Application of AtGRF gene in improving the genetic transformation efficiency of pumpkin

Abstract

This invention discloses the application of the AtGRF gene in improving the genetic transformation efficiency of pumpkin, belonging to the fields of genetic engineering and genetic breeding technology. Overexpression vectors containing AtGRF1, AtGRF2, AtGRF3, AtGRF4, AtGRF5, AtGRF6, AtGRF7, AtGRF8, and AtGRF9 were constructed and genetic transformation experiments were conducted. It was found that the AtGRF1 overexpression vector improved the genetic transformation efficiency of pumpkin but could not be stably inherited. Further, by using the inducible promoter ZmGlbpro to regulate the AtGRF1 gene, stably inherited offspring were obtained. This invention is of great significance for pumpkin gene function research and molecular breeding, and for accelerating the process of breeding new pumpkin varieties.

Description

Technical Field

[0001] This invention relates to the application of an AtGRF family gene in improving the genetic transformation efficiency of pumpkin, and belongs to the fields of genetic engineering and genetic breeding technology. Background Technology

[0002] Pumpkin (Cucurbita moschata) is an annual vine-like herbaceous plant belonging to the Cucurbitaceae family and the Cucurbita genus. China ranks first in the world in both pumpkin planting area and output, with a total annual output exceeding 20 million tons. Pumpkin has low cultivation costs and strong plant resistance, and is often used as rootstock for other cucurbit vegetables to improve the resistance, yield, and fruit quality of grafted seedlings. Therefore, it has a large market demand and is an important agricultural product.

[0003] Currently, pumpkin breeding primarily relies on traditional methods, with transgenic breeding and marker-assisted breeding still in their early stages. The main limitation of transgenic pumpkin breeding lies in the lack of an efficient and stable genetic transformation system. Although Xin et al. (2022) achieved stable transformation of pumpkin using Agrobacterium-mediated transformation, obtaining transformed plants with a transformation efficiency of 3.56%, this method requires meticulous attention to detail and exhibits poor stability. The publication of the pumpkin reference genome and the ongoing research into regeneration-promoting genes offer possibilities for improving the efficiency of pumpkin genetic transformation.

[0004] I. Advances in Pumpkin Genetic Transformation and Gene Editing Research

[0005] Plant genetic transformation (transgenic technology) refers to a series of techniques that involve the in vitro recombination of exogenous genes (target genes) and their integration into the genome through transformation systems or tissue culture, enabling plants to acquire new traits that can be stably inherited. Genetic transformation is an important means of improving plant traits, offering unparalleled advantages over traditional hybridization methods, such as effectively overcoming species boundaries, precise targeting of improved traits, and shorter breeding processes. The main methods of plant genetic transformation include pollen tube pathways, Agrobacterium-mediated transformation, and gene gun methods. Currently, Agrobacterium-mediated transformation is the most widely reported method, applicable to almost all dicotyledonous plants and some monocotyledonous plants, thus becoming the mainstream method in plant genetic transformation. However, the efficiency of this method is affected by many factors, such as the selection of pumpkin genotype and explants, the selection of Agrobacterium strains, the selection of screening agents, infection methods, sterilization methods, and the use of growth regulators. Furthermore, current genetic transformation technologies for pumpkin crops generally suffer from low transformation efficiency, poor reproducibility, false positives, and chimera interference. Although some studies have proposed methods for optimizing the genetic transformation of pumpkin, these reports only partially optimize the details of the technology system, and the improvement in genetic transformation efficiency is limited. With the rapid development of molecular biology, there is an urgent need to establish an efficient and stable genetic transformation system for the genetic improvement and gene function verification of pumpkin crops.

[0006] II. Research Progress on Growth Regulatory Factors in Plant Genetic Transformation

[0007] Growth-regulating factor (GRF) genes encode a class of transcription factors that play a crucial regulatory role in plant growth and development. The GRF gene family has multiple members, and the number of family members varies in different crops. The Arabidopsis AtGRF gene family includes nine members (AtGRF1 to AtGRF9). The QLQ domains of AtGRF proteins all possess a conserved Gln-Leu-Gln residue, with the sole exception of AtGRF9, which replaces Leu with Phe. The WRC domains of all AtGRF proteins contain two distinct structural features: a conserved C3H motif consisting of multiple basic amino acids (Arg and Lys) and three Cys and one His residue. In terms of gene expression sites, AtGRF1–AtGRF6 genes are strongly expressed in roots, stems, shoot apex meristems (SAM), flower buds, and mature flowers, but their expression is lower in mature stems and leaves. AtGRF7 and AtGRF8 are mainly expressed in shoot apex and flowers. AtGRF9 requires a longer time to be expressed in shoot apical meristems and flower buds. Previous studies have reported that alterations in the expression of AtGRF1, AtGRF2, and AtGRF3 genes produce pleiotropic phenotypes, affecting leaf and cotyledon growth and development, bolting and flowering time, and male fertility (Kim JH et al 2010). Overexpression of AtGRF5, AtGRF6, and AtGRF9 has a positive effect on the proliferation of transgenic callus cells in rapeseed (Kong et al 2020), while overexpression of AtGRF9 significantly enhances root surface area, root volume, and root diameter in tomatoes.

[0008] Recent studies in wheat, maize, and sorghum (Jonesetal 2019; Debernardietal 2020; Panetal 2022; Chenetal 2022) have found that overexpression of the GRF5 gene significantly promotes callus regeneration, thereby improving the genetic transformation efficiency of crops. Therefore, GRF, along with other genes that promote regeneration (such as GIF, WUS, BBM, and PLT), are collectively referred to as regeneration-promoting genes. Utilizing these regeneration-promoting genes can not only significantly improve genetic transformation efficiency but also expand the selection range of transformation recipients, reducing the dependence of genetic transformation on genotype. Consequently, an increasing number of researchers are focusing on using regeneration-promoting genes to improve the regeneration and genetic transformation efficiency of difficult-to-transform plants. In cucurbitaceous crops, overexpression of the AtGRF5 gene has also been found to improve the genetic transformation efficiency of watermelon (Pan W et al 2022), melon (Wan L et al 2023), and bitter melon (Liu Zhiyang et al 2023). However, these studies have not focused on the significant negative impacts that sustained overexpression of AtGRF5 may have on the fertility of transgenic plants and the stable heritability of transgenic fragments. These two aspects are crucial to the practical application value of AtGRF5 in optimizing genetic transformation systems. Furthermore, research on the roles of other members of this family in improving genetic transformation efficiency, besides the AtGRF5 gene, is relatively scarce.

[0009] In addition, the UBI promoter and CaMV35S (Fang et al., 2015) are currently the most commonly used constitutive promoters. Their gene expression-driving characteristic is that they exhibit very high activity in almost all plant tissues and at different growth stages. However, long-term constitutive overexpression of genes can lead to abnormal plant growth and development. Numerous studies have reported that using constitutive promoters to drive ectopic expression of regeneration-promoting genes may lead to abnormal growth and development or multiple effects in transgenic plants (Loweetal 2016; Chenetal 2022; Panetal 2022). To address the drawbacks of ectopic or overexpression of constitutive promoters, various strategies have been developed to overcome these problems, including specific expression, removal of regeneration-promoting genes, and induced or conditional expression. For example, in maize, using the tissue-specific ZmPLTP promoter to express BBM and the auxin-induced ZmAxig1 promoter to express WUS2 successfully regenerated healthy, fertile transgenic plants (Loweetal 2018).

[0010] In summary, Cucurbita crops urgently require a genetic transformation system with high regeneration efficiency and stable inheritance, and regeneration-promoting genes hold great potential in this area. Currently, research on regeneration-promoting gene systems in Cucurbitaceae crops is extremely limited. Therefore, this invention utilizes the AtGRF family of regeneration-promoting genes to establish a highly efficient and stable genetic transformation system for Cucurbita, providing technical support for the genetic transformation and molecular breeding of other Cucurbitaceae crops. Summary of the Invention

[0011] The purpose of this invention is to improve the genetic transformation efficiency of pumpkin by using regeneration-promoting genes through genetic engineering technology, and to achieve stable inheritance by regulating the growth and development of regeneration-promoting genes through inducible promoters, thereby providing a more efficient genetic transformation system for pumpkin.

[0012] To achieve the above objectives, this invention systematically investigated the role of AtGRF genes in promoting the efficiency of pumpkin genetic transformation. The AtGRF family comprises nine members: AtGRF1, AtGRF2, AtGRF3, AtGRF4, AtGRF5, AtGRF6, AtGRF7, AtGRF8, and AtGRF9. Overexpression vectors were constructed using their respective CDS sequences. All AtGRF genes are driven by the constitutive promoter pAtUBI10, and these vectors utilize the Basta herbicide resistance gene. All vector plasmids contain DsRed as a visual reporter gene. DsRed fluorescence was observed in the regenerated shoots using a handheld fluorescent lamp to track positive transformation events.

[0013] Further genetic transformation experiments were conducted using pumpkin cotyledons as explants. The results showed that transformation of the empty vector control (containing the regeneration-promoting gene) resulted in a transformation efficiency of only 0.67%, with most of the regenerated shoots being transgenic negative. However, transformation of vectors overexpressing the AtGRF family genes yielded regenerated seedlings expressing DsRed fluorescence. Overexpression of AtGRF1 showed the most significant improvement in transformation efficiency, reaching 16.72%.

[0014] Subsequently, we further observed the DsRed fluorescence of leaves, male and female flowers, and fruits of transgenic plants overexpressing AtGRF1. The results showed that the leaves of transgenic plants containing the AtGRF1 gene were of normal size and shape and carried red fluorescence throughout their growth and development. However, overexpression of AtGRF1 led to the phenotype of male flower diapause, characterized by shriveling and wrinkling before male flowers opened, and some male flowers falling off prematurely. Nevertheless, some male flowers still opened normally. Female flowers developed normally, and the fruits enlarged normally after self-pollination. DsRed fluorescence observation of the obtained fruit materials showed that all fruits from transgenic plants exhibited DsRed fluorescence, while no DsRed fluorescence was observed in wild-type fruits.

[0015] Subsequently, mature fruits were copied, and it was found that the seeds overexpressing AtGRF1 were plump and similar in shape and size to wild-type pumpkin seeds. DsRed fluorescence was observed in the seeds using a handheld fluorescent protein lamp; no DsRed fluorescence was observed in the wild-type pumpkin seeds. In contrast, DsRed fluorescence was observed in the seed coat of the AtGRF1 overexpressing seeds. However, upon peeling off the seed coat, the embryo did not express DsRed fluorescence, and the T1 generation seedlings after germination also showed no fluorescence. This result indicates that the transgenic fragment containing DsRed in the T0 transgenic plants was not inherited by the next generation.

[0016] In summary, constitutive overexpression of AtGRF1 (pAtUBI10:AtGRF1) increased the genetic transformation efficiency of pumpkin to 16.72% and yielded T0 generation positive transformants. However, AtGRF1 overexpression led to partial male flower abortion. Although a small number of seeds could still be obtained after self-pollination, the transgenic fragment could not be stably inherited by offspring. We speculate that this may be due to the abortion of gametophytes or embryos caused by continuous and overexpression of AtGRF1, resulting in the transgenic fragment's inability to be passed on.

[0017] To address the issue of unstable transgenic passage caused by continuous overexpression of AtGRF1, using an inducible promoter to drive AtGRF1 expression, and only adding an inducer during tissue culture while ceasing induction during the transgenic plant growth stage, could potentially effectively prevent the transgenic fragments from failing to pass on due to teratogenicity. Since the pumpkin genetic transformation system requires the addition of the plant hormone ABA to the culture medium during the tissue culture stage, this invention introduces the ABA-inducible promoter ZmGlbpro (Hoerster et al. 2020) to drive AtGRF1 expression, constructing the pBZmGlbpro:AtGRF1 vector. The ZmGlbpro promoter is the promoter of the maize ZmGlb gene, whose gene number in the NCBI genome database is MN380778.1.

[0018] The pBZmGlbpro:AtGRF1 vector was genetically transformed into pumpkin. The DsRed fluorescence of the resulting regenerated shoots was observed using a handheld fluorescent lamp. It was found that regenerated shoots expressing DsRed fluorescence could be obtained, and the genetic transformation efficiency was 4.49%.

[0019] We further observed the DsRed fluorescence of leaves, flowers, and fruits of transgenic plants overexpressing ZmGlbpro:AtGRF1. The results showed that the leaves of the ZmGlbpro:AtGRF1-transgenic plants developed normally in size and shape. Simultaneously, their male and female flowers developed normally, and the fruits exhibited enlargement after self-pollination. Subsequently, DsRed fluorescence was observed on the obtained self-pollinated fruit materials using a handheld fluorescent protein lamp. DsRed fluorescence was observed in all fruits of the transgenic plants, while no DsRed fluorescence was observed in the wild-type control fruits.

[0020] Subsequently, mature fruits from ZmGlbpro:AtGRF1 transgenic plants were copied, and seeds containing ZmGlbpro:AtGRF1 were found to be plump and morphologically similar to wild-type pumpkin seeds in shape and size. DsRed fluorescence was observed in T1 generation seeds using a handheld fluorescent protein lamp. While no DsRed fluorescence was observed in wild-type control pumpkin seeds, DsRed fluorescence was observed in the seed coat of ZmGlbpro:AtGRF1 seeds, and fluorescence was also observed in the embryo. T1 generation seedlings also expressed red fluorescence after germination. This indicates that using the ABA-inducible promoter ZmGlbpro to drive AtGRF1 can overcome the fertility defects caused by constitutive overexpression of AtGRF1, thus solving the problem of transgenic fragments being unable to be passaged.

[0021] Therefore, this invention screened the AtGRF gene AtGRF1, which improves the genetic transformation efficiency of pumpkin, and successfully obtained transgenic plants that can be stably inherited by regulating the expression of this gene through the inducible promoter ZmGlbpro. This provides a more efficient gene editing tool for pumpkin gene function research and molecular breeding, and is of great significance for accelerating the breeding process of new pumpkin varieties. Attached Figure Description

[0022] Figure 1 pBAtGRF1 plasmid map.

[0023] Figure 2 Bright-field and DsRed fluorescence images of regenerated shoots transformed with blank vector and AtGRF1-9 vector.

[0024] Figure 3 Bright-field and DsRed fluorescence images of leaves (A), male flowers (B), and fruits (C) of wild-type and AtGRF1 vector-transformed plants.

[0025] Figure 4 Bright-field and DsRed fluorescence images of pumpkin seeds (A), embryos (B), and T1 generation plants (C) transformed with wild-type and AtGRF1 vectors.

[0026] Figure 5 Plasmid map of ZmGlbpro:AtGRF1.

[0027] Figure 6 Bright-field and DsRed fluorescence images of T1 generation pumpkin plants transformed with wild-type and ZmGlbpro:AtGRF1 vector. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to specific embodiments.

[0029] The genetic transformation of pumpkin using cotyledonary nodes as explants suffers from problems such as weak regeneration capacity, high false positives, chimerism, and difficulty in selection, resulting in extremely low genetic transformation efficiency. The original genetic transformation efficiency of pumpkin is approximately 1‰, making efficient pumpkin genetic transformation technology a global challenge. The use of the growth regulator AtGRF5 has already improved genetic transformation efficiency in watermelon, cantaloupe, and bitter melon, yielding transgenic plants. This leads us to wonder if this gene family could be used to effectively improve the genetic transformation efficiency of pumpkin.

[0030] This invention investigated the application effects of nine genes from the AtGRF family (AtGRF1, AtGRF2, AtGRF3, AtGRF4, AtGRF5, AtGRF6, AtGRF7, AtGRF8, and AtGRF9) in a pumpkin genetic transformation system. Genetic transformation of pumpkin was carried out using overexpression vectors of these genes, driven by the constitutive promoter pAtUBI10. The results showed that all overexpression vectors containing AtGRF genes yielded transgenic plants, with AtGRF1 showing the most significant improvement in transformation efficiency. Compared to the transformation efficiency of only 0.67% with an empty vector, overexpression of AtGRF1 increased the transformation efficiency to 16.72%, an increase of approximately 25 times. Compared to the AtGRF5 gene, which is more widely used in other crops (with a genetic transformation efficiency of 10.67%), the genetic transformation efficiency of overexpressing AtGRF1 is also about 56.7% higher.

[0031] Simultaneously, the phenotypes of AtGRF1-transformed plants at various growth stages were tracked and investigated, including plant height, leaf area, female flowers, male flowers, and seeds. Observations revealed that the transgenic plants exhibited normal plant height, leaf size, and female flower morphology, but male flower development was slow. DsRed fluorescence was observed in the seed coats of self-pollinated seeds, but no fluorescence was observed in the embryos or T1 generation seedlings. These results indicate that constitutive overexpression of AtGRF1 transgenic fragments cannot be stably inherited into the next generation.

[0032] Currently, constitutive strong promoters, such as the CaMV35S promoter and the maize Ubiquitin-1 promoter, are widely used in agricultural biotechnology. However, when using these promoters to induce the transformation of target genes in crops such as rice to improve quality, the improvement effect is often not obvious because the time (developmental stage specificity) or space (tissue and organ specificity) of target gene expression cannot be well controlled, or because the gene expression level induced by these constitutive promoters is too high, affecting plant growth and development. These are obstacles encountered when using constitutive strong promoters combined with functional genes to improve crop quality. In view of this, this invention uses the ABA-inducible promoter ZmGlbpro to drive AtGRF1 expression. The results show that using the inducible promoter ZmGlbpro to drive AtGRF1 for pumpkin genetic transformation can obtain healthy transgenic plants with a genetic transformation efficiency of 4.49%. At the same time, the phenotype of the T0 generation of ZmGlbpro:AtGRF1 transgenic plants at various growth stages was tracked, including plant height, leaf area, and the development of female and male flowers. No significant growth and development abnormalities were found. Further investigation into the propagation of the transgenic fragment revealed that the fluorescent reporter gene can be stably inherited from the T0 generation to the next generation.

[0033] Example 1: AtGRF gene genetic transformation experiment

[0034] 1. Construction of AtGRF family overexpression vectors

[0035] The AtGRF family consists of nine genes, whose sequence numbers are as follows:

[0036] AtGRF1: AT2G22840.1

[0037] AtGRF2: AT4G37740.1

[0038] AtGRF3: AT2G36400.1

[0039] AtGRF4: AT3G52910.1

[0040] AtGRF5: AT3G13960.1

[0041] AtGRF6: AT2G06200.1

[0042] AtGRF7: AT5G53660.1

[0043] AtGRF8: AT4G24150.1

[0044] AtGRF9: AT2G45480.1

[0045] The vector construction was undertaken by Genewiz Biotechnology Co., Ltd. First, a sequence tandemly consisting of the pAtUBI10 promoter, the AtGRF5 gene CDS, and the hspT terminator was synthesized. Our laboratory vector pBSE403DsR was digested with HindIII, and the vector backbone was recovered. The gene sequence pAtUBI10:AtGRF5-hspT was cloned into the digested vector to construct the vector pBAtGRF5.

[0046] Subsequently, Genewiz Biotechnology Co., Ltd. synthesized the gene sequences of AtGRF1, AtGRF2, AtGRF3, AtGRF4, AtGRF6, AtGRF7, AtGRF8, and AtGRF9. Then, the vector pBAtGRF5 was digested with BsrGI and BamHI enzymes, and the AtGRF1, AtGRF2, AtGRF3, AtGRF4, AtGRF6, AtGRF7, AtGRF8, and AtGRF9 genes were cloned into the digested vector pBAtGRF5 using 5' BsrGI and 3' BamHI to replace the AtGRF5 gene, thus constructing overexpression vectors pBAtGRF1, pBAtGRF2, pBAtGRF3, pBAtGRF4, pBAtGRF6, pBAtGRF7, pBAtGRF8, and pBAtGRF9. All vector plasmids contain the DsRed reporter gene and the Basta herbicide resistance gene for subsequent transformation experiments, used for tagging and screening. The specific steps are as follows:

[0047] Vector digestion: The pBAtGRF5 vector was first double-digested with BsrGI and BamHI enzymes, incubated overnight at 37°C, and then inactivated at 80°C for 10 minutes. The digestion reaction system is shown in Table 1.

[0048] Table 1. BsrGI and BamHI double enzyme digestion reaction system

[0049]

[0050] Target gene cloning and recovery: Cloning primers were designed using Geneious software (see Table 1), synthesized by Beijing Qingke Biotechnology Co., Ltd., and high-fidelity PCR was performed using 2×Phanta Flash Master Mix (Dye Plus) to amplify the CDS of the target gene. PCR primers, amplification reaction system, and procedures are shown in Tables 2, 3, and 4.

[0051] Table 2 pBAtGRF1-9 forward and reverse primers

[0052]

[0053]

[0054] Table 3 High-fidelity PCR reaction system for the target gene

[0055]

[0056] Table 4 PCR amplification program

[0057]

[0058] After the PCR reaction was completed, 5 μL of the product was subjected to 1% agarose gel electrophoresis. After electrophoresis, the band size was observed on a gel electrophoresis apparatus to check if it matched the size of the target fragment. The expected band was excised and then the gel was extracted using an AxyPrep gel extraction kit.

[0059] Ligation: Then, the gel-recovered products of the target fragment AtGRF1-9 (except AtGRF5) and the vector fragment recovered after double digestion of pBAtGRF5 were ligated using the ClonExpress II One Step Cloning Kit. After preparing the homologous recombination ligation reaction system, it was reacted in a PCR instrument at 37℃ for 30 min. The reaction system is shown in Table 5.

[0060] Table 5 Homologous recombination linkage system

[0061]

[0062]

[0063] Transformation of Escherichia coli: The ligation product was transformed into Escherichia coli DH5α by heat shock. The specific steps are as follows: Take out Escherichia coli DH5α competent cells from the -80℃ freezer, add 10 μL of ligation product to 100 μL of Escherichia coli competent cells, first freeze for 5 min, then react in a 42℃ water bath for 45 s, then freeze for 5 min, then add 700 μL of antibiotic-free LB liquid medium in a clean bench, place in a 37℃ shaker, shake at 200 r / min for 30 min, then take 100 μL and spread evenly on LB solid medium (Kan resistant, 50 mg / L) plates, seal the plates and incubate overnight in a 37℃ incubator.

[0064] Colony PCR: Single colonies were picked from overnight LB solid medium containing Kan resistance using a sterile toothpick or pipette tip and transferred to a centrifuge tube containing 1 mL of liquid LB medium containing Kan resistance. The mixture was shaken at 37°C and 200 rpm for colony PCR identification. After the PCR reaction, 1% agarose gel electrophoresis was performed for identification. Once the bands met the expected size, they were sent to Qingke Biotechnology Co., Ltd. for sequencing, and then sequence alignment was performed using Geneious software.

[0065] Plasmid extraction: After confirming correct sequencing alignment, plasmids were extracted using the TIANprep MiniPlasmid Kit IIDP103. The pBAtGRF1 plasmid map is shown below. Figure 1 .

[0066] 2. Agrobacterium-mediated transformation

[0067] The plasmid was transformed into Agrobacterium competent cells using a freeze-thaw method. The specific steps are as follows: The expression vector plasmid returned by Genewiz Biotechnology Co., Ltd. was transformed into Agrobacterium EHA105 (Agrobacterium strain EHA105 was purchased from Shanghai Weidi Biotechnology Co., Ltd.). In a clean bench, 2 μL of plasmid was taken and added to 100 μL of EHA105 Agrobacterium competent cells, and gently tapped to mix. After mixing, the cells were incubated on ice for 5 min, then frozen in liquid nitrogen for 1 min, and then quickly placed in a 37°C water bath for 5 min. 800 μL of LB medium was added, and the cells were incubated at 28°C and 220 rpm for 2 h on a shaker. Spread it evenly on a solid medium containing 50 mg / L kanamycin and 50 mg / L rif, and incubate in the dark at 28°C for two days. Select single-clone plaques and shake them in LB+Kanamycin+Rif liquid for 12 hours. After shaking and mixing, perform positive identification. Agrobacterium-containing solutions that test positive can be stored in a 4°C refrigerator for short-term use. For long-term use, add an equal volume of 50% sterilized glycerol, mix by inversion, and store in a -80°C refrigerator for later stable genetic transformation.

[0068] 3. Pumpkin genetic transformation experiment

[0069] Genetic transformation was carried out using the Jingxin rootstock No. 4.

[0070] (1) Sowing: Select plump and uniformly sized seeds of Jingxin No. 4 pumpkin and soak them in 55℃ warm water for more than half an hour to remove the seed coat. In a clean bench, first wash with 75% alcohol for less than 30 seconds, then soak in 10% NaClO solution for 15 minutes, gently shaking during the process. After disinfection, rinse 5 times with sterile water. Transfer the disinfected seeds to the prepared seed germination medium. Incubate in the dark at 28℃ for 48 hours. When clear vascular bundle ridges appear on the cotyledons, the explants can be cut off.

[0071] (2) Agrobacterium infection: A single colony of positive Agrobacterium EHA105 was picked and placed in 2 mL of LB liquid medium containing 50 mg / L Kan and 50 mg / L Rif, and incubated overnight at 28°C and 220 rpm with a shaker. Then, it was diluted 1:500 and added to 50 mL of fresh LB liquid medium (containing Kan and Rif), and incubated overnight at 28°C and 220 rpm. The next day, when the bacterial culture reached OD...600 At 0.4-0.8, centrifuge at 6000 rpm for 8 min to collect Agrobacterium, resuspend the cells in 1M liquid medium and dilute to OD. 600 Prepare 0.2 mL for later use. Take germinated seeds and, in a clean bench, cut off about 1 / 3 of the distal cotyledons, remove the hypocotyl, and separate the two cotyledons. Each cotyledon will form a U-shaped wound near its proximal end, thus obtaining the explant. Place the cut explants into the prepared resuspension solution and sonicate at 100W for 10 seconds. In the clean bench, remove the plunger of the syringe, add the sonicated cotyledon explants and resuspension solution to the syringe barrel of a 20 mL syringe, gently insert the plunger, and push the plunger forward to the 15 mL mark. Seal the needle hole at the tip of the syringe with a rubber stopper, and slowly pull the plunger backward to the 20 mL mark, holding it for 1.5 minutes to apply a vacuum.

[0072] (3) Co-culture: After infection, the explants were spread on filter paper to gently blot off the attached bacterial solution, and then transferred to a co-culture medium lined with two layers of filter paper. After sealing, they were co-cultured at 23°C in the dark for four days. The luminescence of DsRed was observed using a handheld fluorescent protein observation lamp LUYOR-3415RG dual-wavelength fluorescent protein excitation light source UV lamp to assess the infection efficiency.

[0073] (4) Differentiation and regeneration: Wash the explants 7-8 times with sterile water, blot dry the surface liquid with sterile absorbent paper, and insert the explants obliquely onto the recovery medium. After 7 days of recovery culture, transfer them to the differentiation medium and subculture them approximately every two weeks. After culturing under light for four weeks, use a handheld fluorescent protein observation lamp to select cotyledons containing DsRed fluorescent buds and subculture them into tissue culture flasks containing regeneration medium or elongation medium.

[0074] (5) Identification of positive buds: Positive plants were detected using a handheld fluorescent protein observation lamp, LUYOR-3415RG, with a dual-wavelength fluorescent protein excitation source and ultraviolet light. Following the instructions for use, the red light source was turned on to excite fluorescence, and a corresponding red filter was used to detect whether red fluorescence was expressed.

[0075] The culture medium formula used in this experiment is as follows:

[0076] Seed germination medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / L LABA, pH 5.85-5.90;

[0077] IM liquid medium: 4.43 g / L MS + 30 g / L sucrose + 2 mg / L 6-BA + 1 mg / L ABA + 2.5 MMES + 80 mg / L LAs, pH 5.85-5.90;

[0078] Co-culture medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / LABA + 2.5 M MES + 80 mg / L As + 150 mg / L DTT, pH 5.85-5.90;

[0079] Recovery medium: 4.43 g / L MS + 30 g / L sucrose + 9 g / L Agar + 2 mg / L 6-BA + 1 mg / L ABA + 200 mg / mL TMT, pH 5.85-5.90;

[0080] Differentiation medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / LABA + 200 mg / mL TMT, pH 5.85-5.90;

[0081] Rooting medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 200 mg / mL TMT, pH 5.85-5.90;

[0082] 4. Evaluation of genetic transformation effects

[0083] DsRed fluorescence was observed in the regenerated shoots using a handheld fluorescent lamp to track positive transformation events. The genetic transformation efficiency of the empty vector control without the regeneration-promoting gene was only 0.67% (Table 6), and most of the resulting regenerated shoots were transgene-negative, with no DsRed fluorescence observed. However, healthy regenerated shoots were obtained from transformations using vectors overexpressing the AtGRF family genes. Figure 2 Among them, the overexpression vector containing AtGRF1 showed the most significant improvement in the genetic transformation efficiency of pumpkin, with a genetic transformation efficiency of 16.72%.

[0084] Table 6: Effects of the AtGRF gene on the genetic transformation efficiency of pumpkin

[0085]

[0086] Note: Transgenic plants: regenerated seedlings with complete and healthy plant morphology. Genetic transformation efficiency = (number of transgenic plants / total number of explants) × 100%.

[0087] Next, we investigated the growth and development of the AtGRF1 transgenic plants, and observed the DsRed fluorescence of the leaves, male and female flowers, and fruits of the AtGRF1 transgenic plants. Figure 3 The results showed that transgenic plants containing the AtGRF1 gene had normal leaf size and shape and carried red fluorescence throughout their growth and development. Figure 3 A). Male flowers undergo diapause, appearing shriveled and wrinkled before opening, with some falling off prematurely. However, some male flowers still manage to open and carry fluorescence (…). Figure 3 B). The female flowers developed normally, and the fruits exhibited normal enlargement and fluorescence after self-pollination, with no abnormalities in growth and development. DsRed fluorescence observation of the obtained fruit materials showed that all fruits of the mutant material exhibited DsRed fluorescence, while no DsRed fluorescence was observed in the wild-type fruits. Figure 3 C).

[0088] Copying mature fruits overexpressing the AtGRF1 gene revealed that the seeds overexpressing AtGRF1 were plump and similar in shape and size to wild-type pumpkin seeds. DsRed fluorescence observation using a handheld fluorescent protein lamp showed that no DsRed fluorescence was observed in wild-type pumpkin seeds, while DsRed fluorescence was observed in the seed coat of seeds overexpressing AtGRF1. Figure 4 A). However, when the seed coat was removed and the embryo was examined, it was found that the embryo did not express red fluorescence (A). Figure 4 B). The T1 generation seedlings obtained through further germination also lacked fluorescence ( Figure 4 C). This indicates that overexpression of AtGRF1 leads to the inability of transgenic fragments containing DsRed to be stably inherited by the next generation.

[0089] Example 2: Genetic transformation experiment of ZmGlbpro:AtGRF1 gene

[0090] 1. pBZmGlbpro:AtGRF1 vector construction

[0091] First, the gene sequence of ZmGlbpro was synthesized by Genewiz Biotechnology Co., Ltd. The laboratory vector pBSE403DsR was digested with Sbf1 and Xba1 enzymes, and the vector backbone was recovered. The ZmGlbpro gene sequence was cloned into the digested vector to construct the intermediate vector pBSE403R-ZmGlb. Further, the intermediate vector pBSE403R-ZmGlb was double-digested with XbaI and Sacl enzymes, and the vector fragment was recovered. Using the vector pBAtGRF1 as a template, the AtGRF1 gene was amplified. Finally, the AtGRF1 gene was inserted into the pBSE403R-ZmGlb vector between the XbaI and Sacl restriction sites via homologous recombination to obtain the pBZmGlbpro:AtGRF1 vector. The specific steps are as follows:

[0092] Vector digestion: The intermediate pBSE403R-ZmGlb was double-digested with XbaI enzyme and Sacl enzyme, incubated overnight at 37°C, and then inactivated at 80°C for 10 minutes. The digestion reaction system is shown in Table 7.

[0093] Table 7. Double enzyme digestion system of XbaⅠ and Sacl

[0094]

[0095] Target gene cloning and recovery: AtGRF1 cloning primers were designed using Geneious software and synthesized by Beijing Qingke Biotechnology Co., Ltd. The pBAtGRF1 vector was used as the amplification template, and the primers were supplemented with upstream and downstream adapter sequences for the pBSE403R-ZmGlb vector. High-fidelity PCR was performed using 2×Phanta Flash Master Mix (Dye Plus) to amplify the CDS of the target gene. PCR primers are shown in Table 8, and the amplification reaction system and procedure are the same as those in Tables 3 and 4.

[0096] Table 8 pBAtGRF1 forward and reverse primers

[0097] Primer name sequence ZmGlbpro: AtGRF1-F ATACAGCCAACCCAAGTCTAGAAATGGATTCTTGGAGTTCG ZmGlbpro: AtGRF1-R GAACGAAAGCTCTGAGCTCTCACAGAGAAGGAGCAGT

[0098] After the PCR reaction was completed, 5 μL of the product was subjected to 1% agarose gel electrophoresis. After electrophoresis, the band size was observed on a gel electrophoresis apparatus to check if it matched the size of the target fragment. The expected band was excised and then the gel was extracted using an AxyPrep gel extraction kit.

[0099] Ligation: Then, the target fragment AtGRF1 gel-recovered product and the enzyme-digested pBSE403R-ZmGlb vector were ligated using the ClonExpress II One Step Cloning Kit (Novizan). After preparing the homologous recombination ligation reaction system, it was reacted in a PCR instrument at 37℃ for 30 min. The reaction system is shown in Table 9.

[0100] Table 9 Homologous Recombination Linkage System

[0101]

[0102] Transformation of Escherichia coli: The ligation product was transformed into Escherichia coli DH5α by heat shock. The specific steps are as follows: Take out Escherichia coli DH5α competent cells from the -80℃ freezer, add 10 μL of ligation product to 100 μL of Escherichia coli competent cells, first freeze for 5 min, then react in a 42℃ water bath for 45 s, then freeze for 5 min, then add 700 μL of antibiotic-free LB liquid medium in a clean bench, place in a 37℃ shaker, shake at 200 r / min for 30 min, then take 100 μL and spread evenly on LB solid medium (Kan resistant, 50 mg / L) plates, seal the plates and incubate overnight in a 37℃ incubator.

[0103] Colony PCR: Single colonies were picked from overnight LB solid medium containing Kan resistance using a sterile toothpick or pipette tip and placed into a centrifuge tube containing 1 mL of liquid LB medium containing Kan resistance. The mixture was shaken at 200 rpm at 37°C for colony PCR identification. After the PCR reaction, 1% agarose gel electrophoresis was performed for identification. Once the bands met the expected size, they were sent to Qingke Biotechnology Co., Ltd. for sequencing. Then, Geneious software was used for sequence alignment to compare the obtained AtGRF1 gene coding region sequence with the reference CDS sequence.

[0104] Plasmid extraction: After confirming the sequencing results, plasmids were extracted using the TIANprep Mini Plasmid Kit IIDP103. The plasmid map of pBZmGlbpro:AtGRF1 is shown below. Figure 5 As shown.

[0105] 2. Agrobacterium-mediated transformation

[0106] The method is consistent with the Agrobacterium transformation method in Implementation Case 1.

[0107] 3. Pumpkin genetic transformation experiment

[0108] The genetic transformation method is consistent with that in Implementation Case 1.

[0109] 4. Evaluation of genetic transformation effects

[0110] The regenerated shoots were observed for DsRed fluorescence using a handheld fluorescent lamp to track positive transformation events. With the differentiation medium without ABA as a control, the genetic transformation efficiency of the pBZmGlbpro:AtGRF1 vector was 0% (Table 10). However, when 1 mg / L ABA was added to the differentiation medium, AtGRF1 was induced to express, and the genetic transformation efficiency increased to 4.49%.

[0111] Table 10 Effect of ZmGlbpro:AtGRF1 on the genetic transformation efficiency of pumpkin

[0112]

[0113] Furthermore, we investigated the growth and development of the ZmGlbpro:AtGRF1 transgenic plants. The results showed that the transgenic plants containing ZmGlbpro:AtGRF1 had normal leaf size and shape, both male and female flowers opened normally, and the fruits after self-pollination swelled normally; no significant abnormalities were observed in their growth and development. Subsequently, DsRed fluorescence was observed on the obtained fruit materials using a handheld fluorescent protein lamp. DsRed fluorescence was observed in all fruits from the transgenic plants, while no DsRed fluorescence was observed in the wild-type fruits.

[0114] The mature fruits of the ZmGlbpro:AtGRF1 transgenic plants were copied, and the seeds were found to be plump and similar in shape and size to wild-type pumpkin seeds. Subsequently, DsRed fluorescence was observed in the seeds using a handheld fluorescent lamp. No DsRed fluorescence was observed in the wild-type pumpkin seeds, but DsRed fluorescence was observed in the seed coat of the ZmGlbpro:AtGRF1-containing seeds. Further fluorescence observation of the embryos after removing the seed coat revealed strong red fluorescence. The T1 generation plants obtained through further germination also exhibited fluorescence. Figure 6 This indicates that the transgenic fragments in transgenic plants containing ZmGlbpro:AtGRF1 can be stably inherited by the next generation.

[0115] In summary, using the pBZmGlbpro:AtGRF1 vector driven by the inducible promoter ZmGlbpro to drive AtGRF1 for genetic transformation of pumpkin can significantly improve the genetic transformation efficiency to 4.49%, and the transgenic fragment can be stably inherited.

[0116] Appendix: Explanation of the sequence list

[0117] SEQ ID NO:1: Gene sequence of AtGRF1;

[0118] SEQ ID NO:2: Gene sequence of ZmGlbpro;

[0119] SEQ ID NO:3, 4: Upstream and downstream primer sequences for amplifying the AtGRF1 gene, with upstream and downstream adapter primer sequences for the pAtUBI10 promoter and terminator hspT added to the primers;

[0120] SEQ ID NO:5, 6: upstream and downstream primer sequences for amplifying the AtGRF1 gene, with the pBSE403R-ZmGlb vector upstream and downstream adapter primer sequences added to the primers.

Claims

1. A method for improving the genetic transformation efficiency of pumpkin, characterized in that... Includes the following steps: Using Agrobacterium-mediated genetic transformation to convert bacteria containing... AtGRF Genes and inducible promoters ZmGlbpro The expression vector was transformed into the pumpkin genome to obtain the expression of the [specific expression]. AtGRF The genetically modified pumpkin plant with the gene described AtGRF The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the inducible promoter is described. ZmGlbpro The nucleotide sequence is shown in SEQ ID NO:

2.

2. The method for improving the genetic transformation efficiency of pumpkin as described in claim 1, characterized in that, The specific steps of the genetic transformation are as follows: 1) Construct a structure containing the above AtGRF Genes and inducible promoters ZmGlbpro The carrier of expression; 2) Transform Agrobacterium using the expression vector constructed in step 1); 3) Using pumpkin seed leaves as explants, the explants were infected with transformed Agrobacterium and induced to differentiate. The inducible promoter was then used. ZmGlbpro The expression of the above was obtained under the regulation of the control. AtGRF Transgenic pumpkin plants with genetically modified genes.

Images