the protein described in claim 1 to obtain a plant with reduced plant height and increased number of branches, pods per plant, and grains per plant; wherein the plant is soybean.